Name: identification and characterization of immunogenic rna species in hdm allergens that modulate eosinophilic lung inflammation
Uploaded: 2020-05-30T15:00:00.000+00:00
Duration: 8 min 44 s
Description: Watch this Scientific Journal Video about Identification and Characterization of Immunogenic RNA Species in HDM Allergens that Modulate Eosinophilic Lung Inflammation at JoVE.com

We thank Ms. Karla Gorena for technical assistance in flow cytometry. L.S. is supported by the China Scholarship Council and Hunan Provincial Innovation Foundation for Postgraduate (CX201713068). H.H.A. is supported by the Department of Clinical Laboratory Sciences, College of Applied Medical Sciences, Jouf University, Sakaka, Saudi Arabia. X.D.L. is supported by the UT Health San Antonio School of Medicine Startup Fund and the Max and Minnei Voelcker Fund.

Experimental procedures described here were approved by the Institutional Animal Care and Use Committee of University of Texas Health San Antonio.
1. Dot blot to show the presence of dsRNA structures in HDM total RNA
<ol>
	<li>Total RNA isolation from allergens, insects, and non-insect allergens
	<ol>
		<li>Put HDM, insects, or non-insect animals collected alive or obtained commercially into 50 mL tubes, and quickly freeze with liquid-N2. Then store at -70 &#176;C for subsequent total RNA isolation. 
		NOTE: In this experiment, HDM, insect, and non-insect animals were selected because they are known to be common sources of allergens. Further, an immunostimulatory function of their RNAs remain unclear.</li>
		<li>Transfer a proper amount (equivalent to 100 &#956;L in volume or less) of HDM, insects or non-insect animals stored at -70 &#176;C into a 2 mL tube containing beads (1.4 mm ceramic spheres), then freeze tubes in a liquid-N2 container for ~10 min.</li>
		<li>For the total RNA isolation, add 1 mL of guanidinium thiocyanate-based RNA isolation reagent24 to each tube, then break the insect and non-insect small animals with a high-energy cell disrupter at the maximum speed for 45 s and chill on ice. Repeat this step twice.</li>
		<li>Transfer the solution from step 1.1.3 into a new 1.5 mL tube and add 200 &#956;L of chloroform to each tube and vortex. Centrifuge tubes at 14,000 x g for 14 min at 4 &#176;C.</li>
		<li>Once centrifugation is completed, transfer the upper aqueous phase (200 &#956;L) into a new 1.5 mL tube containing 500 &#956;L of isopropanol to precipitate RNA pellet. Do not disturb the interphase. The recommended volume ratio of the upper phase versus isopropanol is 1:2.5 ratio.</li>
		<li>Mix by gentle vortexing, then centrifuge tubes at 14,000 x g for 14 min at 4 &#176;C.</li>
		<li>Aspirate the supernatant with caution then wash the RNA pellet with 500 &#956;L of 75% ethanol and centrifuge at 7,500 x g for 10 min at 4 &#176;C. Remove all liquid with caution, air-dry the pellet and dissolve the RNA pellet with 20-50 &#956;L of RNase-free H2O.</li>
		<li>Measure the RNA concentration with a spectrophotometer using the following parameters:
		<ol>
			<li>Open the associated software and select the type of nucleic acids to measure. Change the sample type to RNA.</li>
			<li>Perform the blank measurement with 1-2 &#956;L of RNase-free H2O. Wipe off the RNase-free H2O. Now, the instrument is ready for the measurement.</li>
			<li>Load 1-2 &#956;L of the RNA sample and measure the RNA concentration (&#956;g/&#956;L). 
			NOTE: The ratio of the absorbance at 260 and 280 nm (A260/280) at ~2.0 (1.9-2.2) is generally accepted as &#8220;pure&#8221; for RNA. If not processed immediately, store RNA samples at -70 &#730;C and avoid the freeze-thaw cycles to keep the RNA intact.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Detection of dsRNA structure in the total RNA using dsRNA specific J2 antibody
	<ol>
		<li>Prepare two 20 &#956;L of RNA samples (200 ng/&#956;L). One with RNase-III treatment (1 &#956;L for 1 &#956;g RNA, incubate at 37 &#176;C for 60 min), and the other without RNase-III treatment. 
		NOTE: RNase III is used here to specifically degrade dsRNA, but not single-stranded RNA25.</li>
		<li>Use a pencil to draw grids where RNA samples will be blotted on the membrane.</li>
		<li>Spot 2 &#956;L of the 200 ng/&#956;L of the RNA sample onto the positively charged nylon membrane.</li>
		<li>Crosslink the samples to the membrane at 1,200 microjoules x 100 in a UV crosslinker. Repeat steps 1.2.3 and 1.2.4 two more times in the sample spot place. This will result in total 0.8&#160;&#956;g per blot. 
		NOTE: Do not spot more than 2 &#956;L of RNA sample on the membrane at a time.</li>
		<li>Block non-specific binding with 5% milk in TBS-T for 1 h with shaking at room temperature. Remove the blocking solution from step 1.2.5 and add the anti-dsRNA J2 antibody at the 1:1,000 dilution in 1% milk in TBS-T and incubate overnight with shaking at 4 &#176;C.</li>
		<li>Wash the membrane with TBS-T for 5 min and repeat this step for 3 times. Add the secondary antibody (Alkaline phosphatase-conjugated Anti-Mouse IgG diluted in 1% milk 1:5,000) and incubate for 1 h on a shaker at room temperature. Wash the membrane with TBS-T for 5 min and repeat this step for 3x.</li>
		<li>Add the substrate (BCIP/NBT) and incubate for 5-15 min until a desired signal is visible.</li>
		<li>Stop the reaction by rinsing the membrane with ddH2O.</li>
		<li>Dry the membrane on tissue papers and take a photograph using a smartphone (a representative result is shown in Figure 1).</li>
	</ol>
	</li>
</ol>
2. RT-qPCR to measure the ability of HDM total RNA in stimulating lung ISGs expression
<ol>
	<li>RNA isolation from mice lung tissues 
	NOTE: Mice (female, 8-12 weeks old, C57BL/6J) were maintained under specific pathogen-free conditions.
	<ol>
		<li>Briefly anesthetize the animal with isoflurane and administer via the intratracheal instillation with 5 &#956;g (diluted in 80 &#956;L PBS) of HDM RNAs treated with or without RNase III.</li>
		<li>After 16-18 h post HDM RNA treatment, sacrifice the mouse by CO2 inhalation for a few minutes. Then, place the mouse on a platform and pin limbs with needles.</li>
		<li>Disinfect the mouse with 70% ethanol then cut the skin starting from abdomen to the neck with a sterilized scissor.</li>
		<li>Fix the skin with needles and cut the ribs to expose the lungs. Remove the whole lungs and wash them with cold PBS. Place the lungs on tissue papers and excise one small piece of each lung-lobe into a 2 mL tube containing beads (200-300 &#956;L in volume, 1.4 mm ceramic spheres). 
		NOTE: The purpose of using ceramic beads is to grind whole lung tissues</li>
		<li>Freeze the lung samples by placing tubes into a liquid-N2 container for ~10 min.</li>
		<li>Add 500 &#956;L of guanidinium thiocyanate-based RNA isolation reagent to each tube and break the lung tissues with a homogenizer for 45 s. Chill on ice between each step. Repeat this step twice.</li>
		<li>Follow the steps 1.1.4- 1.1.7 for lung RNA isolation.</li>
