This research was supported by the &#8220;Establishment of measurement standards for Chemistry and Radiation&#8221;, grant number KRISS-2020-GP2020-0003, and &#8220;Development of Measurement Standards and Technology for Biomaterials and Medical Convergence&#8221;, grant number KRISS-2020-GP2020-0004 programs, funded by the Korea Research Institute of Standards and Science. This research was also supported by the Ministry of Science and ICT (MSIT), National Research Foundation of Korea (NRF-2019M3A9F3065868), The Ministry of Health and Welfare (MOHW), the Korea Health Industry Development Institute (KHIDI, HI20C0558), the Ministry of Trade, Industry &#38; Energy (MOTIE), and Korea Evaluation Institute of Industrial Technology (KEIT, 20009350). ORCID ID (Hee Min Yoo: 0000-0002-5951-2137; Dukjin Kang: 0000-0002-5924-9674; Seil Kim: 0000-0003-3465-7118; Joo-Eun Lee: 0000-0002-2495-1439; Jina Lee: 0000-0002-3661-3701).&#160;We thank Chang Woo Park for assistance with experiments.

1. Bacterial cell cultures and preparation of Lactobacillus&#160; cell-free supernatant (LCFS)
NOTE: Steps 1.2 &#8211; 1.9 are conducted in an anaerobic chamber.
<ol>
	<li>Prepare an MRS agar plate and broth containing L-cysteine and sterilize by autoclaving.</li>
	<li>Pre-incubate the MRS agar plate in H2 anaerobic chamber maintained at 37 &#730;C with 20 ppm oxygen.</li>
	<li>Thaw Lactobacillus bacterial stock and inoculate the agar plate with the bacterial culture (Figure 1A (i)).</li>
	<li>Incubate bacteria for 2 - 3 days in H2 anaerobic chamber at 37 &#730;C and 20 ppm oxygen until single bacterial colonies are obtained.</li>
	<li>Wash and dry the Hungate type anerobic culture tube. Autoclave the culture tube at 121 &#730;C for 15 min.</li>
	<li>Then incubate the tube in H2 anaerobic chamber at 37 &#730;C and 20 ppm oxygen to remove oxygen.</li>
	<li>Place 2 - 3 mL of MRS broth into the tube. Seal the tube with a butyl rubber stopper and screw the cap.</li>
	<li>Obtain a single colony with a loop and place it into the 1.5 mL culture tube with 500 &#181;L of 1x PBS. (Figure 1A (ii)).</li>
	<li>Suspend the colony using a 1 mL syringe (Figure 1A (iii)). Do this by, inserting the needle of the 1 mL syringe in the center of the tube lid, aspirating the suspended colony and then resuspending it back into the MRS broth media. (Figure 1A (iv)).</li>
	<li>Incubate the MRS broth media in a shaker incubator for 2 days (37 &#176;C, 5% CO2, 200 rpm).</li>
	<li>Measure the optical density (OD) using a spectrophotometer to monitor bacterial growth curves until the absorbance at OD620 reaches to 2.0.</li>
	<li>Separate the bacterial pellets and the conditioned media by centrifuging at 1,000 x g for 15 min. Wash the collected bacterial pellets with 1x PBS and resuspend in 4 mL of RPMI 1640 supplemented with 10% fetal bovine serum. Do not include any antibiotics in the medium.</li>
	<li>Maintain the bacterial pellets in RPMI and incubate in a shaker incubator for 4 h at 37 &#176;C with 5% CO2 at a speed of 100 rpm.</li>
	<li>For the preparation of the probiotic supernatant, remove the bacterial pellet via centrifugation at 1000 x&#160;g, for 15 min at 4 &#176;C. Sterile-filter the recovered supernatant using a 0.22 &#956;m filter and store at &#8722;80 &#176;C until use.</li>
</ol>
2. Generation of spheroids
<ol>
	<li>Preparing colorectal cancer cell lines
	<ol>
		<li>Grow DLD-1, HT-29, and WiDr cell lines as monolayers until 70-80% confluency and incubate the plate at 37 &#176;C in a 5% CO2 incubator (Growth medium: RPMI containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin).</li>
		<li>For cells grown in 100 mm Petri dish, wash the plate twice with 4 mL of 1x PBS. Add 1 mL of 0.25% trypsin-EDTA and incubate the Petri dish for 2 min at 37 &#176;C in a 5% CO2 incubator to dissociate the cells.</li>
		<li>After incubation, check for the cell dissociation under a microscope and neutralize trypsin-EDTA with 5 mL of growth medium.</li>
		<li>Transfer the dissociated cells to a 15 mL conical tube and centrifuge for 3 min at 300 x&#160;g.</li>
		<li>Discard the supernatant and resuspend gently with 3 mL of growth media.</li>
		<li>Count the cells with trypan blue to determine viable cells using a hemocytometer. (Figure 1B (i))</li>
	</ol>
	</li>
	<li>Spheroid formation
	<ol>
		<li>In a 15 mL conical tube, dilute the cells from 2.1.5 to obtain 1 - 2 x 105 cells/mL (Figure 1B (ii))</li>
		<li>Add final concentration of 0.6% methylcellulose to the cell suspension and transfer the diluted cells to a sterile reservoir. 
		NOTE: For each cell line, the amount of methylcellulose needed should be titrated and determined accordingly.</li>
		<li>Use a multichannel pipette to dispense 200 &#181;L of cells to each well of an ultra-low attachment 96-well round bottom microplate. (Figure 1B (iii))</li>
		<li>Incubate the plate at 37 &#176;C in a 5% CO2 incubator for 24 - 36 h.</li>
		<li>After 24 - 36 h, observe the plate under a light microscope to ensure spheroid formation.</li>
	</ol>
	</li>
</ol>
3. Treating 3D colorectal cancer cells with LCFS
<ol>
	<li>Generate spheroids as described in steps 2 and 3.</li>
	<li>Before performing the LCFS treatment, thaw the frozen LCFS at room temperature (RT) for 10 - 20 min.</li>
	<li>Inoculate the LCFS stock solution into a growth medium. Serially dilute to 25%, 12.5%, and 6% in the growth medium (i.e., 25% LCFS = 150 &#181;L of growth medium + 50 &#181;L of LCFS).</li>
	<li>Take out the cell culture plate containing spheroids from the incubator and remove as much of the growth medium as possible from each well using a 200 &#956;L pipette.</li>
	<li>Add the growth media with LCFS on the cells and incubate at 37 &#176;C in a 5% CO2 incubator for 24 - 48 h. 
