Name: in vivo crispr/cas9 screening to simultaneously evaluate gene function in mouse skin and oral cavity
Uploaded: 2020-11-02T13:00:00.000+00:00
Duration: 7 min 52 s
Description: Watch this Scientific Journal Video about In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity at JoVE.com

This work was supported by a project grant from the Canadian Institute of Health Research (CIHR 365252), the Krembil Foundation and the Ontario Research Fund Research Excellence Round 8 (RE08-065). Sampath Kumar Loganathan is the recipient of a Canadian Cancer Society fellowship (BC-F-16#31919).

<ol>
	<li>Beronja, S., Fuchs, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi-mediated+gene+function+analysis+in+skin.">RNAi-mediated gene function analysis in skin.</a> Methods in Molecular Biology. 961, 351-361 (2013).</li><li>Beronja, S., Livshits, G., Williams, S., Fuchs, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+functional+dissection+of+genetic+networks+via+tissue-specific+transduction+and+RNAi+in+mouse+embryos.">Rapid functional dissection of genetic networks via tissue-specific transduction and RNAi in mouse embryos.</a> Nature Medicine. 16, 821-827 (2010).</li><li>Shalem, O., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+screening+in+human+cells.">Genome-scale CRISPR-Cas9 knockout screening in human cells.</a> Science. 343, 84-87 (2014).</li><li>Beronja, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+screens+in+mice+identify+physiological+regulators+of+oncogenic+growth.">RNAi screens in mice identify physiological regulators of oncogenic growth.</a> Nature. 501, 185-190 (2013).</li><li>Loganathan, S. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rare+driver+mutations+in+head+and+neck+squamous+cell+carcinomas+converge+on+NOTCH+signaling.">Rare driver mutations in head and neck squamous cell carcinomas converge on NOTCH signaling.</a> Science. 367, 1264-1269 (2020).</li><li>Leemans, C. R., Snijders, P. J. F., Brakenhoff, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+landscape+of+head+and+neck+cancer.">The molecular landscape of head and neck cancer.</a> Nature Reviews Cancer. 18, 269-282 (2018).</li><li>Green, A. C., Olsen, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutaneous+squamous+cell+carcinoma:+an+epidemiological+review.">Cutaneous squamous cell carcinoma: an epidemiological review.</a> British Journal of Dermatology. 177, 373-381 (2017).</li><li>Campbell, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=pathway+network,+and+immunologic+features+distinguishing+squamous+carcinomas.">pathway network, and immunologic features distinguishing squamous carcinomas.</a> Cell Reports. 23, 194-212 (2018).</li><li>Sanjana, N. E., Shalem, O., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+vectors+and+genome-wide+libraries+for+CRISPR+screening.">Improved vectors and genome-wide libraries for CRISPR screening.</a> Nature Methods. 11, 783-784 (2014).</li><li>Geraerts, M., Willems, S., Baekelandt, V., Debyser, Z., Gijsbers, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+lentiviral+vector+titration+methods.">Comparison of lentiviral vector titration methods.</a> BMC Biotechnology. 6, 34 (2006).</li><li>Schramek, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+in+vivo+RNAi+screen+unveils+myosin+IIa+as+a+tumor+suppressor+of+squamous+cell+carcinomas.">Direct in vivo RNAi screen unveils myosin IIa as a tumor suppressor of squamous cell carcinomas.</a> Science. 343, 309-313 (2014).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159, 440-455 (2014).</li><li>Langmead, B., Trapnell, C., Pop, M., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrafast+and+memory-efficient+alignment+of+short+DNA+sequences+to+the+human+genome.">Ultrafast and memory-efficient alignment of short DNA sequences to the human genome.</a> Genome Biology. 10, 25 (2009).</li><li>Li, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAGeCK+enables+robust+identification+of+essential+genes+from+genome-scale+CRISPR/Cas9+knockout+screens.">MAGeCK enables robust identification of essential genes from genome-scale CRISPR/Cas9 knockout screens.</a> Genome Biology. 15, 554 (2014).</li><li>Winters, I. P., Murray, C. W., Winslow, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Towards+quantitative+and+multiplexed+in+vivo+functional+cancer+genomics.">Towards quantitative and multiplexed in vivo functional cancer genomics.</a> Nature Reviews Genetics. 19, 741-755 (2018).</li><li>Rogers, Z. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+the+in+vivo+fitness+landscape+of+lung+adenocarcinoma+tumor+suppression+in+mice.">Mapping the in vivo fitness landscape of lung adenocarcinoma tumor suppression in mice.</a> Nature Genetics. 50, 483-486 (2018).</li><li>Chow, R. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV-mediated+direct+in+vivo+CRISPR+screen+identifies+functional+suppressors+in+glioblastoma.">AAV-mediated direct in vivo CRISPR screen identifies functional suppressors in glioblastoma.</a> Nature Neuroscience. 20, 1329-1341 (2017).</li><li>Wang, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mapping+a+functional+cancer+genome+atlas+of+tumor+suppressors+in+mouse+liver+using+AAV-CRISPR&#8211;mediated+direct+in+vivo+screening.">Mapping a functional cancer genome atlas of tumor suppressors in mouse liver using AAV-CRISPR&#8211;mediated direct in vivo screening.</a> Science Advances. 4, 5508 (2018).</li><li>Chan, K., Tong, A. H. Y., Brown, K. R., Mero, P., Moffat, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pooled+CRISPR-based+genetic+screens+in+mammalian+cells.">Pooled CRISPR-based genetic screens in mammalian cells.</a> Journal of Visualized Experiments. (151), e59780 (2019).</li><li>Hart, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+CRISPR+screens+reveal+fitness+genes+and+genotype-specific+cancer+liabilities.">High-resolution CRISPR screens reveal fitness genes and genotype-specific cancer liabilities.</a> Cell. 163, 1515-1526 (2015).</li></ol>

The authors have nothing to disclose.