		<li>Air-dry the pellet and dissolve the RNA pellet with proper amount of RNase-free H2O (~20-30 &#956;L).</li>
		<li>Measure the RNA concentration as described in step 1.1.8.</li>
	</ol>
	</li>
	<li>RT-qPCR to determine the ability of HDM RNA in stimulating lung gene expression.
	<ol>
		<li>Using 100 ng/&#956;L of RNA extracted from lung tissues as the template, perform the cDNA synthesis according to the referenced protocol26.</li>
		<li>Set up an RT-qPCR reaction at 10 &#956;L/well for a 384-well plate using cDNA generated above and the gene-specific primer pairs (Table 1 and Table 2).</li>
		<li>Seal the wells tightly with a transparent adhesive film and vortex the plate for 30 s. Spin the plate at 1,000 x g for 30 s to collect samples at the bottom of the wells.</li>
		<li>Load the plate onto a RT-qPCR machine and start to run the RT-qPCR reaction using the thermal cycler protocol (Table 3).</li>
		<li>Export the results into a spreadsheet file or analyze the data using the software provided by the manufacture after the program is completed (a representative result is shown in Figure 2).</li>
	</ol>
	</li>
</ol>
3. FACS analysis to determine the effects of HDM RNA on the infiltration of eosinophils in BAL and lung
<ol>
	<li>BAL fluid collection for FACS analysis
	<ol>
		<li>Euthanize mice (female, 8-12 weeks old, C57BL/6J) that were treated with HDM allergen extracts (according to the experimental design shown in Figure 3B) by CO2 inhalation.</li>
		<li>Place the mouse on a platform and pin limbs with needles.</li>
		<li>Disinfect the mouse with 70% ethanol. Use scissors to cut the skin from the upper area of the abdomen to the neck.</li>
		<li>Gently, pull the salivary glands and the sternohyoid muscle carefully apart using the forceps to expose the trachea. Place a nylon string (~10 cm) under the trachea using forceps.</li>
		<li>Make an incision in the trachea (~2 mm under the larynx) just enough to insert a cannula. Do not cut through the trachea. Knot the string around trachea and cannula.</li>
		<li>Load the syringe with 1 mL of PBS+EDTA and attach it to the end of the cannula. Inject 1 mL of PBS+EDTA into the lung and completely aspirate the solution. Detach the syringe from the cannula carefully and transfer&#160;the solution into a 15 mL tube on ice.</li>
		<li>Reload the syringe with the fresh PBS+EDTA and repeat this step 2x.</li>
		<li>Centrifuge the tube containing the pooled BAL obtained in step 3.1.7 to pellet the cells at 500 x g for 7 min at 4 &#176;C. Record the volume of BAL fluid then transfer the supernatant to two 1.5 mL tubes without disturbing the pellet. 
		NOTE: The supernatant of BAL can be stored at -70 &#176;C for future analysis e.g., ELISA.</li>
		<li>In case there are RBCs present in the pellet due to severe lung inflammation, after removing the supernatant, add 500 &#956;L of RBC lysis buffer and mix well by resuspension. Transfer the solution into a new 1.5 mL tube and centrifuge for 7 min at the speed of 500 x g at 4 &#176;C.</li>
		<li>Remove the supernatant and resuspend the pellet in 150 &#956;L of FACS buffer.</li>
		<li>Transfer the 150 &#956;L of the resuspended sample into 96-well plate and centrifuge the plate for 7 min at the speed of 500 x g at 4 &#176;C.</li>
		<li>Quickly, invert the plate on tissue papers to collect the cells residing at the bottom of the wells.</li>
		<li>Stain the cells with antibodies in FACS buffer in the presence of 2.4G2 blocking antibody (2.5 &#956;g / 100 &#956;L). Incubate the plate at room temperature for 30 min in a dark place.</li>
		<li>After staining, centrifuge the plate to pellet the cells at 500 x g for 7 min at 4 &#176;C.</li>
		<li>Remove the staining solution by inverting the plate on tissue paper then wash by resuspending with 100 &#956;L of FACS buffer. Next, centrifuge the plate again at 500 x g for 7 min at 4 &#176;C and remove the FACS buffer by inverting the plate on tissue paper.</li>
		<li>Resuspend samples into 150 &#956;L of FACS buffer and transfer samples to the FACS tubes containing 350 &#956;L of FACS buffer. Add 25 &#956;L of counting beads to each sample. Samples are now ready for flow cytometry analysis. 
		NOTE: Various cell types in BAL fluid were labeled with antibodies as indicated. Counting beads were added before the FACS run. Flow cytometry data were analyzed using a commercially available software. Refer to Figure 3 and Table 4 for gating strategy.</li>
	</ol>
	</li>
	<li>Lung tissue digestion for the FACS analysis
	<ol>
		<li>Follow steps 3.1.1 - 3.1.3.</li>
		<li>Cut the skin starting from abdomen to the neck with a sterilized scissor. Fix the skin with needles and cut the ribs to expose the lungs.</li>
		<li>Remove the whole lungs and wash them with cold PBS. Place samples in the 1.5 mL tube containing 50 &#956;L of lung digestion solution.</li>
		<li>Mince the lung tissues into small pieces with a curved scissor. Transfer the lung tissues into a 6-well plate, then add 8 mL of lung digestion solution. Place the plate on a shaker in 37 &#176;C incubator for 45 min.</li>
		<li>After incubation, use the top of 1.5 mL tube to grind the lung tissues. Place a 70 &#181;m strainers on a new 6-well plate and apply the sample through 0.22 &#181;m filter.</li>
		<li>Transfer the filtered solution into a 15 mL tube, then centrifuge the tubes at 500 x g for 7 min at 4 &#176;C. Aspirate the supernatant and resuspend the pellet in 1 mL of RBC lysis buffer and leave it on ice for 3 min.</li>
		<li>Transfer the sample into 1.5 mL tube and centrifuge at 500 x g for 7 min at 4 &#176;C. Repeat 2x</li>
		<li>Wash the lung cells 2x with 1 mL FACS buffer. Aspirate the supernatant and resuspend the pellet in 1 mL of FACS buffer, and then transfer 100 &#956;L of the sample into 96 well plate.</li>
		<li>Centrifuge the plate for 7 min at the speed of 500 x g at 4 &#176;C. Follow the steps described in BAL fluid collection for FACS analysis (3.1.13 to 3.1.16) to stain the cells of digested lung tissue samples. 
		NOTE: Eosinophils in the lungs were labeled with antibodies as indicated, then mixed with counting beads for further FACS analysis. Flow cytometry data were analyzed using associated software. Refer to Figure 3 for evaluating HDM RNA-induced immune responses.</li>
	</ol>
	</li>
</ol>
4. Statistical analysis
<ol>
	<li>Perform statistical analysis using a commercially available software.</li>
	<li>Determine the p values by unpaired two-tailed Student t test for the comparison of two groups.</li>
	<li>Calculate the absolute numbers of eosinophils based on reference beads (top panel) using the formula</li>
</ol>
<img alt="Equation 1" src="/files/ftp_upload/61183/61183equ01.jpg" />
<ol start="4">
	<li>Determine the p values by two-way ANOVA and Sidak&#8217;s multiple comparisons test for the comparison of more than two groups.</li>
	<li>Consider a p value smaller than 0.05 as statistically significant. The p values are indicated on plots as *p &#60;0.05, **p&#60;0.01, ***p&#60;0.001, and ****p&#60;0.0001. 
	NOTE: All buffer recipes are provided in Table 5.</li>
</ol>