	NOTE: The volume to be used will depend on the plate size as follows: 2 mL for 6-well cell culture plates; 200 &#956;L for 96-well cell culture plates.</li>
</ol>
4. Cell viability for spheroids
<ol>
	<li>Prepare 8 - 10 LCFS-treated colorectal cancer spheroids in opaque-walled multi-well plates (cell viability assays are performed 48 h after LCFS treatment).</li>
	<li>Thaw the cell viability reagent (see Table of Materials) at 4 &#176;C for overnight.</li>
	<li>Equilibrate the cell viability reagent to room temperature before use.</li>
	<li>Before performing the assay, remove 50% of the growth media from the spheroids.</li>
	<li>Add 100 &#181;L of cell viability reagent to each well. 
	NOTE: The volume to be used will depend on the plate size as follows: 100 &#956;L for 96-well cell culture plates.</li>
	<li>Mix the reagent vigorously for 5 min to promote cell lysis.</li>
	<li>Incubate for 30 min &#8211; 2 h at 37 &#176;C.</li>
	<li>Record the luminescence.</li>
</ol>
5. Quantitative real-time polymerase chain reaction analysis for spheroids
<ol>
	<li>For each condition, prepare 10 - 15 spheroids in a 2 mL tube and centrifuge for 3 min at 400 x g.</li>
	<li>Discard the supernatant and wash the spheroids twice in 1 mL of ice-cold 1x PBS. 
	NOTE: Avoid centrifugation, let the spheroids settle down.</li>
	<li>Aspirate as much of the 1x PBS as possible and isolate RNA using a commercially available kit.</li>
	<li>Synthesize cDNA from 1 &#956;g of RNA using a commercially available kit as per the manufacturer&#8217;s protocol.</li>
	<li>Prepare a master mix to run all samples in triplicate (see Table 1 and Table 2).</li>
	<li>Perform the amplification in a 20 &#181;L of the template master mix into each qPCR plate well.</li>
	<li>Mix reactions well and spin if necessary.</li>
	<li>Run samples as per the recommendations of the instrument manufacturer (Table 3).</li>
</ol>
6. Western blotting from spheroids
NOTE: When collecting spheroids, use a 200 &#956;L pipette and cut the end of the tips to avoid disturbing their structure.
<ol>
	<li>For each condition, prepare 30 - 40 spheroids in a 2 mL tube.</li>
	<li>Place the tube on ice and let the spheroids settle down to the bottom of the 2 mL tube.</li>
	<li>Discard the supernatant and wash the spheroids twice in 1 mL ice-cold 1x PBS 
	NOTE: Avoid centrifugation, let the spheroids settle down.</li>
	<li>Aspirate as much of the 1x PBS as possible and add RIPA buffer with a protease inhibitor cocktail (10 spheroids = 30 &#181;L of RIPA buffer).</li>
	<li>Lyse the cells by pipetting up and down and perform sonication for 30 s with 30 s of resting on ice for 10 cycles.</li>
	<li>Centrifuge the protein lysates at 15000 x g for 15 min at 4 &#176;C.</li>
	<li>Determine the protein concentration for each cell lysate.</li>
	<li>Before loading, boil each cell lysate in a sample buffer at 100 &#176;C for 10 min.</li>
	<li>Load equal amounts of protein into the wells of the SDS-PAGE gel and run the gel for 1 - 2 h at 100 V.</li>
	<li>Transfer the protein from the gel to the PVDF membrane.</li>
	<li>After transferring, block the membrane for 1 h at room temperature using a blocking buffer (5% skim milk + TBS with 0.05% Tween-20).</li>
	<li>Incubate the membrane with 1:1,000 dilutions of primary antibody (Table 4) in 1x TBST with 5% BSA buffer at 4 &#176;C overnight.</li>
	<li>Wash the membrane three times with TBST, 15 min for each wash.</li>
	<li>Incubate the membrane with 1:2,500 dilutions of secondary antibody in the blocking buffer at room temperature for 2 h (see Table of Materials).</li>
	<li>Wash the membrane three times with TBST, 15 min for each wash.</li>
	<li>Prepare the membrane for HRP detection with a chemiluminescent substrate.</li>
	<li>Acquire chemiluminescent images.</li>
</ol>
7. Propidium Iodide (PI) staining of spheroids
<ol>
	<li>Prepare 5-10 spheroids as described in Step 4.1 and place the spheroids in an incubator at 37 &#176;C and 5% CO2.</li>
	<li>Dilute a 1 mg/mL stock of PI 1:100 in 1x PBS.</li>
	<li>Remove 50% of the medium from each well of the 96-well plate.</li>
	<li>Add 100 &#181;L of the PI solution to each well and place the wells in an incubator at 37 &#176;C and 5% CO2 for 10 - 15 min.</li>
	<li>Wash out the PI solution with 1x PBS.</li>
	<li>Add 200 &#181;L of growth medium and take an image using a fluorescence microscope. Analyze the fluorescence intensity using Image J to get the viability count of the spheroid.</li>
</ol>
8. FACS analysis of spheroids
<ol>
	<li>Generate spheroids as described previously.</li>
	<li>For each condition, prepare 30 - 40 spheroids in a FACS tube and centrifuge for 3 min at 400 x g and RT.</li>
	<li>Aspirate the supernatant and wash the spheroids in 3 mL of 1x PBS, then centrifuge at 400 x&#160;g for 3 min at 4 &#176;C.</li>
	<li>Aspirate the supernatant and add 200 &#181;L of 0.25% Trypsin-EDTA, then incubate at RT for 2 -3 min. 
	NOTE: The incubation time is dependent on the spheroid size and cell type.</li>
	<li>Add 1 mL of FACS buffer and gently dissociate the spheroids using a 200 &#956;L pipette.</li>
	<li>Centrifuge the dissociated cells at 400 x&#160;g and 4 &#176;C for 3 min. 
	NOTE: FACS buffer = 1x PBS + 2.5% FBS, filtered using a 0.22 &#181;m top filter.</li>
	<li>Discard the supernatant and add 7-AAD/Annexin V reagent (7AAD (5 &#181;L), Annexin V (5 &#181;L)/sample).</li>
	<li>Gently vortex the cells and incubate for 13 - 30 min at RT in the dark.</li>
	<li>Add 500 &#181;L of FACS buffer and filter the cells using conical polystyrene test tubes to remove aggregate cells.</li>
	<li>Centrifuge at 400 x&#160;g and 4 &#176;C for 3 min.</li>
	<li>Add 500 &#181;L of Annexin V binding buffer to each tube and resuspend.</li>
	<li>Analyze using a flow cytometer.</li>
</ol>