CRISPR/Cas9 genome editing has been widely used in in vitro and in vivo studies to investigate gene functions and cellular processes. Most in vivo studies utilize CRISPR/Cas9 gene edited cells grafted into an animal model (allograft or xenograft). While this is a powerful tool to study cancer genetics and cellular functions, it still lacks the native tissue microenvironment and might elicit wounding and/or immune responses.
To overcome these challenges, several groups have pioneered direct in vivo CRISPR approaches generating several, multiplexed autochthonous mouse models over the last few years15,16,17,18. These projects usually rely on adeno-associated virus (AAV) to deliver sgRNAs to target organs. AAV allows for generation of very higher titer thereby facilitating production high titer virus required for in vivo manipulations. However, usage of AAVs severely limits the number of genes that can be analysed to about 40-50 genes, as AAVs, unlike lentivirus, do not stably integrate into genomic DNA, making readout of sgRNA libraries impractical. AAV based screening necessitates direct readout of mutations in target sites using e.g., targeted capture sequencing. However, multiplexed PCR-based capture sequencing restricts the number of capturable targets in a &#8216;screenable&#8217; library usually to the order of dozens15,16,17,18.
Compared to AAV in vivo CRISPR screens, the methodology described here uses lentiviral sgRNAs. Given that lentiviral constructs integrate into the target cell&#8217;s DNA, sgRNA representation can be analysed in genomic DNA similar to any conventional CRISPR screens19,20. Thus, this methodology allows the simultaneous analysis of hundreds of genes and can be seamlessly scaled-up even to genome-wide in vivo screens. For example, a genome-wide screen with 78,000 sgRNAs and a coverage of 30x would require ~90 embryos as previously described for a similar shRNA screen4. As the litter sizes of most common inbred mouse strains is around 8-12 pups/litter and an experienced surgeon can easily inject all mice within a littler, only about ~10-12 dams and surgeries would be required for such a genome-wide screen.
The success of an in vivo screen hinges on high titer virus production. While lentiviral constructs that express a sgRNA of interest, Cas9 and Cre (e.g., pSECC) are a convenient and feasible all-in-one solution, they have the packaging limit for the lentiviral capsid (~10 kb in total size), leading to overall lower viral titer. To overcome this challenge, we use R26-LSL-Cas9-GFP mice and a lenti-viral construct containing only Cre-recombinase along with a sgRNA. The resulting lentiviral construct is only 7 kb in length and yields a viral titer of more than 108 PFU/mL.
Targeted and specific libraries can be quickly generated in as little as a few days and the complex network of genetic interactions can be studied in vivo within a few weeks. Cas9-mediated mutagenesis can be performed either in wild-type mice to study organ development, homeostasis or disease phenotypes (cancer, inflammatory skin diseases, etc.) or can be easily combined with mice harboring any oncogenic mutations or combination of mutations to model the genetic status found in human patients. In addition, the cloning methodology can be refined to clone CRISPRa or CRISPRi libraries by adding compatible restriction sites and sgRNA sequences in all-in-one plasmid. Of note, all the libraries that manipulate gene functions can be used not only in mouse models but also in other animal models and in organoid cultures. Together, this methodology highlights the utility and provides a boilerplate to use direct in vivo CRISPR to integrate somatic gene editing and mouse modeling to rapidly assess gene function in vivo.