<ol>
	<li>Strachan, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hay+fever,+hygiene,+and+household+size.">Hay fever, hygiene, and household size.</a> BMJ. 299, 1259-1260 (1989).</li><li>Schuijs, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Farm+dust+and+endotoxin+protect+against+allergy+through+A20+induction+in+lung+epithelial+cells.">Farm dust and endotoxin protect against allergy through A20 induction in lung epithelial cells.</a> Science. 349, 1106-1110 (2015).</li><li>Stein, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+Immunity+and+Asthma+Risk+in+Amish+and+Hutterite+Farm+Children.">Innate Immunity and Asthma Risk in Amish and Hutterite Farm Children.</a> New England Journal of Medicine. 375, 411-421 (2016).</li><li>Roers, A., Hiller, B., Hornung, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recognition+of+Endogenous+Nucleic+Acids+by+the+Innate+Immune+System.">Recognition of Endogenous Nucleic Acids by the Innate Immune System.</a> Immunity. 44, 739-754 (2016).</li><li>Schlee, M., Hartmann, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Discriminating+self+from+non-self+in+nucleic+acid+sensing.">Discriminating self from non-self in nucleic acid sensing.</a> Nature Reviews Immunology. 16, 566-580 (2016).</li><li>Wu, J., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+immune+sensing+and+signaling+of+cytosolic+nucleic+acids.">Innate immune sensing and signaling of cytosolic nucleic acids.</a> Annual Reviews Immunology. 32, 461-488 (2014).</li><li>O'Hara, A. M., Shanahan, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+flora+as+a+forgotten+organ.">The gut flora as a forgotten organ.</a> EMBO Reports. 7 (7), 688-693 (2006).</li><li>. Focused Meeting 2018: Microbes and Mucosal Surfaces Available from: <a target="_blank" href="https://microbiologysociety.org/event/society-events-and-meetings/focused-meeting-2018-microbes-and-mucosal-surfaces.html">https://microbiologysociety.org/event/society-events-and-meetings/focused-meeting-2018-microbes-and-mucosal-surfaces.html</a> (2018)</li><li>Weber, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-stranded+RNA+is+produced+by+positive-strand+RNA+viruses+and+DNA+viruses+but+not+in+detectable+amounts+by+negative-strand+RNA+viruses.">Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses.</a> Journal of Virology. 80, 5059-5064 (2006).</li><li>Barral, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functions+of+the+cytoplasmic+RNA+sensors+RIG-I+and+MDA-5:+Key+regulators+of+innate+immunity.">Functions of the cytoplasmic RNA sensors RIG-I and MDA-5: Key regulators of innate immunity.</a> Pharmacology and Therapeutics. 124, 219-234 (2009).</li><li>Netea, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+the+Th1/Th2+paradigm+towards+a+Toll-like+receptor/T-helper+bias.">From the Th1/Th2 paradigm towards a Toll-like receptor/T-helper bias.</a> Antimicrobial Agents and Chemotherapy. 49, 3991-3996 (2005).</li><li>McNally, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intranasal+administration+of+dsRNA+analog+poly(I:C)+induces+interferon-alpha+receptor-dependent+accumulation+of+antigen+experienced+T+cells+in+the+airways.">Intranasal administration of dsRNA analog poly(I:C) induces interferon-alpha receptor-dependent accumulation of antigen experienced T cells in the airways.</a> PLoS One. 7, 51351 (2012).</li><li>Seya, T., Takeda, Y., Matsumoto, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+vaccines+with+dsRNA+adjuvant+ARNAX+induces+antigen-specific+tumor+shrinkage+without+cytokinemia.">Tumor vaccines with dsRNA adjuvant ARNAX induces antigen-specific tumor shrinkage without cytokinemia.</a> Oncoimmunology. 5, 1043506 (2016).</li><li>Toussi, D. N., Massari, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+Adjuvant+Effect+of+molecularly+defined+Toll-Like+Receptor+Ligands.">Immune Adjuvant Effect of molecularly defined Toll-Like Receptor Ligands.</a> Vaccines (Basel). 2, 323-353 (2014).</li><li>She, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+Sensing+of+Aeroallergen-Associated+Double-Stranded+RNA+Triggers+an+IFN+Response+and+Modulates+Type+2+Lung+Inflammation.">Immune Sensing of Aeroallergen-Associated Double-Stranded RNA Triggers an IFN Response and Modulates Type 2 Lung Inflammation.</a> Journal of Immunology. 203, 2520-2531 (2019).</li><li>Fujimoto, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pulmonary+inflammation+and+cytokine+dynamics+of+bronchoalveolar+lavage+fluid+from+a+mouse+model+of+bronchial+asthma+during+A(H1N1)pdm09+influenza+infection.">Pulmonary inflammation and cytokine dynamics of bronchoalveolar lavage fluid from a mouse model of bronchial asthma during A(H1N1)pdm09 influenza infection.</a> Science Reports. 7, 9128 (2017).</li><li>Yao, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+Autonomous+Memory+Alveolar+Macrophages+Requires+T+Cell+Help+and+Is+Critical+to+Trained+Immunity.">Induction of Autonomous Memory Alveolar Macrophages Requires T Cell Help and Is Critical to Trained Immunity.</a> Cell. 175, 1634-1650 (2018).</li><li>Dua, K., Shukla, S. D., Hansbro, P. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aspiration+techniques+for+bronchoalveolar+lavage+in+translational+respiratory+research:+Paving+the+way+to+develop+novel+therapeutic+moieties.">Aspiration techniques for bronchoalveolar lavage in translational respiratory research: Paving the way to develop novel therapeutic moieties.</a> Journal of Biological Methods. 4, 73 (2017).</li><li>Van Hoecke, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bronchoalveolar+Lavage+of+Murine+Lungs+to+Analyze+Inflammatory+Cell+Infiltration.">Bronchoalveolar Lavage of Murine Lungs to Analyze Inflammatory Cell Infiltration.</a> Journal of Visualized Experiments. (123), e55398 (2017).</li><li>Salahuddin, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Processing+of+Bronchoalveolar+Lavage+Fluid+and+Matched+Blood+for+Alveolar+Macrophage+and+CD4++T-cell+Immunophenotyping+and+HIV+Reservoir+Assessment.">Processing of Bronchoalveolar Lavage Fluid and Matched Blood for Alveolar Macrophage and CD4+ T-cell Immunophenotyping and HIV Reservoir Assessment.</a> Journal of Visualized Experiments. (148), e59427 (2019).</li><li>Son, K. N., Liang, Z., Lipton, H. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Double-Stranded+RNA+Is+Detected+by+Immunofluorescence+Analysis+in+RNA+and+DNA+Virus+Infections,+Including+Those+by+Negative-Stranded+RNA+Viruses.">Double-Stranded RNA Is Detected by Immunofluorescence Analysis in RNA and DNA Virus Infections, Including Those by Negative-Stranded RNA Viruses.</a> Journal of Virology. 89, 9383-9392 (2015).</li><li>Monsion, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+Detection+of+Long+dsRNA+in+Vitro+and+in+Vivo+Using+the+dsRNA+Binding+Domain+from+FHV+B2+Protein.">Efficient Detection of Long dsRNA in Vitro and in Vivo Using the dsRNA Binding Domain from FHV B2 Protein.</a> Front Plant Sci. 9, 70 (2018).</li><li>Redente, E. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Age+and+sex+dimorphisms+contribute+to+the+severity+of+bleomycin-induced+lung+injury+and+fibrosis.">Age and sex dimorphisms contribute to the severity of bleomycin-induced lung injury and fibrosis.</a> American Journal of Physiology-Lung Cellular and Molecular Physiology. 301, 510-518 (2011).</li><li>Card, J. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gender+differences+in+murine+airway+responsiveness+and+lipopolysaccharide-induced+inflammation.">Gender differences in murine airway responsiveness and lipopolysaccharide-induced inflammation.</a> Journal of Immunology. 177, 621-630 (2006).</li><li>Gueders, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+models+of+asthma:+a+comparison+between+C57BL/6+and+BALB/c+strains+regarding+bronchial+responsiveness,+inflammation,+and+cytokine+production.">Mouse models of asthma: a comparison between C57BL/6 and BALB/c strains regarding bronchial responsiveness, inflammation, and cytokine production.</a> Inflammation Research. 58, 845-854 (2009).</li></ol>