<ol>
	<li>Bron, P. A., Van Baarlen, P., Kleerebezem, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+molecular+insights+into+the+interaction+between+probiotics+and+the+host+intestinal+mucosa.">Emerging molecular insights into the interaction between probiotics and the host intestinal mucosa.</a> Nature Reviews Microbiology. 10 (1), 66-78 (2012).</li><li>Ruiz, L., Delgado, S., Ruas-Madiedo, P., S&#225;nchez, B., Margolles, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bifidobacteria+and+their+molecular+communication+with+the+immune+system.">Bifidobacteria and their molecular communication with the immune system.</a> Frontiers in Microbiology. 8, 1-9 (2017).</li><li>Sanders, M. E., Merenstein, D. J., Reid, G., Gibson, G. R., Rastall, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotics+and+prebiotics+in+intestinal+health+and+disease:+from+biology+to+the+clinic.">Probiotics and prebiotics in intestinal health and disease: from biology to the clinic.</a> Nature Reviews Gastroenterology and Hepatology. 16 (10), 605-616 (2019).</li><li>Pandey, K. R., Naik, S. R., Vakil, B. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotics,+prebiotics+and+synbiotics-+a+review.">Probiotics, prebiotics and synbiotics- a review.</a> Journal of Food Science and Technology. 52 (12), 7577-7587 (2015).</li><li>Harish, K., Varghese, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotics+in+humans-evidence+based+review.">Probiotics in humans-evidence based review.</a> Calicut Medical Journal. 4 (4), 3 (2006).</li><li>Routy, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+microbiota+influences+anticancer+immunosurveillance+and+general+health.">The gut microbiota influences anticancer immunosurveillance and general health.</a> Nature Reviews Clinical Oncology. 15 (6), 382-396 (2018).</li><li>Pampaloni, F., Reynaud, E. G., Stelzer, E. H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Most+of+the+cell-based+data-harvesting+efforts+that+drive+the+integration+of+cell+biology.">Most of the cell-based data-harvesting efforts that drive the integration of cell biology.</a> Nature Reviews Molecular Cell Biology. 8 (10), 839-845 (2007).</li><li>Shamir, E. R., Ewald, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+organotypic+culture:+Experimental+models+of+mammalian+biology+and+disease.">Three-dimensional organotypic culture: Experimental models of mammalian biology and disease.</a> Nature Reviews Molecular Cell Biology. 15 (10), 647-664 (2014).</li><li>Jong, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+tissue+culture+models+in+cancer+biology.">Three-dimensional tissue culture models in cancer biology.</a> Seminars in Cancer Biology. 15 (5), 365-377 (2005).</li><li>Zanoni, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+tumor+spheroid+models+for+in+vitro+therapeutic+screening:+a+systematic+approach+to+enhance+the+biological+relevance+of+data+obtained.">3D tumor spheroid models for in vitro therapeutic screening: a systematic approach to enhance the biological relevance of data obtained.</a> Scientific Reports. 6, 19103 (2016).</li><li>Anton, D., Burckel, H., Josset, E., Noel, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+cell+culture:+A+breakthrough+in+vivo.">Three-dimensional cell culture: A breakthrough in vivo.</a> International Journal of Molecular Sciences. 16 (3), 5517-5527 (2015).</li><li>Lee, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+the+Anti-Cancer+Activity+of+the+Probiotic+Bacterium+Lactobacillus+fermentum+Using+2D+vs.+3D+Culture+in+Colorectal+Cancer+Cells.">Characterization of the Anti-Cancer Activity of the Probiotic Bacterium Lactobacillus fermentum Using 2D vs. 3D Culture in Colorectal Cancer Cells.</a> Biomolecules. 9 (10), 557 (2019).</li><li>Koledova, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+cell+culture:+An+introduction.">3D cell culture: An introduction.</a> Methods in Molecular Biology. 1612, (2017).</li><li>Kapa&#322;czy&#324;ska, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=2D+and+3D+cell+cultures+-+a+comparison+of+different+types+of+cancer+cell+cultures.">2D and 3D cell cultures - a comparison of different types of cancer cell cultures.</a> Archives of Medical Science. 14 (4), 910-919 (2018).</li><li>Langhans, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+in+vitro+cell+culture+models+in+drug+discovery+and+drug+repositioning.">Three-dimensional in vitro cell culture models in drug discovery and drug repositioning.</a> Frontiers in Pharmacology. 9, 1-14 (2018).</li><li>Breslin, S., O'Driscoll, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+cell+culture:+The+missing+link+in+drug+discovery.">Three-dimensional cell culture: The missing link in drug discovery.</a> Drug Discovery Today. 18 (5-6), 240-249 (2013).</li><li>Mazzocchi, A. R., Rajan, S. A. P., Votanopoulos, K. I., Hall, A. R., Skardal, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+patient-derived+3D+mesothelioma+tumor+organoids+facilitate+patient-centric+therapeutic+screening.">In vitro patient-derived 3D mesothelioma tumor organoids facilitate patient-centric therapeutic screening.</a> Scientific Reports. 8, 2886 (2018).</li><li>Lv, D., Hu, Z., Lu, L., Lu, H., Xu, X. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Three-dimensional+cell+culture:+A+powerful+tool+in+tumor+research+and+drug+discovery.">Three-dimensional cell culture: A powerful tool in tumor research and drug discovery.</a> Oncology Letters. 14 (6), 6999-7010 (2017).</li><li>Thirumala, S., Gimble, J., Devireddy, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methylcellulose+Based+Thermally+Reversible+Hydrogel+System+for+Tissue+Engineering+Applications.">Methylcellulose Based Thermally Reversible Hydrogel System for Tissue Engineering Applications.</a> Cells. 2 (3), 460-475 (2013).</li><li>Chandrashekran, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methylcellulose+as+a+scaffold+in+the+culture+of+liver-organoids+for+the+potential+of+treating+acute+liver+failure.">Methylcellulose as a scaffold in the culture of liver-organoids for the potential of treating acute liver failure.</a> Cell and Gene Therapy Insights. 4 (11), 1087-1103 (2018).</li><li>Lee, W., Park, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+patterned+stem+cell+differentiation+using+thermo-responsive+methylcellulose+hydrogel+molds.">3D patterned stem cell differentiation using thermo-responsive methylcellulose hydrogel molds.</a> Scientific Reports. 6, 1-11 (2016).</li><li>Fan, H., Demirci, U., Chen, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Emerging+organoid+models:+Leaping+forward+in+cancer+research.">Emerging organoid models: Leaping forward in cancer research.</a> Journal of Hematology and Oncology. 12 (1), 1-10 (2019).</li><li>Drost, J., Clevers, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organoids+in+cancer+research.">Organoids in cancer research.</a> Nature Reviews Cancer. 18 (7), 407-418 (2018).</li><li>Liou, C. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Metabolic+Pathway+for+Activation+of+Dietary+Glucosinolates+by+a+Human+Gut+Symbiont.">A Metabolic Pathway for Activation of Dietary Glucosinolates by a Human Gut Symbiont.</a> Cell. 180 (4), 717-728 (2020).</li><li>Sherwin, E., Bordenstein, S. R., Quinn, J. L., Dinan, T. G., Cryan, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+and+the+social+brain.">Microbiota and the social brain.</a> Science. 366 (6465), 2016 (2019).</li><li>Honda, K., Littman, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+microbiota+in+adaptive+immune+homeostasis+and+disease.">The microbiota in adaptive immune homeostasis and disease.</a> Nature. 535 (7610), 75-84 (2016).</li><li>B&#225;rcena, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Healthspan+and+lifespan+extension+by+fecal+microbiota+transplantation+into+progeroid+mice.">Healthspan and lifespan extension by fecal microbiota transplantation into progeroid mice.</a> Nature Medicine. 25 (8), 1234-1242 (2019).</li><li>Michalovich, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Obesity+and+disease+severity+magnify+disturbed+microbiome-immune+interactions+in+asthma+patients.">Obesity and disease severity magnify disturbed microbiome-immune interactions in asthma patients.</a> Nature Communications. 10, 5711 (2019).</li><li>Ansaldo, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akkermansia+muciniphila+induces+intestinal+adaptive+immune+responses+during+homeostasis.">Akkermansia muciniphila induces intestinal adaptive immune responses during homeostasis.</a> Science. 364 (6446), 1179-1184 (2019).</li></ol>