One of the challenges for cancer research in the post-genomic era is to mine the vast amount of genome data for causal gene mutations and to identify nodes in the gene network that can be targeted therapeutically. While bioinformatic analyses have helped immensely towards these goals, establishing efficient in vitro and in vivo models is a prerequisite to decipher the complexity of biological systems and disease states and for enabling drug development. While conventional transgenic mouse models have been used extensively for in vivo cancer genetics studies, their cost-, time- and labor-intensive nature has largely prohibited the systematic analysis of the hundreds of putative cancer genes unraveled by modern genomics. To overcome this bottleneck, we combined a previously established ultrasound-guided in utero injection methodology1,2 with a CRISPR/Cas9 (Clustered Regularly Interspaced Short Palindromic Repeats) gene editing technology3 to simultaneously induce and study loss-of-function mutations of hundreds of genes in skin and oral cavity of a single mouse.
The methodology described here utilizes ultrasound-guided injections of engineered lentiviruses into the amniotic cavity of living mouse embryos at embryonic day E9.5. The lentiviral cargo containing CRISPR/Cas9 components transduce the single-layered surface ectoderm, which later gives rise to the epithelium of the skin and oral cavity. Skin is composed of an outer epidermis, followed by basement membrane and dermis. Epidermis is a stratified epithelium composed of an inner, basal layer, which maintains contact with the basement membrane and has proliferative and stem cell capacity. The basal layer gives rise to the differentiated layers above such as spinous, granular and stratum corneum layers2,4. Lineage tracing studies show that this direct in vivo CRISPR/Cas9 method genetically manipulates tissue-resident stem cells within the basal layer that persist throughout adulthood. As lentivirus can be titrated to transduce the E9.5 surface ectoderm at clonal density, this method can be used to generate mosaic mice harboring thousands of discrete gene knock-out clones. Next generation sequencing can then be used to analyze the effect of CRISPR/Cas9-mediated gene ablation within those clones in a multiplexed manner5.
We recently used this method to assess the function of 484 genes that show recurrent mutations in human Head and Neck Squamous Cell Carcinoma (HNSCC)5. HNSCC is a devastating cancer with a high mortality rate of 40&#8211;50% and it is the 6th most common cancer worldwide6. HNSCC arise in mucosal linings of the upper airway or oral cavity and are associated with tobacco and alcohol consumption or human papillomavirus (HPV) infection. Cutaneous Squamous Cell Carcinoma (SCC) are skin tumors and represent the second most common cancer in humans7. Cutaneous SCC and HNSCC are histologically and molecularly very similar, with a high percentage of cases exhibiting alteration in TP53, PIK3CA, NOTCH1, and HRAS8. While there are only a handful of genes mutated at high frequency, there are hundreds of genes found mutated at low frequency (&#60; 5%), a phenomenon commonly referred to as the long-tail distribution. As the majority of the long-tail genes lack biological or clinical validation, we used this in vivo CRISPR screening technology to model loss-of-function of these genes in tumor-prone mice with sensitizing mutations in p53, Pik3ca or Hras and identified several novel tumor suppressor genes that cooperate with p53, Pik3ca or Hras to trigger tumor development5.
Here, we describe a detailed protocol to generate multiplexed sgRNA lentiviral CRISPR sgRNA libraries and perform CRISPR/Cas9 gene knock-out screens in the mouse surface ectoderm. Of note, this methodology can be adapted to incorporate other gene manipulation technologies such as CRISPR activation (CRISPRa) and CRISPR inactivation (CRISPRi) or modified to target other organ systems in mouse to study gene functions.

<table><tbody><tr><td>0.45 micron filter</td><td>Sigma</td><td>S2HVU02RE</td><td></td></tr><tr><td>12k or 92k oligo chip</td><td>Customarray Inc. (Genscript)</td><td></td><td></td></tr><tr><td>15 cm cell culture plates</td><td>Corning</td><td></td><td></td></tr><tr><td>293FT</td><td>Invitrogen</td><td>R70007</td><td></td></tr><tr><td>293NT</td><td>Systems Biosciences</td><td>LV900A-1</td><td></td></tr><tr><td>Alkaline phosphatase</td><td>NEB</td><td>M0290L</td><td></td></tr><tr><td>Amplicillin</td><td>Fisher Scientific</td><td>BP1760-25</td><td></td></tr><tr><td>ATP</td><td>NEB</td><td>9804S</td><td></td></tr><tr><td>BsmBI</td><td>NEB</td><td>R0580L</td><td></td></tr><tr><td>Chromic gut suture</td><td>Covidien</td><td></td><td></td></tr><tr><td>Deep sequencing (Next-Seq or Hi-Seq)</td><td>Illumina</td><td></td><td></td></tr><tr><td>DNA-cleanup kit</td><td>Zymo Research</td><td>D4008</td><td></td></tr><tr><td>DNAesy Blood and Tissue DNA extraction kit</td><td>Qiagen</td><td>69506</td><td></td></tr><tr><td>Endura electrocompetent cells</td><td>Lucigen</td><td>60242-1</td><td></td></tr><tr><td>Glass Capillaries</td><td>Drummond</td><td>3-000-203-G/X</td><td></td></tr><tr><td>HEK293T cells</td><td>ATCC</td><td>CRL-3216</td><td></td></tr><tr><td>High-Speed Centrifuge</td><td>Beckman Coulter</td><td>MLS-50</td><td></td></tr><tr><td>LB Agar</td><td>Wisent Technologies</td><td>800-011-LG</td><td></td></tr><tr><td>Micropipette puller</td><td>Sutter Instrument</td><td>P97</td><td></td></tr><tr><td>Mineral oil</td><td>Sigma</td><td>M5904</td><td></td></tr><tr><td>Mini-prep plasmid Kit</td><td>Frogga Bio</td><td>PDH300</td><td></td></tr><tr><td>Mouse oxygen anaesthesia system</td><td>Visual Sonics</td><td></td><td></td></tr><tr><td>Nanoject II micromanipulator</td><td>Drummond</td><td></td><td></td></tr><tr><td>NEBuffer 3.1 (Buffer for BsmBI)</td><td>NEB</td><td>R0580L</td><td></td></tr><tr><td>Needle sharpener</td><td>Sutter Instrument</td><td>BV-10</td><td></td></tr><tr><td>Oligo cleanup kit</td><td>Zymo research</td><td>D4060</td><td></td></tr><tr><td>PAGE purified illumina sequencing primer</td><td>IDT DNA</td><td></td><td></td></tr><tr><td>PEI (polyethyleneimine)</td><td>Sigma</td><td>408727-100ML</td><td></td></tr><tr><td>Permoplast modeling clay</td><td></td><td></td><td></td></tr><tr><td>Petridish with central opening</td><td>Visual Sonics</td><td></td><td></td></tr><tr><td>pMD2.G</td><td>Addgene</td><td>12259</td><td></td></tr><tr><td>psPAX2</td><td>Addgene</td><td>12260</td><td></td></tr><tr><td>Q5 Polymerase 2x Master mix</td><td>NEB</td><td>M0494L</td><td></td></tr><tr><td>Qubit Fluorometric Quantification</td><td>Invitrogen</td><td>Q33327</td><td></td></tr><tr><td>Semicircular Silicone plug</td><td>Corning</td><td></td><td></td></tr><tr><td>Silicone membrane</td><td>Visual Sonics</td><td></td><td></td></tr><tr><td>T4 DNA ligase</td><td>NEB</td><td>M0202L</td><td></td></tr><tr><td>Ultra-centrifuge tubes</td><td>Beckman Coulter</td><td>344058</td><td></td></tr><tr><td>Vevo2000 ultrasound system</td><td>Visual Sonics</td><td></td><td></td></tr></tbody></table>

