Name: humanized nog mice for intravaginal hiv exposure and treatment of hiv infection
Uploaded: 2020-01-31T15:00:00.000+00:00
Duration: 8 min 15 s
Description: Watch this Scientific Journal Video about Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection at JoVE.com

The authors would like to thank the Biomedicine Animal Facility staff at Aarhus University, particularly Ms. Jani K&#230;r for colony maintenance efforts and for tracking mouse weights. The authors would like to thank Professor Florian Klein for developing standard-of-care cART and for guidance. The following reagent was obtained through the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: pRHPA.c/2635 (cat# 11744) from Dr. John Kappes and Dr. Christina Ochsenbauer.

<ol>
	<li>Skelton, J. K., Ortega-Prieto, A. M., Dorner, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Hitchhiker's+guide+to+humanized+mice:+new+pathways+to+studying+viral+infections.">A Hitchhiker's guide to humanized mice: new pathways to studying viral infections.</a> Immunology. 154 (1), 50-61 (2018).</li><li>Denton, P. W., Krisko, J. F., Powell, D. A., Mathias, M., Kwak, Y. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+Administration+of+Antiretrovirals+Prior+to+Exposure+Prevents+Rectal+and+Intravenous+HIV-1+Transmission+in+Humanized+BLT+Mice.">Systemic Administration of Antiretrovirals Prior to Exposure Prevents Rectal and Intravenous HIV-1 Transmission in Humanized BLT Mice.</a> PLoS ONE. 5 (1), 8829 (2010).</li><li>Zou, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nef+functions+in+BLT+mice+to+enhance+HIV-1+replication+and+deplete+CD4+++CD8+++thymocytes.">Nef functions in BLT mice to enhance HIV-1 replication and deplete CD4 + CD8 + thymocytes.</a> Retrovirology. 9 (1), 44 (2012).</li><li>Berges, B. K., Akkina, S. R., Folkvord, J. M., Connick, E., Akkina, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mucosal+transmission+of+R5+and+X4+tropic+HIV-1+via+vaginal+and+rectal+routes+in+humanized+Rag2+-/-+&#947;c+-/-+(RAG-hu)+mice.">Mucosal transmission of R5 and X4 tropic HIV-1 via vaginal and rectal routes in humanized Rag2 -/- &#947;c -/- (RAG-hu) mice.</a> Virology. 373 (2), 342-351 (2008).</li><li>Veselinovic, M., Charlins, P., Akkina, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+HIV-1+Mucosal+Transmission+and+Prevention+in+Humanized+Mice.">Modeling HIV-1 Mucosal Transmission and Prevention in Humanized Mice.</a> Methods Mol Biol. , 203-220 (2016).</li><li>Neff, C. P., Kurisu, T., Ndolo, T., Fox, K., Akkina, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+topical+microbicide+gel+formulation+of+CCR5+antagonist+maraviroc+prevents+HIV-1+vaginal+transmission+in+humanized+RAG-hu+mice.">A topical microbicide gel formulation of CCR5 antagonist maraviroc prevents HIV-1 vaginal transmission in humanized RAG-hu mice.</a> PLoS ONE. 6 (6), 20209 (2011).</li><li>Neff, P. C., Ndolo, T., Tandon, A., Habu, Y., Akkina, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+pre-exposure+prophylaxis+by+anti-retrovirals+raltegravir+and+maraviroc+protects+against+HIV-1+vaginal+transmission+in+a+humanized+mouse+model.">Oral pre-exposure prophylaxis by anti-retrovirals raltegravir and maraviroc protects against HIV-1 vaginal transmission in a humanized mouse model.</a> PLoS ONE. 5 (12), 15257 (2010).</li><li>Veselinovic, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+pre-exposure+prophylaxis:+Mucosal+tissue+drug+distribution+of+RT+inhibitor+Tenofovir+and+entry+inhibitor+Maraviroc+in+a+humanized+mouse+model.">HIV pre-exposure prophylaxis: Mucosal tissue drug distribution of RT inhibitor Tenofovir and entry inhibitor Maraviroc in a humanized mouse model.</a> Virology. 464-465, 253-263 (2014).</li><li>Akkina, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humanized+Rag1-/-&#947;c-/-+mice+support+multilineage+hematopoiesis+and+are+susceptible+to+HIV-1+infection+via+systemic+and+vaginal+routes.">Humanized Rag1-/-&#947;c-/- mice support multilineage hematopoiesis and are susceptible to HIV-1 infection via systemic and vaginal routes.</a> PLoS ONE. 6 (6), 20169 (2011).</li><li>Zhou, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+administration+of+combinatorial+dsiRNAs+via+nanoparticles+efficiently+suppresses+HIV-1+infection+in+humanized+mice.">Systemic administration of combinatorial dsiRNAs via nanoparticles efficiently suppresses HIV-1 infection in humanized mice.