The authors have no relevant financial disclosures.

The tissue microenvironment, including neighboring cells and the extracellular matrix (ECM), is fundamental to tissue generation and crucial in the control of cell growth and tissue development13. However, 2D cultures have several disadvantages, such as the disruption of cellular interactions, as well as alterations in cell morphology, extracellular environments, and the approach of division14. 3D cell culture systems have been rigorously studied to better reproduce in vivo effects, and have been proven as more precise systems for in vitro cancer testing15,16. There is a need for model systems to more accurately predict personalized responses to chemotherapeutics17.
3D scaffolding was developed for tissue engineering. It acts as a surrogate loss of ECM, representing the available space of tumor cells. In addition, the scaffolding provides physical interactions for cell adhesion and proliferation and causes cells to form appropriate spatial distributions and cell-ECM or cell-cell interactions18. The methylcellulose (MC) polymer has been continuously studied to determine its suitability in generating MC-based hydrogel systems for applications in 3D cell culture engineering19,20. However, the intact incorporation of these hydrogels into biomaterials like 3D cell networks remains technically challenging21. Therefore, the spheroid formation protocol presented here recommends the titration of MC concentrations and optimization with various time points for each CRC cell line. Cell line-specific characteristics, such as cell aggregation, viability, and death, can significantly affect each of the conditions we tested. This method can provide a means of generating uniform spheroids for testing LCFS&#160;on cancer cells.
Probiotics, which are beneficial bacteria, produce active metabolites that can potentially mimic anti-cancer effects. Thus, our study was designed to isolate lactic acid bacteria (LAB) and test the anti-cancer effects of their metabolic extracts from cell-free supernatants (CFS). Our studies provided a method for observing the effects of L. fermentum cell-free supernatants that induces apoptotic cell death in colorectal cancer cells in a 3D system. The mRNA levels of apoptosis markers involved in apoptotic pathways are dramatically induced after LCFS exposure in 3D conditions. Moreover, decreased levels of PARP1 and BCL-XL were expressed in the LCFS-treated 3D spheroid control compared to the control in Figure 4C,D,E. Inhibition of NF-&#954;B activation was, also, observed in 3D cultures after treatment with LCFS. Taken all together, the advantages of culturing cells in 3D include increasing cell-cell interactions and responses to signaling molecules to better mimic in vivo systems. Western blotting using spheroids can lead to quantitative insights into the state of various signaling molecules.
Cell lines have certain limitations as preclinical models of cancer research. Recently, cancer organoids have been utilized in the modeling of personalized anti-cancer therapy22,23. The treatment of LCFS with probiotics in organoids is expected to be used as a powerful platform to test anti-cancer effects. Moreover, we only tested one of the Lactobacillus species among the various probiotics in the cancer model. Various probiotics are, also, being tested for the prevention of metabolic syndrome, immunological, and neurological disorders24,25,26. LCFS from Bifidobacterium, Saccharomyces, Streptococcus, Enterococcus, and Akkermansia species are potential candidates for the testing of health benefits through various types of disease models27,28,29.
Based on this study, it can be concluded that the understanding of signaling in spheroids and the various responses to LCFS treatment in 3D models may be beneficial for testing anti-cancer effects using the method that we proposed. Additionally, 3D cancer models can provide several advantages that are not possible with traditional 2D monolayers.