in vivo crispr/cas9 screening to simultaneously evaluate gene function in mouse skin and oral cavity

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to assess therapeutic avenues. However, their time-, labor- and cost-intensive nature limits their utility for systematic analysis of gene function. Recent advances in genome-editing technologies overcome those limitations and allow for the rapid generation of specific gene perturbations directly within specific mouse organs in a multiplexed and rapid manner. Here, we describe a CRISPR/Cas9-based method (Clustered Regularly Interspaced Short Palindromic Repeats) to generate thousands of gene knock-out clones within the epithelium of the skin and oral cavity of mice, and provide a protocol detailing the steps necessary to perform a direct&#160;in vivo&#160;CRISPR&#160;screen for tumor suppressor genes. This approach can be applied to other organs or other CRISPR/Cas9 technologies such as CRISPR-activation or CRISPR-inactivation to study the biological function of genes during tissue homeostasis or in various disease settings.

Figure 1A shows the design of the oligonucleotides for multiplexing several custom CRISPR libraries in a cost-effective manner in a single 12k or 92k oligo chip. Once the sgRNAs (blue color coded) are selected, the oligonucleotides are designed with restriction sites (orange colored BsmBI) and library specific PCR primer pairs (green color coded). Several libraries can be designed by using unique combination of primer pairs for multiplexing in a single oligo chip. When PCR amplifying the libraries using a specific PCR primer pair, always include a water only negative control and run all the reactions on an agarose gel. The negative control lane should not have any bands at 100 bp, while the library amplified lane should have a single 100 bp band. If there is no band, make sure the PCR primer pair is selected appropriately. Figure 1B shows the quality control step of the cloned library and the viral production and concentration procedure. Care should be taken to preserve the equal representation of sgRNAs from cloning till transduction. Next-generation sequencing reads of PCR amplified DNA from plasmid and lenti-viral library transduced cells should show a high correlation. Any deviation must be analyzed carefully to examine whether the representation is lost before or after the lenti-virus preparation. If the sgRNA reads from plasmid DNA do not show equal representation of sgRNAs, then the viral preparation and concentration procedure must be repeated with care. If the loss of equal sgRNA representation occurred in plasmid DNA, then the entire cloning procedure must be repeated including PCR amplification of libraries from oligo chip with reduced amplification cycles. The success of the CRISPR library screening depends critically on equal representation of the sgRNAs present in the library.
Figure 2 shows the ultrasound-guided micro-injection set up for manipulating the E9.5 embryos in pregnant mouse. The entire set-up is placed under a biosafety level class II cabinet to maintain the sterile condition of the entire procedure and to avoid any infection of the pregnant mouse due to the surgical procedures. Care should be taken to avoid pressuring the uterine horns while injecting. The needle must be very sharp, so that the wound on the uterine wall and the amniotic membrane is minimal.
Figure 3 shows the results of the ultra-sound guided injection of lenti-virus carrying Cre-recombinase in E9.5 Lox-stop-Lox (LSL) Confetti mouse pups at postnatal day (P)0. Viral titer can be adjusted to get an appropriate transduction coverage of the epidermis. While high titer of virus would result in larger coverage of the mouse skin, it would also result in transduction of multiple sgRNAs into the same cell potentially confounding the outcomes. To reduce multiple transductions of a single cell, the infection rate should be kept &#60;20%.
Figure 4 shows next-generation sequencing reads of PCR amplified DNA from plasmid and lenti-viral library transduced cells and also reads from 4 representative tumors. sgRNA guides targeting Adam10 and Ripk4 are enriched in the tumor samples (triangles and diamonds) compared to sgRNA presentation in plasmid pool or infected cells. Adam10 and Ripk4 function as tumor suppressors5. Several hundred tumors can be multiplexed by assigning unique barcodes to each sample and deep sequenced as outlined in the protocol.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61693/61693fig01.jpg" /> 
Figure 1: Cloning of targeted CRISPR library.&#160;(A) Schematic representing the design of oligonucleotides for the 12 k or 92 k custom oligo chip. BsmBI (or other compatible) restriction sites (orange color coded and underlined) were added on each side of the sgRNA. Arrow heads indicate the BsmBI cut site. For each library, a unique pair of PCR primers (green, brown and purple color coded) were added, so that it can be specifically amplified using PCR from the pooled chip. Several custom libraries can be multiplexed up to 12k or 92k oligos. (B) Graph showing sgRNA representation from a CRISPR library in plasmid DNA versus DNA from cells transduced with the same lentiviral library. Each dot represents a guide. Full representation was maintained after transduction with some correlation in abundance. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61693/61693fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61693/61693fig02v2.jpg" /> 