We have nothing to disclose.

The current protocol describes how to evaluate the immunostimulatory properties of allergen-associated microbial RNA and their impacts on the development of eosinophilic lung inflammation in a mouse model of allergic asthma. Although long dsRNAs are known as the replication intermediates of many viruses that can potently activate interferon responses in mammalian cells, their presences in HDM allergens have been unknown until our recent work15. The combination of RNA dot blot, RT-qPCR and FACS analysis presented in this manuscript may provide a good example to dissect innate components such as the dsRNA species in environmental allergens that are critically involved in regulating allergen-induced eosinophilic inflammation.
In this protocol, the RNA dot blot has been employed to detect the presence of dsRNA structures in natural allergens using a mouse monoclonal antibody J2, which specifically binds to the dsRNA (&#8805;40bp) independent of sequence. This method is highly reliable because J2 antibody can still recognize dsRNA samples pretreated with RNase T1 (single stranded RNA-specific endonuclease), but not samples pretreated with RNase III (a dsRNA-specific endonuclease). However, it is worth pointing out that a widely used synthetic analogue of dsRNA, Polyinosinic:polycytidylic acid [Poly(I:C)], has been reported to preferentially bind to another anti-dsRNA monoclonal antibody K1, instead of J221,22,23. Therefore, the use of J2 antibody for the detection of Poly(I:C) is not recommended.
Cell type analysis on samples collected from BAL or lung tissues is useful for assessing the progression of allergic lung inflammation. Although BAL procedure is a common technique, the results may vary among research laboratories. Numerous factors may cause these variations such as the amount of bronchoalveolar lavage collected. The ideal volume of BAL recovered from an 8-12 weeks old mice is ~3 ml19. Another factor that may contribute to the lack of reproducibility is how deep the catheter should be inserted into the trachea (~0.5 cm is optimal) because deeper insertion of the catheters may cause damage to the trachea. In addition, researchers should also consider other factors such as the age, strain, and gender of the mice as these factors can greatly impact the experiment results27,28,29.
Here, we provide a technical protocol to characterize immunomodulatory effects of HDM RNA in vitro and in vivo using RNA dot blot, RT-qPCR and FACS analysis of BAL and lung tissues. Proper practices can ensure successful reproducibility of results obtained when performing these techniques. For instance, try to avoid the contamination of RNases when performing RNA dot blot. Also, the centrifugation speed should be properly adjusted since the unnecessary higher centrifugation speed may compromise cell viability. Finally, cells used for the FACS analysis should be fixed if not analyzed on the same day.
Since innate immunity plays a pivotal role in host defense and inflammation2,3, the techniques and methods described in this paper will be very useful for studying the immunomodulatory role of other innate immune components such as microbial DNA in natural allergens in the development of type 2 inflammation.