Probiotics are the most advantageous microorganisms in the gut that improves immune homeostasis and host energy metabolism1. Probiotics from Lactobacillus and Bifidobacterium are the most advanced of its kind found in the intestine2,3. Previous investigations have shown that Lactobacillus has inhibitory and antiproliferative effects on several cancers, including colorectal cancer4. Moreover, probiotics prevent inflammatory bowel diseases, Crohn&#8217;s disease, and ulcerative colitis5,6. However, most studies with probiotics were performed in two dimensional (2D) monolayers that are grown on solid surfaces.
Artificial culture systems lack environmental features, which is not natural for cancer cells. To overcome this limitation, three dimensional (3D) culture systems have been developed7,8. Cancer cells in 3D show improvements in terms of basic biological mechanisms, such as cell viability, proliferation, morphology, cell-cell communication, drug sensitivity, and in vivo relevance9,10. Moreover, spheroids are made from multicellular types of colorectal cancer and are dependent on cell-cell interactions and the extracellular matrix (ECM)11. Our previous study has reported that probiotic cell-free supernatant (CFS) produced using Lactobacillus fermentum showed anti-cancer effects on 3D cultures of colorectal cancer (CRC) cells12. We proposed that CFS is a suitable alternative strategy for testing probiotic effects on 3D spheroids12.
Here, we present an approach that can accommodate multicellular types of 3D colorectal cancer for the analysis of therapeutic effects of probiotic cell-free supernatant (CFS) on several 3D colorectal cancer mimicry systems. This method provides a means for the analysis of related probiotic and anti-cancer effects in vitro.

<table><tbody><tr><td>&lt;br/&gt; 10% Mini-PROTEAN TGX Precast Protein Gels, 15-well, 15 &amp;micro;l</td><td>Biorad</td><td>4561036</td><td>Pkg of 10</td></tr><tr><td>Applied Biosystems MicroAmp Optical Adhesive Film</td><td>Thermo Fisher Scientific</td><td>4311971</td><td>100 covers</td></tr><tr><td>10x transfer buffer</td><td>Intron</td><td>IBS-BT031A</td><td>1 L</td></tr><tr><td>10X Tris-Glycine (W/SDS)</td><td>Intron</td><td>IBS-BT014</td><td>1 L</td></tr><tr><td>Axygen 2.0 mL MaxyClear Snaplock Microcentrifuge Tube, Polypropylene, Clear, Nonsterile, 500 Tubes/Pack, 10 Packs/Case</td><td>Corning</td><td>SCT-200-C</td><td>500 Tubes/Pack, 10 Packs/Case</td></tr><tr><td>BD Difco Bacto Agar</td><td>BD</td><td>214010</td><td>500 g</td></tr><tr><td>BD Difco Lactobacilli MRS Broth</td><td>BD</td><td>DF0881-17-5</td><td>500 g</td></tr><tr><td>CellTiter-Glo 3D Cell viability assay</td><td>Promega</td><td>G9681</td><td>100&amp;mu;l/assay in 96-well plates</td></tr><tr><td>Complete Protease Inhibitor Cocktail</td><td>Sigma-Aldrich</td><td>11697498001</td><td>vial of 20 tablets</td></tr><tr><td>Corning Phosphate-Buffered Saline, 1X without calcium and magnesium, PH 7.4 &amp;plusmn; 0.1</td><td>Corning</td><td>21-040-CV</td><td>500 mL</td></tr><tr><td>EMD Millipore Immobilon-P PVDF Transfer Membranes</td><td>fisher Scientific</td><td>IPVH00010</td><td>26.5cm x 3.75m roll; Pore Size: 0.45um</td></tr><tr><td>Falcon 5 mL Round Bottom Polystyrene Test Tube, with Cell Strainer Snap Cap</td><td>Corning</td><td>352235</td><td>25/Pack, 500/Case</td></tr><tr><td>Fetal Bovine Serum, certified, US origin</td><td>Thermo Fisher Scientific</td><td>16000044</td><td>500 mL</td></tr><tr><td>iScript cDNA Synthesis Kit, 25 x 20 &amp;micro;l rxns #1708890</td><td>Biorad</td><td>1708890</td><td>25 x 20 &amp;micro;L rxns</td></tr><tr><td>iTaq Universal SYBR Green Supermix</td><td>Biorad</td><td>1725121</td><td>5 x 1 mL</td></tr><tr><td>Lactobacillus fermentum</td><td>Korean Collection for Type Cultures</td><td>KCTC 3112</td><td></td></tr><tr><td>L-Cysteine hydrochloride monohydrate</td><td>Sigma-Aldrich</td><td>C6852-25G</td><td>25 g</td></tr><tr><td>Methyl Cellulose (3500-5600mPa&amp;middot;s, 2% in Water at 20&amp;deg;C)</td><td>TCI</td><td>M0185</td><td>500 g</td></tr><tr><td>MicroAmp Fast Optical 96-Well Reaction Plate with Barcode, 0.1 mL</td><td>Applied Biosystems</td><td>4346906</td><td>20 plates</td></tr><tr><td>Millex-GS Syringe Filter Unit, 0.22 &amp;micro;m, mixed cellulose esters, 33 mm, ethylene oxide sterilized</td><td>Millipore</td><td>SLGS033SB</td><td>250</td></tr><tr><td>PE Annexin V Apoptosis Detection Kit with 7-AAD</td><td>Biolegend</td><td>640934</td><td>100 tests</td></tr><tr><td>Penicillin-Streptomycin (10,000 U/mL)</td><td>Thermo Fisher Scientific</td><td>15140122</td><td>100 mL</td></tr><tr><td>Propidium Iodide</td><td>Introgen</td><td>P1304MP</td><td>100 mg</td></tr><tr><td>RIPA Lysis and Extraction Buffer</td><td>Thermo Fisher Scientific</td><td>89901</td><td>250 mL</td></tr><tr><td>RNeasy Mini Kit (250)</td><td>Qiagen</td><td>74106</td><td>250</td></tr><tr><td>RPMI-1640</td><td>Gibco</td><td>11875-119</td><td>500 mL</td></tr><tr><td>Trypsin-EDTA (0.25%), phenol red</td><td>Thermo Fisher Scientific</td><td>25200056</td><td>100 mL</td></tr><tr><td>&lt;strong&gt;Name of Materials/Equipment/Software&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments/Description&lt;/strong&gt;</td></tr><tr><td>anti - p-I&amp;kappa;B&amp;alpha; (B-9)</td><td>Santa cruze</td><td>sc-8404</td><td>200 &amp;micro;g/mL</td></tr><tr><td>anti-BclxL (H-5)</td><td>Santa cruze</td><td>sc-8392</td><td>200 &amp;micro;g/mL</td></tr><tr><td>anti-PARP 1 (C2-10)</td><td>Santa cruze</td><td>sc-53643</td><td>50 &amp;micro;l ascites</td></tr><tr><td>anti-&amp;beta;-actin (C4)</td><td>Santa cruze</td><td>sc-47778</td><td>200 &amp;micro;g/mL</td></tr><tr><td>BD FACSVerse</td><td>BD Biosciences</td><td></td><td>San Diego, CA, USA</td></tr><tr><td>Synergy HTX Multi-Mode Microplate Reader</td><td>BioT</td><td>S1LFA</td><td></td></tr><tr><td>CO2 incubator</td><td>Thermo fisher</td><td>HERAcell 150i</td><td></td></tr><tr><td>Conical tube 15 ml</td><td>SPL</td><td>50015</td><td></td></tr><tr><td>Conical tube 50 ml</td><td>SPL</td><td>50050</td><td></td></tr><tr><td>Corning Costar Ultra-Low Attachment Multiple Well Plate</td><td>Sigma-Aldrich</td><td>CLS7007</td><td></td></tr><tr><td>Corning Costar Ultra-Low Attachment Multiple Well Plate</td><td>Sigma-Aldrich</td><td>CLS3471</td><td></td></tr><tr><td>Costar 50 mL Reagent Reservoirs, 5/Bag, Sterile</td><td>Costar</td><td>4870</td><td></td></tr><tr><td>Countess Cell Counting Chamber Slides</td><td>Thermofisher</td><td>C10228</td><td></td></tr><tr><td>Countess II FL Automated Cell Counter</td><td>invitrogen</td><td>AMQAF1000</td><td></td></tr><tr><td>EnSpire Multimode Reader</td><td>Perkin Elmer</td><td></td><td>Enspire 2300</td></tr><tr><td>Eppendorf Research Plus Multi Channel Pipette, 8-channel</td><td>Eppendorf</td><td>3122000051</td><td></td></tr><tr><td>FlowJo software</td><td>TreeStar</td><td></td><td>Ashland, OR, USA</td></tr><tr><td>Goat Anti-Mouse IgG (H+L)</td><td>Jackson immunoresearch</td><td>115-035-062</td><td>1.5 mL</td></tr><tr><td>Goat Anti-Rabbit IgG (H+L)</td><td>Jackson immunoresearch</td><td>111-035-144</td><td>2.0 mL</td></tr><tr><td>GraphPad Prism 5</td><td>GraphPad Software</td><td></td><td>Inc., San Diego, CA, USA</td></tr><tr><td>ImageJ</td><td>NIH</td><td></td><td></td></tr><tr><td>ImageQuant LAS 4000 mini</td><td>Fujifilm</td><td></td><td>Tokyo, Japan</td></tr><tr><td>Incubated shaker</td><td>Lab companion</td><td>SIF-6000R</td><td></td></tr><tr><td>Multi Gauge Ver. 3.0,</td><td>Fujifilm</td><td></td><td>Tokyo, Japan</td></tr><tr><td>Optical density (OD)LAMBDA UV/Vis Spectrophotometers</td><td>Perkin Elmer</td><td></td><td>Waltham, MA, USA</td></tr><tr><td>Phase-contrast microscope</td><td>Olympus</td><td></td><td>Tokyo, Japan</td></tr><tr><td>SPL microcentrifuge tube 1.5mL</td><td>SPL</td><td>60015</td><td></td></tr><tr><td>SPL Multi Channel Reservoirs, 12-Chs, PS, Sterile</td><td>SPL</td><td>21012</td><td></td></tr><tr><td>StepOnePlus Real-Time PCR system</td><td>Thermo Fisher Scientific</td><td></td><td>Waltham, MA, USA</td></tr><tr><td>Vibra-Cell Ultrasonic Liquid Processors</td><td>SONICS-vibra cell</td><td>VC 505</td><td>500 Watt ultrasonic processor</td></tr><tr><td>Vinyl Anaerobic Chamber</td><td>COY LAB PRODUCTS</td><td></td><td></td></tr></tbody></table>