Figure 2: Picture of the ultrasound-guided microinjection set-up.&#160;(A) Mouse carrying E9.5 embryos was anesthetized and placed on a heated platform with the uterus exposed in a PBS filled modified Petri dish chamber (stabilized by four modeling clay). The blue semi-round rubber supported the uterus containing embryos and the injection needle from the microinjector is positioned on the right side. The ultrasound scan head was mounted on the top relaying live image to the monitor behind with needle head visible. (B) Close-up ultra-sound image of an E9.5 embryo. Lentiviral library was injected with the needle (seen on right side) into the amniotic cavity. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61693/61693fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61693/61693fig03.jpg" /> 
Figure 3: Successful transduction of surface epithelium in mouse.&#160;Fluorescent images of whole-body, oral cavity, tongue, and palate of newborn Cre-reporter LSL-Confetti mice transduced with Cre lentivirus (Inlet: corresponding white light images). Scale bars = 500 &#956;m <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61693/61693fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61693/61693fig04.jpg" /> 
Figure 4: Deep sequencing of tumor samples.&#160;Graph showing sgRNA representation from a CRISPR library in plasmid DNA versus DNA from cells transduced with the same lentiviral library and in addition to reads from 4 representative tumors. The red and green circles denote the number of Adam10 and Ripk4 sgRNA reads in library and transduced cells whereas the red triangle represents the reads of Adam10 sgRNAs and the green diamond represents reads of Ripk4 sgRNAs identified in tumors from separate HNSCC mice showing a 1000x fold enrichment. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61693/61693fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR1 Forward Primer</td>
			<td>GAGGGCCTATTTCCCATGATTC</td>
		</tr>
		<tr>
			<td>PCR1 Reverse Primer</td>
			<td>CAAACCCAGGGCTGCCTTGGAA</td>
		</tr>
	</tbody>
</table>
Table 1: Primers for PCR1 reaction. The forward and reverse primers used for amplification of the region surrounding sgRNA cassette from genomic DNA of cells transduced with the lenti virus.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>&#160;</td>
		</tr>
		<tr>
			<td>1</td>
			<td>98 &#176;C</td>
			<td>30 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>2</td>
			<td>98 &#176;C</td>
			<td>10 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>3</td>
			<td>66 &#176;C</td>
			<td>30 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>4</td>
			<td>72 &#176;C</td>
			<td>15 sec</td>
			<td>15 cycles (step 2-4)</td>
		</tr>
		<tr>
			<td>5</td>
			<td>72 &#176;C</td>
			<td>2 min</td>
			<td></td>
		</tr>
		<tr>
			<td>6</td>
			<td>4 &#176;C</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 2: PCR1 cycle parameters. PCR conditions used for the amplification of the region surrounding sgRNA cassette from genomic DNA of cells transduced with the lenti virus.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>501 FW</td>
			<td colspan="3">AATGATACGGCGACCACCGAGATCTACACTATAGCCTACACTCTTTCCCTACACG 
			ACGCTCTTCCGATCTtgtggaaaggacgaaaCACCG</td>
		</tr>
		<tr>
			<td>701 RV</td>
			<td colspan="3">CAAGCAGAAGACGGCATACGAGATCGAGTAATGTGACTGGAGTTCAGACGTGTGCT 
			CTTCCGATCTATTTTAACTTGCTATTTCTAGCTCTAAAAC</td>
		</tr>
		<tr>
			<td colspan="4">* The underlined bases indicate the Illumina (D501-510 for forward and D701-712 for reverse) barcode location that were used for multiplexing.</td>
		</tr>
		<tr>
			<td colspan="4">* Red colored bases indicate the sequence that bind to the target site on the lentiviral CRISPR plasmid. This region can be modified according to the lentiviral vector used.</td>
		</tr>
	</tbody>
</table>
Table 3: Barcoding Primers for PCR2 reaction. Primers used to barcode amplify each tumor sample (either directly from genomic DNA or using the products from PCR1 as template). The underlined region indicates the unique barcode region that can be assigned for each sample for multiplexing in a deep sequencing reaction. The red colored base pairs indicate the target region in the lentiviral construct that these primers bind. This target region can be modified according to the type of lentiviral construct used.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>&#160;</td>
		</tr>
		<tr>
			<td>1</td>
			<td>98 &#176;C</td>
			<td>30 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>2</td>
			<td>98 &#176;C</td>
			<td>10 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>3</td>
			<td>68 &#176;C</td>
			<td>30 sec</td>
			<td></td>
		</tr>
		<tr>
			<td>4</td>
			<td>72 &#176;C</td>
			<td>15 sec</td>
			<td>10 cycles (step 2-4)</td>
		</tr>
		<tr>
			<td>5</td>
			<td>72 &#176;C</td>
			<td>2 min</td>
			<td></td>
		</tr>
		<tr>
			<td>6</td>
			<td>4 &#176;C</td>
			<td>Hold</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 4: PCR2 cycle parameters. PCR conditions used to barcode amplify each tumor sample (either directly from genomic DNA or using the products from PCR1 as template).