Based on the hygiene hypothesis originally proposed by Strachan1, early childhood exposure to environmental microbial factors such as endotoxin can protect against the development of allergic disorders2,3. During microbial infections, e.g., viral infections, the innate immune detection of foreign nucleic acids (RNA/DNA) triggers host defense responses4,5,6. However, the existence and prevalence of immunogenic nucleic acids such as long double-stranded RNA (dsRNA) species in house dust mites (HDM) or other insect allergens remain unknown. This protocol was designed to determine whether HDM or insect and non-insect allergens contain long dsRNA species that can activate a protective immune response to counteract the development of severe eosinophilic lung inflammation in a mouse model of allergic asthma. Here, we provide three simple and fast methods to evaluate the structural determinants in HDM total RNA that are required for regulating allergen-induced eosinophilic lung inflammation.
The mucosal immune system is the largest immune organ in the body and serves as the first line of host defense against both microbial infections and allergic insults7,8. The long dsRNA, the replication intermediate of many viruses, is known to function as a pathogen-associated molecular pattern (PAMP) to potently stimulate innate responses via Toll like receptor 3 (TLR3) to induce the expression of interferon stimulated genes (ISGs)9,10,11,12,13,14. We have recently shown that HDM total RNA contained dsRNA structures, which upregulated the expression of ISGs and reduced severe eosinophilic lung inflammation when administered via the intratracheal instillation in a murine model of allergic asthma induced by HDM extracts15. The severity of lung inflammations is determined by analyzing the immune cell types in bronchoalveolar lavage (BAL) and lung tissue via flow cytometry16,17,18,19,20.
This protocol includes three assays: 1) rapid detection of dsRNA structures with RNA dot blot using a mouse monoclonal antibody J2 which specifically binds to the dsRNA (&#8805;40bp) in a sequence-independent manner; 2) quick evaluation for in vivo effects of immunostimulatory RNA in mouse lungs by measuring the induction of ISGs using RT-qPCR; 3) accurate quantification of eosinophils in BAL and lung in the context of HDM-induced lung inflammation using flow cytometry analysis.
The above assays can be used to study not only allergic lung diseases, but also respiratory bacterial and viral infections. For example, the dsRNA specific J2 antibody can also be used in other applications such as immunoaffinity chromatography, immunohistochemistry, enzyme-linked immunosorbent assay (ELISA) and immunostaining21,22,23. In addition, several applications downstream of BAL fluid collection can be utilized for quantifying soluble contents such as cytokines and chemokines using ELISA, and transcriptional profiling of cells in the airways (e.g., alveolar macrophages). Although there are a variety of protocols available in the literature to evaluate lung conditions, most of these protocols often focus on the target validation. The procedures described here can be applied to identify components in environmental allergens that are important for regulating the development of allergic diseases.

<table><tbody><tr><td>0.40 &amp;micro;m Falcon Cell Strainer</td><td>Thermo Fisher Scientific</td><td>08-771-1</td><td></td></tr><tr><td>1 mL syringes</td><td>Henke Sass Wolf</td><td>5010.200V0</td><td></td></tr><tr><td>15 mL Tube</td><td>TH.Geyer</td><td>7696702</td><td></td></tr><tr><td>50 mL Tube</td><td>TH.Geyer</td><td>7696705</td><td></td></tr><tr><td>70% ethanol</td><td>Decon Labs</td><td>2701</td><td></td></tr><tr><td>Absolute Counting Beads</td><td>Life Technologies Europe B.V.</td><td>C36950</td><td></td></tr><tr><td>ACK-RBC lysing buffer</td><td>Lonza</td><td>10-548E</td><td></td></tr><tr><td>Amersham Hybond-N+ Membrane</td><td>GE Healthcare</td><td>RPN203B</td><td></td></tr><tr><td>Ant</td><td>San Antonio</td><td>Note: Locally collected</td><td></td></tr><tr><td>Antibody dilution buffer</td><td></td><td>(see Table 5 for recipe)</td><td></td></tr><tr><td>Anti-Mouse CD11b V450 Rat (clone M1/70)</td><td>BD Bioscience</td><td>560456</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse CD11c PE-Cy7 (clone N418)</td><td>BioLegend</td><td>117317</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse CD19 Alexa Flour 647 (clone 1D3)</td><td>eBioscience</td><td>15-0193-81</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse CD3e APC (clone 145-2C11)</td><td>Invitrogen</td><td>15-0031-81</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse CD45 APC-Cy7 (clone: 30-F11)</td><td>BioLegend</td><td>103130</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse Fixable Viabillity Dye eFluor 506</td><td>Invitrogen</td><td>65-0866-14</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse IgG (H+L), AP Conjugate</td><td>Promega</td><td>S3721</td><td></td></tr><tr><td>Anti-Mouse Ly-6G FITC (clone RB6-8C5)</td><td>Invitrogen</td><td>11-5931-82</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse MHC II APC-eFluor 780 (clone M5/114.15.2)</td><td>eBioscience</td><td>47-5321-80</td><td>1 to 200 dilution</td></tr><tr><td>Anti-Mouse Siglec-F PE (clone E50-2440)</td><td>BD Pharmingen</td><td>552126</td><td>1 to 200 dilution</td></tr><tr><td>BCIP/NBT substrate</td><td>Thermo Fisher Scientific</td><td>PI34042</td><td></td></tr><tr><td>Blocking Buffer</td><td></td><td>(see Table 5 for recipe)</td><td></td></tr><tr><td>Cannual, 20G X 1.5&amp;rdquo;</td><td>CADENCE SCIENCE</td><td>9920</td><td></td></tr><tr><td>Centrifuge</td><td>Thermo Fisher Scientific</td><td>75004030</td><td></td></tr><tr><td>CFX384 Touch Real-Time PCR Detection System</td><td>Bio-Rad Laboratories</td><td>1855485</td><td></td></tr><tr><td>Chloroform</td><td>Thermo Fisher Scientific</td><td>C298-500</td><td></td></tr><tr><td>Cockroach</td><td>Greer Laboratories</td><td>B26</td><td></td></tr><tr><td>Counting beads</td><td>Thermo Fisher Scientific</td><td>01-1234-42</td><td></td></tr><tr><td>D. farinae</td><td>Greer Laboratories</td><td>B81</td><td></td></tr><tr><td>D. pteronyssinus</td><td>Greer Laboratories</td><td>B82</td><td></td></tr><tr><td>Denville Cell Culture Plates with lid, 96 well cell culture plate</td><td>Thomas Scientific</td><td>1156F03</td><td></td></tr><tr><td>Digital Dry Bath - Four Blocks</td><td>Universal Medical, Inc.</td><td>BSH1004</td><td></td></tr><tr><td>Earthworm</td><td>San Antonio</td><td>Note: Locally collected</td><td></td></tr><tr><td>Ethylenediaminetetraacetic acid (EDTA)</td><td>Sigma-Aldrich</td><td>E6511</td><td></td></tr><tr><td>FACS buffer</td><td></td><td>(see recipe in Table 5)</td><td></td></tr><tr><td>Falcon Round-Bottom Polypropylene Tubes, 5 mL</td><td>STEMCELLTM TECHNOLOGIES</td><td>38056</td><td></td></tr><tr><td>Flow cytometer (BD FACS Celesta)</td><td>BD Biosciences</td><td></td><td></td></tr><tr><td>Fly</td><td>Greer Laboratories</td><td>B8</td><td></td></tr><tr><td>Forceps</td><td>Roboz Surgical Instrument</td><td>RS-5135</td><td></td></tr><tr><td>Hemocytometer</td><td>Hausser Scientific</td><td>3110</td><td></td></tr><tr><td>HT-DNA</td><td>Sigma</td><td>D6898</td><td></td></tr><tr><td>In Vivo MAb anti-mouse CD16/CD32 (clone: 2.4G2)</td><td>Bio X Cell</td><td>BE0307</td><td></td></tr><tr><td>iScript cDNA Synthesis Kit</td><td>Bio-Rad Laboratories</td><td>1708891</td><td></td></tr><tr><td>Isoflurane</td><td>Abbott Labs</td><td>sc-363629Rx</td><td></td></tr><tr><td>Isopropanol</td><td>Thermo Fisher Scientific</td><td>BP2618500</td><td></td></tr><tr><td>J2 anti-dsRNA monoclonal antibody</td><td>SCICONS</td><td>10010200</td><td></td></tr><tr><td>Lung digestion solution</td><td></td><td>(see recipe in Table 5)</td><td></td></tr><tr><td>Lysing Matrix D</td><td>MP Biomedicals</td><td>116913050-CF</td><td></td></tr><tr><td>Lysing Matrix D, 2 mL tube</td><td>MP Biomedicals</td><td>SKU:116913100</td><td></td></tr><tr><td>Mice (female, 8-12 weeks old, C57BL/6J)</td><td>Jackson Laboratory</td><td>#000664</td><td></td></tr><tr><td>Microcentrifuge tube 1.5 mL</td><td>Sigma-Aldrich</td><td>30120.094</td><td></td></tr><tr><td>Microscope</td><td>Olympus</td><td>CK30</td><td></td></tr><tr><td>Mini-BeadBeater</td><td>Homogenizers</td><td>SKU:BS:607</td><td></td></tr><tr><td>Mini-Beadbeater-16</td><td>Biospec</td><td>607</td><td></td></tr><tr><td>Mosquito</td><td>Greer Laboratories</td><td>B55</td><td></td></tr><tr><td>NanoDrop 2000C</td><td>Thermo Scientific Spectophotometer Medex Supply</td><td>TSCND2000C</td><td></td></tr><tr><td>Needle, 21 G x 1 1/2 in</td><td>BD Biosciences</td><td>305167</td><td></td></tr><tr><td>Non-fat milk</td><td>Bio-Rad Laboratories</td><td>1706404</td><td></td></tr><tr><td>Nylon string</td><td>Dynarex</td><td>3243</td><td></td></tr><tr><td>Phosphate-buffered Saline (PBS)</td><td>Lonza</td><td>BE17-516F</td><td></td></tr><tr><td>RNase III</td><td>Thermo Fisher Scientific</td><td>AM2290</td><td></td></tr><tr><td>RNase T1</td><td>Thermo Fisher Scientific</td><td>AM2283</td><td></td></tr><tr><td>Scissors</td><td>Roboz Surgical Instrument</td><td>RS-6802</td><td></td></tr><tr><td>Shaker or Small laboratory mixer</td><td>Boekel Scientific</td><td>201100</td><td></td></tr><tr><td>SPHERO AccuCount Fluorescent</td><td>Spherotech</td><td>ACFP-70-5</td><td>1 to 10 dilution</td></tr><tr><td>Spider</td><td>San Antonio</td><td>Note: Locally collected</td><td></td></tr><tr><td>TBS</td><td></td><td>(see recipe in Table 5)</td><td></td></tr><tr><td>TBS-T</td><td></td><td>(see recipe in Table 5)</td><td></td></tr><tr><td>Total cell medium</td><td></td><td>(see recipe in Table 5)</td><td></td></tr><tr><td>TRIzol Reagent</td><td>Thermo Fisher Scientific</td><td>15596018</td><td></td></tr><tr><td>Tween 20</td><td>Sigma-Aldrich</td><td>P9416</td><td></td></tr><tr><td>UV Stratalinker 2400 UV</td><td>LabX</td><td>20447</td><td></td></tr><tr><td>Wasp</td><td>San Antonio</td><td>Note: Locally collected</td><td></td></tr></tbody></table>