</a> Molecular Therapy. 19 (12), 2228-2238 (2011).</li><li>Balcombe, J. P., Barnard, N. D., Sandusky, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laboratory+routines+cause+animal+stress.">Laboratory routines cause animal stress.</a> Contemporary Topics in Laboratory Animal Science. 43 (6), 42-51 (2004).</li><li>Trecarichi, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Partial+protective+effect+of+CCR5-Delta+32+heterozygosity+in+a+cohort+of+heterosexual+Italian+HIV-1+exposed+uninfected+individuals.">Partial protective effect of CCR5-Delta 32 heterozygosity in a cohort of heterosexual Italian HIV-1 exposed uninfected individuals.</a> AIDS Research and Therapy. 3 (1), (2006).</li><li>Novembre, J., Galvani, A. P., Slatkin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+geographic+spread+of+the+CCR5+&#916;32+HIV-resistance+allele.">The geographic spread of the CCR5 &#916;32 HIV-resistance allele.</a> PLoS Biology. 3 (11), 1954-1962 (2005).</li><li>Solloch, U. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Frequencies+of+gene+variant+CCR5-&#916;32+in+87+countries+based+on+next-generation+sequencing+of+1.3+million+individuals+sampled+from+3+national+DKMS+donor+centers.">Frequencies of gene variant CCR5-&#916;32 in 87 countries based on next-generation sequencing of 1.3 million individuals sampled from 3 national DKMS donor centers.</a> Human Immunology. 78 (11-12), 710-717 (2017).</li><li>Ochsenbauer, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+Transmitted/Founder+HIV-1+Infectious+Molecular+Clones+and+Characterization+of+Their+Replication+Capacity+in+CD4+T+Lymphocytes+and+Monocyte-Derived+Macrophages.">Generation of Transmitted/Founder HIV-1 Infectious Molecular Clones and Characterization of Their Replication Capacity in CD4 T Lymphocytes and Monocyte-Derived Macrophages.</a> Journal of Virology. 86 (5), 2715-2728 (2012).</li><li>Andersen, A. H. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-Acting,+Potent+Delivery+of+Combination+Antiretroviral+Therapy.">Long-Acting, Potent Delivery of Combination Antiretroviral Therapy.</a> ACS Macro Letters. 7 (5), 587-591 (2018).</li><li>Caro, A. C., Hankenson, F. C., Marx, J. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+thermoregulatory+devices+used+during+anesthesia+of+C57BL/6+mice+and+correlations+between+body+temperature+and+physiologic+parameters.">Comparison of thermoregulatory devices used during anesthesia of C57BL/6 mice and correlations between body temperature and physiologic parameters.</a> Journal of the American Association for Laboratory Animal Science JAALAS. 52 (5), 577-583 (2013).</li><li>Gatlin, J., Padgett, A., Melkus, M. W., Kelly, P. F., Garcia, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+engraftment+of+nonobese+diabetic/severe+combined+immunodeficient+mice+with+human+CD34++cells+transduced+by+a+self-inactivating+human+immunodeficiency+virus+type+1+vector.">Long-term engraftment of nonobese diabetic/severe combined immunodeficient mice with human CD34+ cells transduced by a self-inactivating human immunodeficiency virus type 1 vector.</a> Human Gene Therapy. 12 (9), 1079-1089 (2001).</li><li>Leth, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV-1+transcriptional+activity+during+frequent+longitudinal+sampling+in+aviremic+patients+on+antiretroviral+therapy.">HIV-1 transcriptional activity during frequent longitudinal sampling in aviremic patients on antiretroviral therapy.</a> AIDS. 30 (5), 713-721 (2016).</li><li>Halper-Stromberg, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Broadly+neutralizing+antibodies+and+viral+inducers+decrease+rebound+from+HIV-1+latent+reservoirs+in+humanized+mice.">Broadly neutralizing antibodies and viral inducers decrease rebound from HIV-1 latent reservoirs in humanized mice.</a> Cell. 158 (5), 989-999 (2014).</li><li>Rothenberger, M. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large+number+of+rebounding/founder+HIV+variants+emerge+from+multifocal+infection+in+lymphatic+tissues+after+treatment+interruption.">Large number of rebounding/founder HIV variants emerge from multifocal infection in lymphatic tissues after treatment interruption.</a> Proceedings of the National Academy of Sciences. 112 (10), 1126-1134 (2015).