Watch this Scientific Journal Video about In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity at JoVE.com

In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Here we describe a rapid and direct in vivo CRISPR/Cas9 screening methodology using ultrasound-guided in utero embryonic lentiviral injections to simultaneously assess functions of several genes in the skin and oral cavity of immunocompetent mice.

Genetically modified mouse models (GEMM) have been instrumental in assessing gene function, modeling human diseases, and serving as preclinical model to ...

in-vivo-crisprcas9-screening-to-simultaneously-evaluate-gene-function

Nanyang Technological University

Research

JoVE Journal

Genetics

6.3K Views.  Lunenfeld-Tanenbaum Research Institute, Mount Sinai Hospital. Hier beschrijven we een snelle en directe in vivo CRISPR/Cas9 screeningsmethodologie met behulp van echogeleide in utero embryonale lentivirale injecties om tegelijkertijd functies van verschillende genen in de huid en mondholte van immunocompetente muizen te beoordelen.

Video: In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Using a Fluorescent PCR-capillary Gel Electrophoresis Technique to Genotype CRISPR/Cas9-mediated Knockout Mutants in a High-throughput Format

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play in the functioning of cells and whole organisms. This cause has been tremendously aided by the recent introduction of the CRISPR/Cas9 system-a versatile tool that allows researchers to manipulate the genome and transcriptome in order to, among other things, knock out, knock down, or knock in genes in a targeted manner. For the purpose of knocking out a gene, CRISPR/Cas9-mediated double-strand breaks recruit the non-homologous end-joining DNA repair pathway to introduce the frameshift-causing insertion or deletion of nucleotides at the break site. However, an individual guide RNA may cause undesirable off-target effects, and to rule these out, the use of multiple guide RNAs is necessary. This multiplicity of targets also means that a high-volume screening of clones is required, which in turn begs the use of an efficient high-throughput technique to genotype the knockout clones. Current genotyping techniques either suffer from inherent limitations or incur high cost, hence rendering them unsuitable for high-throughput purposes. Here, we detail the protocol for using fluorescent PCR, which uses genomic DNA from crude cell lysate as a template, and then resolving the PCR fragments via capillary gel electrophoresis. This technique is accurate enough to differentiate one base-pair difference between fragments and hence is adequate in indicating the presence or absence of a frameshift in the coding sequence of the targeted gene. This precise knowledge effectively precludes the need for a confirmatory sequencing step and allows users to save time and cost in the process. Moreover, this technique has proven to be versatile in genotyping various mammalian cells of various tissue origins targeted by guide RNAs against numerous genes, as shown here and elsewhere.

The genotyping technique described here, which couples fluorescent polymerase chain reaction (PCR) to capillary gel electrophoresis, allows for high-throughput genotyping of nuclease-mediated knockout clones. It circumvents limitations faced by other genotyping techniques and is more cost effective than sequencing methods.

The development of programmable genome-editing tools has facilitated the use of reverse genetics to understand the roles specific genomic sequences play ...

Using CRISPR/Cas9 Gene Editing to Investigate the Oncogenic Activity of Mutant Calreticulin in Cytokine Dependent Hematopoietic Cells

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to generate RNA-guided nucleases, such as CRISPR-associated (Cas) 9 for site-specific eukaryotic genome editing. Genome engineering by Cas9 is used to efficiently, easily and robustly modify endogenous genes in many biomedically-relevant mammalian cell lines and organisms. Here we show an example of how to utilize the CRISPR/Cas9 methodology to understand the biological function of specific genetic mutations. We model calreticulin (CALR) mutations in murine interleukin-3 (mIL-3) dependent pro-B (Ba/F3) cells by delivery of single guide RNAs (sgRNAs) targeting the endogenous Calr locus in the specific region where insertion and/or deletion (indel) CALR mutations occur in patients with myeloproliferative neoplasms (MPN), a type of blood cancer. The sgRNAs create double strand breaks (DSBs) in the targeted region that are repaired by non-homologous end joining (NHEJ) to give indels of various sizes. We then employ the standard Ba/F3 cellular transformation assay to understand the effect of physiological level expression of Calr mutations on hematopoietic cellular transformation. This approach can be applied to other genes to study their biological function in various mammalian cell lines.

Targeted gene editing using CRISPR/Cas9 has greatly facilitated the understanding of the biological functions of genes. Here, we utilize the CRISPR/Cas9 methodology to model calreticulin mutations in cytokine-dependent hematopoietic cells in order to study their oncogenic activity.

Clustered regularly interspaced short palindromic repeats (CRISPR) is an adaptive immunity system in prokaryotes that has been repurposed by scientists to ...