identification and characterization of immunogenic rna species in hdm allergens that modulate eosinophilic lung inflammation

Environmental allergens such as house dust mites (HDM) are often in complex forms containing both allergic proteins that drive aberrant type 2 responses and microbial substances that induce innate immune responses. These allergen-associated microbial components play an important role in regulating the development of type 2 inflammatory conditions such as allergic asthma. However, the underlying mechanisms remain largely undefined. The protocol presented here determines the structural characteristics and in vivo activity of allergen-associated immunostimulatory RNA. Specifically, common allergens are examined for the presence of double-stranded RNA (dsRNA) species that can stimulate IFN responses in lungs and restrain&#160;the development of severe lung eosinophilia in a mouse model of HDM-induced allergic asthma. Here, we have included the following three assays: Dot blot to show the dsRNA structures in total RNA isolated from allergens including HDM species, RT-qPCR to measure the activities of HDM RNA in interferon stimulating genes (ISGs) expression in mouse lungs and FACS analysis to determine the effects of HDM RNA on the number of eosinophils in BAL and lung, respectively.

The presence of long dsRNA structures in HDM, insects and non-insect small animals was examined by dot blot using a dsRNA-specific mouse monoclonal antibody J2 (&#8805; 40bp). RNase III was used to digest dsRNA into 12&#8211;15 bp dsRNA fragments, which were undetectable by J2 (Figure 1).
The ability of HDM total RNA to stimulate an innate immune response in mouse lungs in a dose-dependent manner&#160;was analyzed by RT-qPCR (Figure 2, upper). The RNase III treatment abolished the immunostimulatory activity of HDM total RNA, indicating that dsRNA structures in HDM total RNA is essential for innate immune activity in the lungs (Figure 2, lower).
The inhibitory effects of HDM total RNA on the development of a severe type 2 lung inflammation were evaluated with the FACS analysis (Figure 3A). In this study, the eosinophilic lung inflammation was induced by HDM extracts, which were treated with or without RNase III as depicted in the experimental design (Figure 3B). RNase III treatment was used to remove long dsRNA species from HDM extracts. As expected, the degradation of long dsRNA species resulted in severe type 2 lung inflammation reflected by the increased eosinophils numbers in BAL and lungs. Notably, the number of eosinophils in the HDM total RNA-treated group is comparable to the group treated with the original HDM extract that endogenously contains the long dsRNA species (Figure 3B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61183/61183fig01.jpg" /> 
Figure 1: Detection of the dsRNA structures in HDM RNAs by dsRNA specific J2 Ab using dot blot.&#160;Total RNA from different aeroallergens including Dermatophagoides farinae (D.f.) and Dermatophagoides pteronyssinus (D.p.) was blotted on a nylon membrane for the detection of dsRNA (left panel). HDM (D.f. and D.p.) RNA was left untreated (-), treated with RNase III (dsRNA-specific nuclease) and RNase T1 (ssRNA-specific nuclease) (right panel). This figure is reprinted from She et al.15. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61183/61183fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61183/61183fig02.jpg" /> 
Figure 2: Induction of ISG mRNA expression by total RNA from HDM (D.f.) was measured by RT-PCR.&#160;When delivered into mouse lungs, HDM RNA was able to stimulate the expression of ISGs in a dose-dependent manner (upper panel). RNase III treatment eliminated the immune stimulating activity of HDM RNA (lower panel). This figure is reprinted from She et al.15. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61183/61183fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/61183/61183fig03.jpg" /> 
Figure 3: Characterization of specific cell types in the airways and evaluation of BAL fluid and lung eosinophils.&#160;(A) Gating strategy used to identify cells recovered from BAL fluid were stained for cell surface markers as indicated. (B) Administration of HDM (D.f.) RNA at 5 &#956;g/mouse (blue bar) versus control mouse lung RNA (red bar). HDM (D.f.) RNA but not dsRNA-depleted HDM extract decreased the number of eosinophils in both airways and lungs of animals treated with HDM extract. This figure is reprinted from She et al.15. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61183/61183fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Mouse Primers</td>
			<td colspan="2">Sequence (Forward-Reverse, 5&#8217;&#8594;3&#8217;)</td>
		</tr>
		<tr>
			<td>RPL19</td>
			<td colspan="2">AAATCGCCAATGCCAACTC; 
			TCTTCCCTATGCCCATATGC</td>
		</tr>
		<tr>
			<td>IL1&#946;</td>
			<td colspan="2">TCTATACCTGTCCTGTGTAATG; 
			GCTTGTGCTCTGCTTGTG</td>
		</tr>
		<tr>
			<td>IFIT3</td>
			<td colspan="2">TGGCCTACATAAAGCACCTAGATGG; 
			CGCAAACTTTTGGCAAACTTGTCT</td>
		</tr>
		<tr>
			<td>ISG15</td>
			<td colspan="2">GAGCTAGAGCCTGCAGCAAT; 
			TTCTGGGCAATCTGCTTCTT</td>
		</tr>
		<tr>
			<td>Mx1</td>
			<td colspan="2">TCTGAGGAGAGCCAGACGAT; 
			ACTCTGGTCCCCAATGACAG</td>
		</tr>
		<tr>
			<td>OASL2</td>
			<td colspan="2">GGATGCCTGGGAGAGAATCG; 
			TCGCCTGCTCTTCGAAACTG</td>
		</tr>
		<tr>
			<td>TNF&#945;</td>
			<td colspan="2">CCTCCCTCTCATCAGTTCTATGG; 
			GGCTACAGGCTTGTCACTCG</td>
		</tr>
	</tbody>
</table>
Table 1: RT-qPCR Primers.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Reagents</td>
			<td>Volume (10 &#956;l)</td>
		</tr>
		<tr>
			<td colspan="2">Universal SYBR Green supermix (2x)</td>
			<td>5 &#956;l</td>
		</tr>
		<tr>
			<td colspan="2">Forward and reverse primers (5 &#956;M)</td>
			<td>1 &#956;l</td>
		</tr>
		<tr>
			<td colspan="2">cDNA template</td>
			<td>0.4 &#956;l</td>
		</tr>
		<tr>
			<td colspan="2">DNase- and RNase-free H2O</td>
			<td>3.6 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 2: Master mix setup for RT-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>Step 1</td>
			<td>95 oC</td>
			<td>3 minutes</td>
		</tr>
		<tr>
			<td>Step 2</td>
			<td>95 oC</td>
			<td>10 seconds</td>
		</tr>
		<tr>
			<td>Step 3</td>
			<td>55 oC</td>
			<td>30 seconds</td>
		</tr>
		<tr>
			<td>Step 4</td>
			<td>Go to step 2, (Repeat 2-3 for 39 cycles)</td>
			<td></td>
		</tr>
		<tr>
			<td>Step 5 (Melt Curve)</td>
			<td>55 oC to 95 oC</td>
			<td>0.5 oC, increments (hold time is 5 seconds)</td>
		</tr>
	</tbody>
</table>
Table 3: Program for running the RT-qPCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>1. Create a plot composed of forward (FSC) and side scatter (SSC).</td>
		</tr>
		<tr>
			<td>2. Create a small plot for counting beads (FSC low, FITC high).</td>
		</tr>
		<tr>
			<td>3. Create a plot to only gate for live cells while excluding dead cells using BV510 dye.</td>
		</tr>
		<tr>
			<td>4. Live cells can then be separated into CD11c high and CD11c low populations.</td>
		</tr>
		<tr>
			<td>5. From CD11c high population gate for macrophages (SiglecF high MHCII low) and DCs (SiglecF low, MHCII high).</td>
		</tr>
		<tr>
			<td>6. From CD11c low gate for T cells (CD3/19 high, MHCII low), and B cells (CD3/19 high, MHCII high).</td>
		</tr>
		<tr>
			<td>7. From CD11c low CD3/19null cell population, gate for neutrophils (CD11b high, Ly-6G high) and Eosinophils (CD11b high, Ly-6G low, SiglecF high).</td>
		</tr>
		<tr>
			<td>8. For gating strategy of Eosinophils in the lung tissues, use these markers aftere excluding dead cells using BV510 dye (CD45, SiglecF, CD11C).</td>
		</tr>
	</tbody>
</table>
Table 4: FACS running
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>TBS:</td>
		</tr>
		<tr>
			<td>20 mm Tris-HCl</td>
		</tr>
		<tr>
			<td>150 mm NaCl</td>
		</tr>
		<tr>
			<td>pH 7.5</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>TBS-T:</td>
		</tr>
		<tr>
			<td>0.05% Tween-20 in TBS</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>Blocking Buffer</td>
		</tr>
		<tr>
			<td>5% non-fat milk diluted in TBS-T</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>Antibody dilution Buffer</td>
		</tr>
		<tr>
			<td>1% non-fat milk diluted in TBS-T</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>PBS+EDTA</td>
		</tr>
		<tr>
			<td>1x PBS + 0.1 mM EDTA</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>FACS buffer</td>
		</tr>
		<tr>
			<td>2% Fetal Calf Serum (FCS) in 1x PBS</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>Total cell medium</td>
		</tr>
		<tr>
			<td>RPMI 1640, 1X Glutamax, 10% FCS, 50 &#181;M 2-mercaptoethanol and Penicillin-Streptomycin.</td>
		</tr>
		<tr>
			<td></td>
		</tr>
		<tr>
			<td>Lung digestion solution</td>
		</tr>
		<tr>
			<td>Total cell medium plus Liberase (50 &#181;g/ml) and DNase I (1 &#181;g/ml)</td>
		</tr>
	</tbody>
</table>
Table 5: Recipes for buffers and solution

Watch this Scientific Journal Video about Identification and Characterization of Immunogenic RNA Species in HDM Allergens that Modulate Eosinophilic Lung Inflammation at JoVE.com

Identification and Characterization of Immunogenic RNA Species in HDM Allergens that Modulate Eosinophilic Lung Inflammation

Environmental allergens such as house dust mites (HDM) often contain microbial substances that activate innate immune responses to regulate allergic inflammation. The protocol presented here demonstrates the identification of dsRNA species in HDM allergens and characterization of their immunogenic activities in modulating eosinophilic lung inflammation.

Environmental allergens such as house dust mites (HDM) are often in complex forms containing both allergic proteins that drive aberrant type 2 responses ...

identification-characterization-immunogenic-rna-species-hdm-allergens

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

6.0K Views.  University of Texas Health San Antonio. Dit protocol is ontworpen om een zeer belangrijk en onopgelost probleem aan te pakken over hoe microbiële stoffen aanwezig en milieuallergenen de ontwikkeling van allergische ontstekingen kunnen reguleren. Specifiek, de methoden hier gepresenteerd kan helpen beantwoorden of dubbelstrengs RNA soorten in huis huis huis stofmijten zijn immunogene in vivo en in staat om eosinofiele longontsteking moduleren. De belangrijkste voordelen van deze technieken zijn dat ze eenvoudig, efficiënt, zeer re...

Video: Identification and Characterization of Immunogenic RNA Species in HDM Allergens that Modulate Eosinophilic Lung Inflammation

Murine Model of Allergen Induced Asthma

Asthma is a major cause of morbidity and mortality, affecting some 300 million people throughout the world.1 More than 8% of the US population has asthma, with the prevalence increasing.2 As with other diseases, animal models of allergic airway disease greatly facilitate understanding of the underlying pathophysiology, help identify potential therapeutic targets, and allow preclinical testing of possible new therapies. Models of allergic airway disease have been developed in several animal species, but murine models are particularly attractive due to the low cost, ready availability, and well-characterized immune systems of these animals.3 Availability of a variety of transgenic strains further increases the attractiveness of these models.4 Here we describe two murine models of allergic airway disease, both employing ovalbumin as the antigen. Following initial sensitization by intraperitoneal injection, one model delivers the antigen challenge by nebulization, the other by intratracheal delivery. These two models offer complementary advantages, with each mimicking the major features of human asthma.5
The major features of acute asthma include an exaggerated airway response to stimuli such as methacholine (airway hyperresponsiveness; AHR) and eosinophil-rich airway inflammation. These are also prominent effects of allergen challenge in our murine models,5,6 and we describe techniques for measuring them and thus evaluating the effects of experimental manipulation. Specifically, we describe both invasive7 and non-invasive8 techniques for measuring airway hyperresponsiveness as well as methods for assessing infiltration of inflammatory cells into the airways and the lung. Airway inflammatory cells are collected by bronchoalveolar lavage while lung histopathology is used to assess markers of inflammation throughout the organ. These techniques provide powerful tools for studying asthma in ways that would not be possible in humans.