evaluating cell death using cell-free supernatant of probiotics in three-dimensional spheroid cultures of colorectal cancer cells

This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using supernatants from Lactobacillus fermentum cell culture, considered as probiotics cultures. The use of 3D cultures to test Lactobacillus cell-free supernatant (LCFS) are a better option than testing in 2D monolayers, especially as L. fermentum can produce anti-cancer effects within the gut. L. fermentum supernatant was identified to possess increased anti-proliferative effects against several colorectal cancer (CRC) cells in 3D culture conditions. Interestingly, these effects were strongly related to the culture model, demonstrating the notable ability of L. fermentum to induce cancer cell death. Stable spheroids were generated from diverse CRCs (colorectal cancer cells) using the protocol presented below. This protocol of generating 3D spheroid is time saving and cost effective. This system was developed to easily investigate the anti-cancer effects of LCFS in multiple types of CRC spheroids. As expected, CRC spheroids treated with LCFS strongly induced cell death during the experiment and expressed specific apoptosis molecular markers as analyzed by qRT-PCR, western blotting, and FACS analysis. Therefore, this method is valuable for exploring cell viability and evaluating the efficacy of anti-cancer drugs.

We describe the protocol of obtaining spheroids from diverse colorectal cancer cell lines. Supplementation with methylcellulose was required to generate spheroids. We also present a method of LCFS preparation and present a model to study the correlation between probiotics and colorectal cancer. Spheroid formation and LCFS preparation protocols are schematically illustrated in Figure 1A,B. As shown in Figure 2A, methylcellulose concentration of 0.6% transforms the cancer cells into compact spheroids. This result indicates that spheroids can be generated from several types of colorectal cancer by using our methylcellulose protocol. Next, the spheroids were treated with 25% LCFS and the morphology was studied after 48 h using a light microscope. As shown in Figure 3A, the spheroids of the groups treated with LCFS exhibited disrupted surfaces. To investigate the anti-cancer effects of LCFS at suitable concentrations, the spheroids were treated for 48 h with various dosages of LCFS: 0 (control), 6%, 12.5%, and 25%. Disruptions in the spheroid morphology were observed in spheroids treated with 25% LCFS, as shown in Figure 3B. In addition, the spheroids were treated with 25% LCFS for 24 h and 48 h, and disruptions in spheroid morphology were observed after 48 h of treatment. Microscopic images of the spheroids are shown in Figure 3C.
After 48 h, the samples were assessed with cell viability assay, and colorectal cancer cell death was observed upon treatment with LCFS&#160;in a dose dependent manner, higher the LCFS amount higher the observed cell death (Figure 3D). We, then, stained the samples with propidium iodide (PI) to observe apoptosis. As expected, the induction of apoptosis was dependent on the LCFS dose (Figure 4A,B,C). RT-PCR was performed to detect the changes in molecular markers of apoptosis i.e., BAX, BAK and NOXA (Figure 5A,B). Lastly, apoptosis markers were studied using western blotting and Annexin V/7AAD through FACS (Figure 6A,B,C,D). These observations show that LCFS effectively induced apoptosis in the 3D model.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61285/61285fig01.jpg" /> 
Figure 1: Schematic representation of spheroid formation and LCFS preparation. 
(A) Schematic representation images of the LCFS generation protocol are marked by (i-iv) (B) Schematics of the methylcellulose-mediated spheroid formation are marked by (i-iii). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61285/61285fig02.jpg" /> 
Figure 2: Methylcellulose-mediated spheroid formation. 
(A) Representative images of methylcellulose-mediated spheroid formation of HT-29, DLD1, and WiDr. Cells were seeded in ultra-low attachment 96-well round bottom plates with methylcellulose concentrations of 0.1-1.2% for 48 h. Scale bar 10 &#956;m (n=3 for each experiment). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61285/61285fig03.jpg" /> 
Figure 3: Evaluation of LCFS concentration and spheroid morphology. 
(A) Representative images of HT-29 treated with LCFS for 48 h. Scale bar 100 &#956;m. (B) HT-29, DLD1, and WiDr spheroids treated with increasing doses of LCFS for 48 h. All spheroids had disrupted edges at 12.5-25% LCFS. Scale bar 20 &#956;m (n=3 for each experiment) (C) Spheroid morphologies of HT-29, DLD1, and WiDr spheroids treated with 25% LCFS for 24 and 48 h. Scale bar 20 &#956;m (n = 3) (D) Measured cell viability, shown as mean &#177; SEM. ***, P &#60; 0.05 (n = 3 for each experiment). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/61285/61285fig04.jpg" /> 
Figure 4: Propidium iodide staining of the spheroids. 
Representative images of PI staining in (A) HT-29, (B) DLD1, and (C) WiDr spheroids after 48 h of LCFS treatment. The images were acquired using a fluorescence microscope and the increase in PI intensity was measured using Image J. Scale bar 10 &#956;m. The mean &#177; SEM is shown. ***, P &#60; 0.05 (n = 3 for each experiment). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/61285/61285fig05.jpg" /> 
Figure 5: Apoptosis markers were identified using qRT-PCR. 
Apoptosis markers, such as BAX, BAK and NOXA, were quantified. mRNA quantification is presented as a relative expression normalized to (A) &#946;-actin and (B) 18s rRNA. The mean &#177; SEM is shown. ***, P &#60; 0.05 (n=3 for each experiment). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/61285/61285fig06.jpg" /> 
Figure 6: Apoptosis markers were determined via Western blotting and FACS analysis of the spheroids. 
Shown in the figure are western blots of (A) HT-29, (B) DLD1, and (C) WiDr cells after LCFS treatment. PARP1, BCL-XL, and p-I&#954;B&#945; was detected. &#946;-actin was used as an internal control. (D) FACS analysis of apoptosis in HT-29, DLD1, and WiDr spheroids incubated with LCFS. Apoptotic cells were detected by the increase in the fluorescence intensity of Annexin V-FITC. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61285/61285fig06large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reaction</td>
			<td>Volume per single 20 &#956;L</td>
		</tr>
		<tr>
			<td>2X qPCR mix</td>
			<td>10 &#956;L</td>
		</tr>
		<tr>
			<td>Forward primer (10 pmols/&#181;L)</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Reverse primer (10 pmols/&#181;L)</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>cDNA (50 ng/&#181;L)</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>7 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 1: PCR reaction mixture.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence</td>
		</tr>
		<tr>
			<td>BAX-Forward</td>
			<td>CCCGAGAGGTCTTTTTCCGAG</td>
		</tr>
		<tr>
			<td>BAX-Reverse</td>
			<td>CCAGCCCATGATGGTTCTGAT</td>
		</tr>
		<tr>
			<td>BAK-Forward</td>
			<td>ATGGTCACCTTACCTCTGCAA</td>
		</tr>
		<tr>
			<td>BAK-Reverse</td>
			<td>TCATAGCGTCGGTTGATGTCG</td>
		</tr>
		<tr>
			<td>NOXA-Forward</td>
			<td>ACCAAGCCGGATTTGCGATT</td>
		</tr>
		<tr>
			<td>NOXA-Reverse</td>
			<td>ACTTGCACTTGTTCCTCGTGG</td>
		</tr>
		<tr>
			<td>18s rRNA-Forward</td>
			<td>GATGGGCGGCGGAAAATAG</td>
		</tr>
		<tr>
			<td>18s rRNA-Reverse</td>
			<td>GCGTGGATTCTGCATAATGGT</td>
		</tr>
		<tr>
			<td>&#946;-Actin-Forward</td>
			<td>TCCTGTGGCATCCACGAAACT</td>
		</tr>
		<tr>
			<td>&#946;-Actin-Reverse</td>
			<td>GAAGCATTTGCGGTGGACGAT</td>
		</tr>
	</tbody>
</table>
Table 2: Primer sequences used in qRT-PCR analysis.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Stage</td>
			<td>Temp (&#186;C)</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>95</td>
			<td>10 min</td>
		</tr>
		<tr>
			<td colspan="3">40 cycles:</td>
		</tr>
		<tr>
			<td>Step 1</td>
			<td>95</td>
			<td>15 sec</td>
		</tr>
		<tr>
			<td>Step 2</td>
			<td>60</td>
			<td>60 sec</td>
		</tr>
		<tr>
			<td rowspan="3">Melting curve stage</td>
			<td>95</td>
			<td>15 sec</td>
		</tr>
		<tr>
			<td>60</td>
			<td>60 sec</td>
		</tr>
		<tr>
			<td>95</td>
			<td>15 sec</td>
		</tr>
	</tbody>
</table>
Table 3: qRT-PCR conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody</td>
			<td>Dilution</td>
		</tr>
		<tr>
			<td>PARP 1 (C2-10)</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>BCL-XL (H-5)</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>p-I&#954;B&#945; (B-9)</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>&#946;-actin (C4)</td>
			<td>1:1000</td>
		</tr>
		<tr>
			<td>Goat Anti-Mouse IgG (H+L)</td>
			<td>1:2500</td>
		</tr>
		<tr>
			<td>Goat Anti-Rabbit IgG (H+L)</td>
			<td>1:2500</td>
		</tr>
	</tbody>
</table>
Table 4: Antibodies used in western blot analysis.

Watch this Scientific Journal Video about Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells at JoVE.com

Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

Here methods are presented to understand anti-cancer effects of Lactobacillus cell-free supernatant (LCFS). Colorectal cancer cell lines show cell deaths when treated with LCFS in 3D cultures. The process of generating spheroids can be optimized depending on the scaffold and the analysis methods presented are useful for evaluating the involved signaling pathways.

This manuscript describes a protocol to evaluate cancer cell deaths in three dimensional (3D) spheroids of multicellular types of cancer cells using ...

evaluating-cell-death-using-cell-free-supernatant-probiotics-three

Nanyang Technological University

Research

JoVE Journal

Cancer Research

6.5K Views.  Korea Research Institute of Standards and Science (KRISS). Hier methoden worden gepresenteerd om te begrijpen anti-kanker effecten van Lactobacillus celvrije supernatant (LCFS). Colorectale kankercellijnen tonen celsterfte bij behandeling met LCFS in 3D-culturen. Het proces van het genereren van sferoïden kan worden geoptimaliseerd, afhankelijk van de steiger en de gepresenteerde analysemethoden zijn nuttig voor het evalueren van de betrokken signaleringsroutes.

Video: Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

Preparation and Metabolic Assay of 3-dimensional Spheroid Co-cultures of Pancreatic Cancer Cells and Fibroblasts

Many cancer types, including pancreatic cancer, have a dense fibrotic stroma that plays an important role in tumor progression and invasion. Activated cancer associated fibroblasts are a key component of the tumor stroma that interact with cancer cells and support their growth and survival. Models that recapitulate the interaction of cancer cells and activated fibroblasts are important tools for studying the stromal biology and for development of antitumor agents. Here, a method is described for the rapid generation of robust 3-dimensional (3D) spheroid co-culture of pancreatic cancer cells and activated pancreatic fibroblasts that can be used for subsequent biological studies. Additionally, described is the use of 3D spheroids in carrying out functional metabolic assays to probe cellular bioenergetics pathways using an extracellular flux analyzer paired with a spheroid microplate. Pancreatic cancer cells (Patu8902) and activated pancreatic fibroblast cells (PS1) were co-cultured and magnetized using a biocompatible nanoparticle assembly. Magnetized cells were rapidly bioprinted using magnetic drives in a 96 well format, in growth media to generate spheroids with a diameter ranging between 400-600 &#181;m within 5-7 days of culture. Functional metabolic assays using Patu8902-PS1 spheroids were then carried out using the extracellular flux technology to probe cellular energetic pathways. The method herein is simple, allows consistent generation of cancer cell-fibroblast spheroid co-cultures and can be potentially adapted to other cancer cell types upon optimization of the current described methodology.