Cancer Research

Using Mouse Oocytes to Assess Human Gene Function During Meiosis I

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively correlated with maternal age, age alone is not always predictive of the risk of generating an aneuploid embryo. Therefore, gene variants might account for incorrect chromosome segregation during oogenesis. Given that access to human oocytes is limited for research purposes, a series of assays were developed to study human gene function during meiosis I using mouse oocytes. First, messenger RNA (mRNA) of the gene and gene variant of interest are microinjected into prophase I-arrested mouse oocytes. After allowing time for expression, oocytes are synchronously released into meiotic maturation to complete meiosis I. By tagging the mRNA with a sequence of a fluorescent reporter, such as green fluorescent protein (Gfp), the localization of the human protein can be assessed in addition to the phenotypic alterations. For example, gain or loss of function can be investigated by establishing experimental conditions that challenge the gene product to fix meiotic errors. Although this system is advantageous in investigating human protein function during oogenesis, adequate interpretation of results should be undertaken given that protein expression is not at endogenous levels and, unless controlled for (i.e. knocked out or down), murine homologs are also present in the system.

As the genetic variants associated with human disease begin to become uncovered, it is becoming increasingly important to develop systems with which to rapidly evaluate the biological significance of those identified variants. This protocol describes methods for evaluating human gene function during female meiosis I using mouse oocytes.

Embryonic aneuploidy is the major genetic cause of infertility in humans. Most of these events originate during female meiosis, and albeit positively ...

Pooled CRISPR-Based Genetic Screens in Mammalian Cells

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian cells, this technology represents a novel means to perform genome-wide genetic screens for functional genomics studies. Libraries of guide RNAs (sgRNA) targeting all open reading frames permit the facile generation of thousands of genetic perturbations in a single pool of cells that can be screened for specific phenotypes to implicate gene function and cellular processes in an unbiased and systematic way. CRISPR-Cas screens provide researchers with a simple, efficient, and inexpensive method to uncover the genetic blueprints for cellular phenotypes. Furthermore, differential analysis of screens performed in various cell lines and from different cancer types can identify genes that are contextually essential in tumor cells, revealing potential targets for specific anticancer therapies. Performing genome-wide screens in human cells can be daunting, as this involves the handling of tens of millions of cells and requires analysis of large sets of data. The details of these screens, such as cell line characterization, CRISPR library considerations, and understanding the limitations and capabilities of CRISPR technology during analysis, are often overlooked. Provided here is a detailed protocol for the successful performance of pooled genome-wide CRISPR-Cas9 based screens.

CRISPR-Cas9 technology provides an efficient method to precisely edit the mammalian genome in any cell type and represents a novel means to perform genome-wide genetic screens. A detailed protocol discussing the steps required for the successful performance of pooled genome-wide CRISPR-Cas9 screens is provided here.

Genome editing using the CRISPR-Cas system has vastly advanced the ability to precisely edit the genomes of various organisms. In the context of mammalian ...

Generation of Genetically Modified Mice through the Microinjection of Oocytes

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear injection of DNA expression constructs into fertilized oocytes remains the most commonly used technique to generate transgenic mice for overexpression. With the introduction of CRISPR technology for gene targeting, pronuclear injection into fertilized oocytes has been extended to the generation of both knockout and knockin mice. This work describes the preparation of DNA for injection and the generation of CRISPR guides for gene targeting, with a particular emphasis on quality control. The genotyping procedures required for the identification of potential founders are critical. Innovative genotyping strategies that take advantage of the "multiplexing" capabilities of CRISPR are presented herein. Surgical procedures are also outlined. Together, the steps of the protocol will allow for the generation of genetically modified mice and for the subsequent establishment of mouse colonies for a plethora of research fields, including immunology, neuroscience, cancer, physiology, development, and others.

The microinjection of mouse oocytes is commonly used for both classic transgenesis (i.e., the random integration of transgenes) and CRISPR-mediated gene targeting. This protocol reviews the latest developments in microinjection, with a particular emphasis on quality control and genotyping strategies.

The use of genetically modified mice has significantly contributed to studies on both physiological and pathological in vivo processes. The pronuclear ...

Developmental Biology

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding sites for transcriptional regulators to modulate gene expression. Alterations of CREs have been implicated in various diseases including cancer. While promoters and enhancers have been the primary CREs for studying gene regulation, very little is known about the role of silencer, which is another type of CRE that mediates gene repression. Originally identified as an adaptive immunity system in prokaryotes, CRISPR/Cas9 has been exploited to be a powerful tool for eukaryotic genome editing. Here, we present the use of this technique to delete an intronic silencer in the human RUNX1 gene and investigate the impacts on gene expression in OCI-AML3 leukemic cells. Our approach relies on electroporation-mediated delivery of two preassembled Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complexes to create two double-strand breaks (DSBs) that flank the silencer. Deletions can be readily screened by fragment analysis. Expression analyses of different mRNAs transcribed from alternative promoters help evaluate promoter-dependent effects. This strategy can be used to study other CREs and is particularly suitable for hematopoietic cells, which are often difficult to transfect with plasmid-based methods. The use of a plasmid- and virus-free strategy allows simple and fast assessments of gene regulatory functions.