Experimental mouse models of allergic asthma offer new possibilities for studying disease pathogenesis and developing new therapeutics. These models are well suited to measuring factors governing the allergic immune response, airway inflammation, and pulmonary pathophysiology.

Asthma is a major cause of morbidity and mortality, affecting some 300 million people throughout the world.1 More than 8% of the US population has asthma, ...

Analysis of Pulmonary Dendritic Cell Maturation and Migration during Allergic Airway Inflammation

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in peripheral tissues in steady state; however in response to antigen stimulation, DCs take up the antigen and rapidly migrate to the draining lymph nodes where they initiate T cell response against the antigen1,2. Additionally, DCs also play a key role in initiating autoimmune as well as allergic immune response3.
DCs play an essential role in both initiation of immune response and induction of tolerance in the setting of lung environment4. Lung environment is largely tolerogenic, owing to the exposure to vast array of environmental antigens5. However, in some individuals there is a break in tolerance, which leads to induction of allergy and asthma. In this study, we describe a strategy, which can be used to monitor airway DC maturation and migration in response to the antigen used for sensitization. The measurement of airway DC maturation and migration allows for assessment of the kinetics of immune response during airway allergic inflammation and also assists in understanding the magnitude of the subsequent immune response along with the underlying mechanisms.
Our strategy is based on the use of ovalbumin as a sensitizing agent. Ovalbumin-induced allergic asthma is a widely used model to reproduce the airway eosinophilia, pulmonary inflammation and elevated IgE levels found during asthma6,7. After sensitization, mice are challenged by intranasal delivery of FITC labeled ovalbumin, which allows for specific labeling of airway DCs which uptake ovalbumin. Next, using several DC specific markers, we can assess the maturation of these DCs and can also assess their migration to the draining lymph nodes by employing flow cytometry.

We describe a strategy to monitor maturation and migration of pulmonary dendritic cells in response to ovalbumin in the setting of ovalbumin induced allergic airway inflammation. This strategy can be modified to assess migration of pulmonary dendritic cells in settings of infection.

Dendritic cells (DCs) are the key players involved in initiation of adaptive immune response by activating antigen-specific T cells. DCs are present in ...

A Reversible, Non-invasive Method for Airway Resistance Measurements and Bronchoalveolar Lavage Fluid Sampling in Mice

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated procedures to obtain such measurements in the same animal are generally not feasible.  Here, we demonstrate protocols for obtaining from mice repeated measurements of AHR and bronchoalveolar lavage fluid samples.  Mice were challenged intranasally seven times over 14 days with a potent allergen or sham treated.  Prior to the initial challenge, and within 24 hours following each intranasal challenge, the same animals were anesthetized, orally intubated and mechanically ventilated.  AHR, assessed by comparing dose response curves of respiratory system resistance (RRS) induced by increasing intravenous doses of acetylcholine (Ach) chloride between sham and allergen-challenged animals, were determined.  Afterwards, and via the same intubation, the left lung was lavaged so that differential enumeration of airway cells could be performed.  These studies reveal that repeated measurements of AHR and BAL fluid collection are possible from the same animals and that maximal airway hyperresponsiveness and airway eosinophilia are achieved within 7-10 days of initiating allergen challenge.  This novel technique significantly reduces the number of mice required for longitudinal experimentation and is applicable to diverse rodent species, disease models and airway physiology instruments.  

Repeated measurements of rodent respiratory physiology and sampling of airway inflammatory cells are desirable, but generally not feasible. Here we describe a repeatable method for orally intubating mice that permits repeated measurements of airway hyperreactivity and sampling of airway inflammatory cells.

Airway hyperreactivity (AHR) measurements and bronchoalveolar lavage (BAL) fluid sampling are essential to experimental asthma models, but repeated ...

Biology

Genome-wide Analysis of HDAC Inhibitor-mediated Modulation of microRNAs and mRNAs in B Cells Induced to Undergo Class-switch DNA Recombination and Plasma Cell Differentiation

Antibody responses are accomplished through several critical B cell-intrinsic processes, including somatic hypermutation (SHM), class-switch DNA recombination (CSR), and plasma cell differentiation. In recent years, epigenetic modifications or factors, such as histone deacetylation and microRNAs (miRNAs), have been shown to interact with B-cell genetic programs to shape antibody responses, while the dysfunction of epigenetic factors has been found to lead to autoantibody responses. Analyzing genome-wide miRNA and mRNA expression in B cells in response to epigenetic modulators is important for understanding the epigenetic regulation of B-cell function and antibody response. Here, we demonstrate a protocol for inducing B cells to undergo CSR and plasma cell differentiation, treating these B cells with histone deacetylase (HDAC) inhibitors (HDIs), and analyzing mRNA and microRNA expression. In this protocol, we directly analyze complementary DNA (cDNA) sequences using next-generation mRNA sequencing (mRNA-seq) and miRNA-seq technologies, mapping of the sequencing reads to the genome, and quantitative reverse transcription (qRT)-PCR. With these approaches, we have defined that, in B cells induced to undergo CSR and plasma cell differentiation, HDI, an epigenetic regulator, selectively modulates miRNA and mRNA expression and alters CSR and plasma cell differentiation.

Epigenetic factors can interact with genetic programs to modulate gene expression and regulate B cell function. By combining in vitro B-cell stimulation, qRT-PCR, and high-throughput microRNA-sequence and mRNA-sequence approaches, we can analyze the epigenetic modulation of miRNA and gene expression in B cells.

Antibody responses are accomplished through several critical B cell-intrinsic processes, including somatic hypermutation (SHM), class-switch DNA ...

Absorption of Nasal and Bronchial Fluids: Precision Sampling of the Human Respiratory Mucosa and Laboratory Processing of Samples

The methods of nasal absorption (NA) and bronchial absorption (BA) use synthetic absorptive matrices (SAM) to absorb the mucosal lining fluid (MLF) of the human respiratory tract. NA is a non-invasive technique which absorbs fluid from the inferior turbinate, and causes minimal discomfort. NA has yielded reproducible results with the ability to frequently repeat sampling of the upper airway. 
By comparison, alternative methods of sampling the respiratory mucosa, such as nasopharyngeal aspiration (NPA) and conventional swabbing, are more invasive and may result in greater data variability. Other methods have limitations, for instance, biopsies and bronchial procedures are invasive, sputum contains many dead and dying cells and requires liquefaction, exhaled breath condensate (EBC) contains water and saliva, and lavage samples are dilute and variable.
BA can be performed through the working channel of a bronchoscope in clinic. Sampling is well tolerated and can be conducted at multiple sites in the airway. BA results in MLF samples being less dilute than bronchoalveolar lavage (BAL) samples.
This article demonstrates the techniques of NA and BA, as well as the laboratory processing of the resulting samples, which can be tailored to the desired downstream biomarker being measured. These absorption techniques are useful alternatives to the conventional sampling techniques used in clinical respiratory research.

This manuscript describes the use of nasal and bronchial absorption techniques, specifically using synthetic absorptive matrices (SAM) to sample the mucosal lining fluid (MLF) of the upper and lower airway. These methods provide better standardization and tolerability than existing respiratory sampling techniques.

The methods of nasal absorption (NA) and bronchial absorption (BA) use synthetic absorptive matrices (SAM) to absorb the mucosal lining fluid (MLF) of the ...