Here, a method is described for the preparation of 3-dimensional (3D) spheroid co-culture of pancreatic cancer cells and fibroblasts, followed by measurement of metabolic functions using an extracellular flux analyzer.

Many cancer types, including pancreatic cancer, have a dense fibrotic stroma that plays an important role in tumor progression and invasion. Activated ...

A Spheroid Killing Assay by CAR T Cells

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric antigen receptor (CAR) redirected T cells obtained the most spectacular results, in particular with pediatric B-acute lymphoblastic leukemia (B-ALL). Classical validation methods of CAR T cells rely on the use of specificity and functionality assays of the CAR T cells against target cells in suspension and in xenograft models. Unfortunately, observations made in vitro are often decoupled from results obtained in vivo and a lot of effort and animals could be spared by adding another step: the use of 3D culture. The production of spheroids out of potential target cells that mimic the 3D structure of the tumor cells when they are engrafted into the animal model represents an ideal alternative. Here, we report an affordable, reliable and easy method to produce spheroids from a transduced colorectal cell line as a validation tool for adoptive cell therapy (exemplified here by CD19 CAR T cells). This method is coupled with an advanced live imaging system that can follow spheroid growth, effector cells cytotoxicity and tumor cell apoptosis.

This protocol is designed to assess immunotherapeutic redirected T-cell (CAR T-cell) cytotoxicity against 3D structured cancerous cells (spheroids) in real time.

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric ...

Assessing Cell Viability and Death in 3D Spheroid Cultures of Cancer Cells

Three-dimensional spheroids of cancer cells are important tools for both cancer drug screens and for gaining mechanistic insight into cancer cell biology. The power of this preparation lies in its ability to mimic many aspects of the in vivo conditions of tumors while being fast, cheap, and versatile enough to allow relatively high-throughput screening. The spheroid culture conditions can recapitulate the physico-chemical gradients in a tumor, including the increasing extracellular acidity, increased lactate, and decreasing glucose and oxygen availability, from the spheroid periphery to its core. Also, the mechanical properties and cell-cell interactions of in vivo tumors are in part mimicked by this model. The specific properties and consequently the optimal growth conditions, of 3D spheroids, differ widely between different types of cancer cells. Furthermore, the assessment of cell viability and death in 3D spheroids requires methods that differ in part from those employed for 2D cultures. Here we describe several protocols for preparing 3D spheroids of cancer cells, and for using such cultures to assess cell viability and death in the context of evaluating the efficacy of anticancer drugs.

Here, we present several simple methods for evaluating viability and death in 3D cancer cell spheroids, which mimic the physico-chemical gradients of in vivo tumors much better than the 2D culture. The spheroid model, therefore, allows evaluation of the cancer drug efficacy with improved translation to in vivo conditions.

Three-dimensional spheroids of cancer cells are important tools for both cancer drug screens and for gaining mechanistic insight into cancer cell biology. ...

Monitoring Cancer Cell Invasion and T-Cell Cytotoxicity in 3D Culture

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited number of assays allow for direct monitoring and mechanistic insights into the interactions between tumor and immune cells, amongst which, T-cells play a significant role in executing the cytotoxic response of the adaptive immune system to cancer cells. Most assays are based on two-dimensional (2D) co-culture of cells due to the relative ease of use but with limited representation of the invasive growth phenotype, one of the hallmarks of cancer cells. Current three-dimensional (3D) co-culture systems either require special equipment or separate monitoring for invasion of co-cultured cancer cells and interacting T-cells.
Here we describe an approach to simultaneously monitor the invasive behavior in 3D of cancer cell spheroids and T-cell cytotoxicity in co-culture. Spheroid formation is driven by enhanced cell-cell interactions in scaffold-free agarose microwell casts with U-shaped bottoms. Both T-cell co-culture and cancer cell invasion into type I collagen matrix are performed within the microwells of the agarose casts without the need to transfer the cells, thus maintaining an intact 3D co-culture system throughout the assay. The collagen matrix can be separated from the agarose cast, allowing for immunofluorescence (IF) staining and for confocal imaging of cells. Also, cells can be isolated for further growth or subjected to analyses such as for gene expression or fluorescence activated cell sorting (FACS). Finally, the 3D co-culture can be analyzed by immunohistochemistry (IHC) after embedding and sectioning. Possible modifications of the assay include altered compositions of the extracellular matrix (ECM) as well as the inclusion of different stromal or immune cells with the cancer cells.

The presented approach simultaneously evaluates cancer cell invasion in 3D spheroid assays and T-cell cytotoxicity. Spheroids are generated in a scaffold-free agarose multi-microwell cast. Co-culture and embedding in type I collagen matrix are performed within the same device which allows to monitor cancer cell invasion and T-cell mediated cytotoxicity.

Significant progress has been made in treating cancer with immunotherapy, although a large number of cancers remain resistant to treatment. A limited ...

A Three-dimensional Model of Spheroids to Study Colon Cancer Stem Cells

Colorectal cancers are characterized by heterogeneity and a hierarchical organization comprising a population of cancer stem cells (CSCs) responsible for tumor development, maintenance, and resistance to drugs. A better understanding of CSC properties for their specific targeting is, therefore, a pre-requisite for effective therapy. However, there is a paucity of suitable preclinical models for in-depth investigations. Although in vitro two-dimensional (2D) cancer cell lines provide valuable insights into tumor biology, they do not replicate the phenotypic and genetic tumor heterogeneity. In contrast, three-dimensional (3D) models address and reproduce near-physiological cancer complexity and cell heterogeneity. The aim of this work was to design a robust and reproducible 3D culture system to study CSC biology. The present methodology describes the development and optimization of conditions to generate 3D spheroids, which are homogenous in size, from Caco2 colon adenocarcinoma cells, a model that can be used for long-term culture. Importantly, within the spheroids, the cells which were organized around lumen-like structures, were characterized by differential cell proliferation patterns and by the presence of CSCs expressing a panel of markers. These results provide the first proof-of-concept for the appropriateness of this 3D approach to study cell heterogeneity and CSC biology, including the response to chemotherapy.

This protocol presents a novel, robust, and reproducible culture system to generate and grow three-dimensional spheroids from Caco2 colon adenocarcinoma cells. The results provide the first proof-of-concept for the appropriateness of this approach to study cancer stem cell biology, including the response to chemotherapy.

Colorectal cancers are characterized by heterogeneity and a hierarchical organization comprising a population of cancer stem cells (CSCs) responsible for ...

Mammary Epithelial and Endothelial Cell Spheroids as a Potential Functional In vitro Model for Breast Cancer Research

Breast cancer is the leading cause of mortality in women. The growth of breast cancer cells and their subsequent metastasis is a key factor for its progression. Although the mechanisms involved in promoting breast cancer growth have been intensively studied using monocultures of breast cancer cells such as MCF-7 cells, the contribution of other cell types, such as vascular and lymphatic endothelial cells that are intimately involved in tumor growth, has not been investigated in depth. Cell-cell interaction plays a key role in tumor growth and progression. Neoangiogenesis, or the development of vessels, is essential for tumor growth, whereas the lymphatic system serves as a portal for cancer cell migration and subsequent metastasis. Recent studies provide evidence that vascular and lymphatic endothelial cells can significantly influence cancer cell growth. These observations imply a need for developing in vitro models that would more realistically reflect breast cancer growth processes in vivo. Moreover, restrictions in animal research require the development of ex vivo models to elucidate better the mechanisms involved.
This article describes the development of breast cancer spheroids composed of both breast cancer cells (estrogen receptor-positive MCF-7 cells) and vascular and/or lymphatic endothelial cells. The protocol describes a detailed step-by-step approach in creating dual-cell spheroids using two different approaches, hanging drop (gold standard and cheap) and 96-well U-bottom plates (expensive). In-depth instructions are provided for how to delicately pick up the formed spheroids to monitor growth by microscopic sizing and assessing viability using dead and live cell staining. Moreover, procedures to fix the spheroids for sectioning and staining with growth-specific antibodies to differentiate growth patterns in spheroids are delineated. Additionally, details for preparing spheroids with transfected cells and methods to extract RNA for molecular analysis are provided. In conclusion, this article provides in-depth instructions for preparing multi-cell spheroids for breast cancer research.