Investigation of the Transcriptional Role of a RUNX1 Intronic Silencer by CRISPR/Cas9 Ribonucleoprotein in Acute Myeloid Leukemia Cells

Direct delivery of preassembled Cas9/guide RNA ribonucleoprotein complexes is a fast and efficient means for genome editing in hematopoietic cells. Here, we utilize this approach to delete a RUNX1 intronic silencer and examine the transcriptional responses in OCI-AML3 leukemic cells.

The bulk of the human genome (~98%) is comprised of non-coding sequences. Cis-regulatory elements (CREs) are non-coding DNA sequences that contain binding ...

Cell Surface Receptor Identification Using Genome-Scale CRISPR/Cas9 Genetic Screens

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and functioning of multicellular organisms. Detecting these interactions remains technically challenging, however. This manuscript describes a systematic genome-scale CRISPR/Cas9 knockout genetic screening approach that reveals cellular pathways required for specific cell surface recognition events. This assay utilizes recombinant proteins produced in a mammalian protein expression system as avid binding probes to identify interaction partners in a cell-based genetic screen. This method can be used to identify the genes necessary for cell surface interactions detected by recombinant binding probes corresponding to the ectodomains of membrane-embedded receptors. Importantly, given the genome-scale nature of this approach, it also has the advantage of not only identifying the direct receptor but also the cellular components that are required for the presentation of the receptor at the cell surface, thereby providing valuable insights into the biology of the receptor.

This manuscript describes a genome-scale cell-based screening approach to identify extracellular receptor-ligand interactions.

Intercellular communication mediated by direct interactions between membrane-embedded cell surface receptors is crucial for the normal development and ...

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors of the diseases. To validate the contribution of a dysfunction of the mutated genes to disease development, the generation of animal models carrying the mutations is one obvious approach. While germline genetically engineered mouse models (GEMMs) are popular biological tools and exhibit reproducible results, it is restricted by time and costs. Meanwhile, non-germline GEMMs often enable exploring gene function in a more feasible manner. Since some brain diseases (e.g., brain tumors) appear to result from somatic but not germline mutations, non-germline chimeric mouse models, in which normal and abnormal cells coexist, could be helpful for disease-relevant analysis. In this study, we report a method for the induction of CRISPR-mediated somatic mutations in the cerebellum. Specifically, we utilized conditional knock-in mice, in which Cas9 and GFP are chronically activated by the CAG (CMV enhancer/chicken &#223;-actin) promoter after Cre-mediated recombination of the genome. The self-designed single-guide RNAs (sgRNAs) and the Cre recombinase sequence, both encoded in a single plasmid construct, were delivered into cerebellar stem/progenitor cells at an embryonic stage using in utero electroporation. Consequently, transfected cells and their daughter cells were labeled with green fluorescent protein (GFP), thus facilitating further phenotypic analyses. Hence, this method is not only showing electroporation-based gene delivery into embryonic cerebellar cells but also proposing a novel quantitative approach to assess CRISPR-mediated loss-of-function phenotypes.

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Conventional loss-of-function studies of genes using knockout animals have often been costly and time-consuming. Electroporation-based CRISPR-mediated somatic mutagenesis is a powerful tool to understand gene functions in vivo. Here, we report a method to analyze knockout phenotypes in proliferating cells of the cerebellum.

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors ...

Zygote Microinjection for Creating Gene Cassette Knock-in and Flox Alleles in Mice

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily produced by electroporation of CRISPR factors (and single-stranded oligo DNA donors) into the zygote. In contrast, gene cassette (&#62;1 kb) knock-in and floxed mice are mainly generated by microinjection of CRISPR factors and double-stranded DNA donors into zygotes. Genome editing technologies have also increased the flexibility of genetically modified mice production. It is now possible to introduce the intended mutations in the target genomic regions in a number of beneficial inbred mouse strains. Our team has produced over 200 gene cassette knock-in mouse lines, and over 110 floxed mouse lines by zygote microinjection of CRISPR-Cas9 following requests from several countries, including Japan. Some of these genome editing used BALB/c, C3H/HeJ, and C57BL/6N inbred strains, however most used C57BL/6J. Unlike the electroporation method, genome editing by zygote microinjection in various inbred strains of mice is not that easy. However, gene cassette knock-in and floxed mice on single inbred genetic backgrounds are as critical as genetic humanized, fluorescent reporter, and conditional knockout mouse models. Therefore, this article presents the protocol for the zygote microinjection of CRISPR factors and double-stranded DNA donors in C57BL/6J mice for generating gene cassette knock-in and floxed mice. This article exclusively focuses on nuclear injection rather than cytoplasmic injection. In addition to zygote microinjection, we outline the timeline for the production process and peripheral techniques such as induction of superovulation and embryo transfer.

The present protocol describes zygote microinjection of CRISPR-Cas9 and donor DNA to efficiently produce gene cassette knock-in and floxed mice.

CRISPR-Cas technology has enabled the rapid and effortless generation of genetically modified mice. Specifically, mice and point mutant mice are readily ...

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

In Vivo CRISPR/Cas9 Screening to Simultaneously Evaluate Gene Function in Mouse Skin and Oral Cavity

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video