Medicine

Humanized Mediator Release Assay as a Read-Out for Allergen Potency

Mediator release assays analyze in vitro immunoglobulin E (IgE)-mediated degranulation and secretion of mediators by effector cells, such as mast cells and basophils, upon stimulation with serial dilutions of putative allergens. Therefore, these assays represent an essential tool that mimics the in vivo degranulation process, which occurs upon allergen exposure in sensitized patients or in skin prick tests. Additionally, these assays are usually employed to investigate the allergenic potential of proteins and the reactivity of patients' sera's reactivity. Herein, we describe a simple 2-day protocol using an immortalized rat basophil leukemia cell line transfected and humanized with the human high-affinity IgE plasma-membrane receptor (Fc&#949;RI). This variant of the mediator release assay is a robust, sensitive, and reproducible in vitro cell-based system without the need to immobilize the antigen to solid matrices. The protocol consists of the following steps: (1) complement inactivation of human sera, (2) harvesting, seeding, and passive sensitization of the cells, (3) stimulation with antigen to cause mediator release, and (4) measuring of &#946;-hexosaminidase activity as a surrogate for the released inflammatory mediators, such as histamine. The assay represents a useful tool to assess the capacity of the allergen-IgE cross-linking to trigger cell degranulation and can be implemented to standardize allergen extracts, to compare patients' reactivity to minor or major allergens and to allergenic extracts (pollen, cat dander, etc.), to investigate the potency of allergen homologs, isoforms, and fold-variants (e.g., hypoallergenicity), as well as the effects of ligands on the allergenic activity. A more recent application includes the use of the assay to monitor the treatment efficacy in the course of allergen immunotherapy.

Here we present the mediator release assay, using a rat basophilic leukemia cell line transfected with the human IgE receptor, to simulate the degranulation of effector cells typically observed in type 1 allergic reactions. This method investigates the biological activity of allergens in a highly sensitive, reproducible, and tailorable manner.

Mediator release assays analyze in vitro immunoglobulin E (IgE)-mediated degranulation and secretion of mediators by effector cells, such as mast cells ...

Advanced Imaging of Lung Homing Human Lymphocytes in an Experimental In Vivo Model of Allergic Inflammation Based on Light-sheet Microscopy

Overwhelming tissue accumulation of highly activated immune cells represents a hallmark of various chronic inflammatory diseases and emerged as an attractive therapeutic target in the clinical management of affected patients. In order to further optimize strategies aiming at therapeutic regulation of pathologically imbalanced tissue infiltration of pro-inflammatory immune cells, it will be of particular importance to achieve improved insights into disease- and organ-specific homing properties of peripheral lymphocytes. The here described experimental protocol allows to monitor lung accumulation of fluorescently labeled and adoptively transferred human lymphocytes in the context of papain-induced pulmonary inflammation. In contrast to standard in vitro assays frequently used for the analysis of immune cell migration and chemotaxis, the now introduced in vivo setting takes into account lung-specific aspects of tissue organization and the influence of the complex inflammatory scenario taking place in the living murine organism. Moreover, three-dimensional cross-sectional light-sheet fluorescence microscopic imaging does not only provide quantitative data on infiltrating immune cells, but also depicts the pattern of immune cell localization within the inflamed lung. Overall, we are able to introduce an innovative technique of high value for immunological research in the field of chronic inflammatory lung diseases, which can be easily applied by following the provided step-by-step protocol.

The here introduced protocol allows characterization of the lung homing capacity of primary human lymphocytes under in vivo inflammatory conditions. Pulmonary infiltration of adoptively transferred human immune cells in a mouse model of allergic inflammation can be imaged and quantified by light-sheet fluorescence microscopy of chemically cleared lung tissue.

Overwhelming tissue accumulation of highly activated immune cells represents a hallmark of various chronic inflammatory diseases and emerged as an ...

Flow Cytometric Analysis for Identification of the Innate and Adaptive Immune Cells of Murine Lung

The respiratory tract is in direct contact with the outside environment and requires a precisely regulated immune system to provide protection while suppressing unwanted reactions to environmental antigens. Lungs host several populations of innate and adaptive immune cells that provide immune surveillance but also mediate protective immune responses. These cells, which keep the healthy pulmonary immune system in balance, also participate in several pathological conditions such as asthma, infections, autoimmune diseases, and cancer. Selective expression of surface and intracellular proteins provides unique immunophenotypic properties to the immune cells of the lung. Consequently, flow cytometry has an instrumental role in the identification of such cell populations during steady-state and pathological conditions. This paper presents a protocol that describes a consistent and reproducible method to identify the immune cells that reside in the lungs of healthy mice under steady-state conditions. However, this protocol can also be used to identify changes in these cell populations in various disease models to help identify disease-specific changes in the lung immune landscape.

In this study, we present an effective and reproducible protocol to isolate the immune populations of the murine respiratory system. We also provide a method for the identification of all innate and adaptive immune cells that reside in the lungs of healthy mice, using a 9-color-based flow cytometry panel.

The respiratory tract is in direct contact with the outside environment and requires a precisely regulated immune system to provide protection while ...

Symptom Assessment of Patients with Allergic Rhinitis Using an Allergen Exposure Chamber

Allergen exposure chambers (AECs) are clinical facilities that allow the exposure of participants to allergenic and non-allergenic airborne particles. They provide stable particle concentrations under controlled environmental conditions. This is of great importance both for diagnostic purposes and for the monitoring of treatment effects. 
Here, a protocol and the technical prerequisites for performing a safe and effective allergen challenge in subjects sensitized to airborne allergens (i.e., house dust mite [HDM]) in the ALL-MED AEC are presented. With this method, triggering allergic symptoms corresponds to natural exposure. This can be used for an allergy diagnosis or as a plausible endpoint in clinical trials, particularly for allergen immunotherapy (AIT). A controlled environment (temperature, humidity, and carbon dioxide [CO2]) in the chamber must be maintained. Allergen particles must be dispersed evenly within the AEC at stable levels throughout the challenge. For this presentation, allergic rhinitis (AR) patients sensitive to HDM allergens were enrolled. AR symptoms were assessed by the following parameters: total nasal symptom score (TNSS), acoustic rhinometry (ARM), peak nasal inspiratory flow (PNIF), and nasal secretion weight. The safety of the procedure was assessed by the peak expiratory flow rate (PEFR) and the forced expiratory volume in the first second (FEV1). The allergic subjects developed symptoms within 120 min of the trial. On average, the most intense symptoms appeared after 60-90 min and, after reaching a plateau, remained stable until the end of the trial.

A protocol for conducting a challenge in an allergen exposure chamber (AEC) facility is presented. AECs have proven to be safe and effective tools for the induction of allergic symptoms or as an endpoint in the efficacy testing of allergen immunotherapy due to their ability to maintain stable particle concentrations and environmental conditions.

Allergen exposure chambers (AECs) are clinical facilities that allow the exposure of participants to allergenic and non-allergenic airborne particles. ...

Multicolor Immunofluorescence of the Nasal Tissue in an Allergic Rhinitis Rat Model

Immunofluorescent Labeling in Nasal Mucosa Tissue Sections of Allergic Rhinitis Rats via Multicolor Immunoassay

Allergic rhinitis (AR) is a chronic, non-infectious inflammatory disease of the nasal mucosa, primarily mediated by specific immunoglobulin E (IgE), affecting approximately 10%-20% of the world's population. While immunofluorescence (IF) staining has long been a standard technique for detecting disease-specific protein expression, conventional IF techniques are limited in their ability to detect the expression levels of three or more proteins in the same sample. Consequently, multicolor IF techniques have been developed in recent years, which allow the simultaneous labeling of multiple targets in cells or tissues.
This protocol provides a comprehensive overview of the process for establishing a rat model of AR, obtaining nasal mucosal samples, and the technical procedures for multicolor immunofluorescence. All rats in the AR group exhibited typical symptoms such as sneezing, a runny nose, and an itchy nose, with behavioral observations scoring &#8805;5 points. Hematoxylin and eosin (H&amp;E) staining revealed increased inflammatory cell counts and disrupted nasal mucosal integrity in the AR group. Multicolor immunofluorescence (mIF) demonstrated increased expression of ROR&#947;t and TICAM-1, while Foxp3 expression decreased in the nasal mucosa tissue of AR rats.

Author Spotlight: Advancing Allergic Rhinitis Research with Multicolor Immunofluorescence

This protocol describes a multicolor immunofluorescence technique for evaluating the rat model of allergic rhinitis.

Allergic rhinitis (AR) is a chronic, non-infectious inflammatory disease of the nasal mucosa, primarily mediated by specific immunoglobulin E (IgE), ...

Identification and Characterization of Immunogenic RNA Species in HDM Allergens that Modulate Eosinophilic Lung Inflammation

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video