Mammary Epithelial and Endothelial Cell Spheroids as a Potential Functional In vitro Model for Breast Cancer Research

Crosstalk between mammary epithelial cells and endothelial cells importantly contributes to breast cancer progression, tumor growth, and metastasis. In this study, spheroids have been made from breast cancer cells together with vascular and/or lymphatic endothelial cells and demonstrate their applicability as an in vitro system for breast cancer research.

Breast cancer is the leading cause of mortality in women. The growth of breast cancer cells and their subsequent metastasis is a key factor for its ...

Establishing 3-Dimensional Spheroids from Patient-Derived Tumor Samples and Evaluating their Sensitivity to Drugs

Despite remarkable advances in understanding tumor biology, the vast majority of oncology drug candidates entering clinical trials fail, often due to a lack of clinical efficacy. This high failure rate illuminates the inability of the current preclinical models to predict clinical efficacy, mainly due to their inadequacy in reflecting tumor heterogeneity and the tumor microenvironment. These limitations can be addressed with 3-dimensional (3D) culture models (spheroids) established from human tumor samples derived from individual patients. These 3D cultures represent real-world biology better than established cell lines that do not reflect tumor heterogeneity. Furthermore, 3D cultures are better than 2-dimensional (2D) culture models (monolayer structures) since they replicate elements of the tumor environment, such as hypoxia, necrosis, and cell adhesion, and preserve the natural cell shape and growth. In the present study, a method was developed for preparing primary cultures of cancer cells from individual patients that are 3D and grow in multicellular spheroids. The cells can be derived directly from patient tumors or patient-derived xenografts. The method is widely applicable to solid tumors (e.g., colon, breast, and lung) and is also cost-effective, as it can be performed in its entirety in a typical cancer research/cell biology lab without relying on specialized equipment. Herein, a protocol is presented for generating 3D tumor culture models (multicellular spheroids) from primary cancer cells and evaluating their sensitivity to drugs using two complementary approaches: a cell-viability assay (MTT) and microscopic examinations. These multicellular spheroids can be used to assess potential drug candidates, identify potential biomarkers or therapeutic targets, and investigate the mechanisms of response and resistance.

The present protocol describes generating 3D tumor culture models from primary cancer cells and evaluating their sensitivity to drugs using cell-viability assays and microscopic examinations.

Despite remarkable advances in understanding tumor biology, the vast majority of oncology drug candidates entering clinical trials fail, often due to a ...

Quantifying Antibody-Dependent Cellular Cytotoxicity in a Tumor Spheroid Model: Application for Drug Discovery

Monoclonal antibody-based immunotherapy targeting tumor antigens is now a mainstay of cancer treatment. One of the clinically relevant mechanisms of action of the antibodies is antibody-dependent cellular cytotoxicity (ADCC), where the antibody binds to the cancer cells and engages the cellular component of the immune system, e.g., natural killer (NK) cells, to kill the tumor cells. The effectiveness of these therapies could be improved by identifying adjuvant compounds that increase the sensitivity of the cancer cells or the potency of the immune cells. In addition, undiscovered drug interactions in cancer patients co-medicated for previous conditions or cancer-associated symptoms may determine the success of the antibody therapy; therefore, such unwanted drug interactions need to be eliminated. With these goals in mind, we created a cancer ADCC model and describe here a simple protocol to find ADCC-modulating drugs. Since 3D models such as cancer cell spheroids are superior to 2D cultures in predicting in vivo responses of tumors to anticancer therapies, spheroid co-cultures of EGFP-expressing HER2+ JIMT-1 breast cancer cells and the NK92.CD16 cell lines were set up and induced with Trastuzumab, a monoclonal antibody clinically approved against HER2-positive breast cancer. JIMT-1 spheroids were allowed to form in cell-repellent U-bottom 96-well plates. On day 3, NK cells and Trastuzumab were added. The spheroids were then stained with Annexin V-Alexa 647 to measure apoptotic cell death, which was quantitated in the peripheral zone of the spheroids with an automated microscope. The applicability of our assay to identify ADCC-modulating molecules is demonstrated by showing that Sunitinib, a receptor tyrosine kinase inhibitor approved by the FDA against metastatic cancer, almost completely abolishes ADCC. The generation of the spheroids and image acquisition and analysis pipelines are compatible with high-throughput screening for ADCC-modulating compounds in cancer cell spheroids.

Here, we present a method to identify compounds that modulate the ADCC mechanism, an important cancer cell-killing mechanism of antitumor antibodies. The cytotoxic effect of NK cells is measured in breast cancer cell spheroids in the presence of Trastuzumab. Image analysis identifies live and dead killer and target cells in spheroids.

Monoclonal antibody-based immunotherapy targeting tumor antigens is now a mainstay of cancer treatment. One of the clinically relevant mechanisms of ...

Quantifying Cell Death in Human Colonoids in Response to Cytotoxic Perturbagens

Quantification of Cytokine-Induced Cell Death in Human Colonic Organoids Using Live Fluorescence Microscopy

Intestinal epithelial cell (IEC) death is increased in patients with inflammatory bowel diseases (IBD) such as ulcerative colitis (UC) and Crohn's disease (CD). This can contribute to defects in intestinal barrier function, exacerbation of inflammation, and disease immunopathogenesis. Cytokines and death receptor ligands are partially responsible for this increase in IEC death. IBD-relevant cytokines, such as TNF-&#945; and IFN-&#947;, are cytotoxic to IECs both independently and in combination. This protocol describes a simple and practical assay to quantify cytokine-induced cytotoxicity in CD patient-derived colonic organoids using a fluorescent cell death dye (SYTOX Green Nucleic Acid Stain), live fluorescence microscopy, and open-source image analysis software. We also demonstrate how to use the Bliss independence mathematical model to calculate a coefficient of perturbagen interaction (CPI) based on organoid cytotoxicity. The CPI can be used to determine if interactions between cytokine combinations or other types of perturbagens are antagonistic, additive, or synergistic. This protocol can be implemented to investigate the cytotoxic activity of cytokines and other perturbagens using patient-derived colonic organoids.

Author Spotlight: Understanding Cytokine-Induced Cell Death in Intestinal Epithelial Cells Using Human Organoids

This protocol describes a simple and cost-effective method to investigate and quantify cell death in human colonic organoids in response to cytotoxic perturbagens such as cytokines. The approach employs a fluorescent cell death dye (SYTOX Green Nucleic Acid Stain), live fluorescence microscopy, and open-source image analysis software to quantify single-organoid responses to cytotoxic stimuli.

Intestinal epithelial cell (IEC) death is increased in patients with inflammatory bowel diseases (IBD) such as ulcerative colitis (UC) and Crohn's disease ...

Biology

Spheroid Generation from Cell Lines: A Three-Dimensional (3D) Cell Culture Method

Source: Dillard, P., et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/video/58785/a-spheroid-killing-assay-by-car-t-cells">A Spheroid Killing Assay by CAR T Cells</a>. J. Vis. Exp. (2018).
Spheroids are a type of 3D cell culture model used to more accurately represent a cell&#8217;s environment compared to 2D cell culture monolayer models. In the example protocol, we will see scientists generate spheroids from a colorectal cancer cell line and apply live-cell imaging to track the spheroids&#8217; growth.

Source: Dillard, P., et al. A Spheroid Killing Assay by CAR T Cells. J. Vis. Exp. (2018).
Spheroids are a type of 3D cell culture model used to more ...

Evaluating Cell Death Using Cell-Free Supernatant of Probiotics in Three-Dimensional Spheroid Cultures of Colorectal Cancer Cells

Samenvatting

Meer video's verkennen