</li><li>Rongvaux, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+Hemato-Lymphoid+System+Mice:+Current+Use+and+Future+Potential+for+Medicine.">Human Hemato-Lymphoid System Mice: Current Use and Future Potential for Medicine.</a> Annual Review of Immunology. 31 (1), 635-674 (2013).</li><li>Walsh, N. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humanized+Mouse+Models+of+Clinical+Disease.">Humanized Mouse Models of Clinical Disease.</a> Annual Review of Pathology: Mechanisms of Disease. 12 (1), 187-215 (2017).</li><li>Denton, P. W., Garc&#237;a, J. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humanized+mouse+models+of+HIV+infection.">Humanized mouse models of HIV infection.</a> AIDS Reviews. 13 (3), 135-148 (2011).</li><li>Denton, P. W., S&#248;gaard, O. S., Tolstrup, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+animal+models+to+overcome+temporal,+spatial+and+combinatorial+challenges+in+HIV+persistence+research.">Using animal models to overcome temporal, spatial and combinatorial challenges in HIV persistence research.</a> Journal of Translational Medicine. 14 (1), (2016).</li><li>Andersen, A. H. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=cAIMP+administration+in+humanized+mice+induces+a+chimerization-level-dependent+STING+response.">cAIMP administration in humanized mice induces a chimerization-level-dependent STING response.</a> Immunology. 157 (2), 163-172 (2019).</li><li>Tanaka, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+Mature+and+Functional+Human+Myeloid+Subsets+in+Hematopoietic+Stem+Cell-Engrafted+NOD/SCID/IL2r+KO+Mice.">Development of Mature and Functional Human Myeloid Subsets in Hematopoietic Stem Cell-Engrafted NOD/SCID/IL2r KO Mice.</a> The Journal of Immunology. 188 (12), 6145-6155 (2012).</li><li>Quan, P. L., Sauzade, M., Brouzes, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DPCR:+A+technology+review.">DPCR: A technology review.</a> Sensors (Switzerland). 18 (4), (2018).</li><li>Denton, P. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+HIV+Latency+in+Humanized+BLT+Mice.">Generation of HIV Latency in Humanized BLT Mice.</a> Journal of Virology. 86 (1), 630-634 (2012).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+immune+system+mouse+model+with+robust+lymph+node+development.">A human immune system mouse model with robust lymph node development.</a> Nature Methods. 15 (8), 623-630 (2018).</li><li>Satheesan, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+Replication+and+Latency+in+a+Humanized+NSG+Mouse+Model+during+Suppressive+Oral+Combinational+Antiretroviral+Therapy.">HIV Replication and Latency in a Humanized NSG Mouse Model during Suppressive Oral Combinational Antiretroviral Therapy.</a> Journal of Virology. 92 (7), 02118 (2018).</li><li>Bachmanov, A. A., Reed, D. R., Beauchamp, G. K., Tordoff, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Food+intake,+water+intake,+and+drinking+spout+side+preference+of+28+mouse+strains.">Food intake, water intake, and drinking spout side preference of 28 mouse strains.</a> Behavior Genetics. 32 (6), 435-443 (2002).</li><li>Shultz, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+functional+human+T-cell+subsets+with+HLA-restricted+immune+responses+in+HLA+class+I+expressing+NOD/SCID/IL2r+null+humanized+mice.">Generation of functional human T-cell subsets with HLA-restricted immune responses in HLA class I expressing NOD/SCID/IL2r null humanized mice.</a> Proceedings of the National Academy of Sciences. 107 (29), 13022-13027 (2010).</li><li>Willinger, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+IL-3/GM-CSF+knock-in+mice+support+human+alveolar+macrophage+development+and+human+immune+responses+in+the+lung.">Human IL-3/GM-CSF knock-in mice support human alveolar macrophage development and human immune responses in the lung.</a> Proceedings of the National Academy of Sciences. 108 (6), 2390-2395 (2011).</li><li>Hanazawa, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+human+immunosuppressive+myeloid+cell+populations+in+human+interleukin-6+transgenic+NOG+mice.">Generation of human immunosuppressive myeloid cell populations in human interleukin-6 transgenic NOG mice.</a> Frontiers in Immunology. 9, (2018).</li><li>Huntington, N. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-15+trans-presentation+promotes+human+NK+cell+development+and+differentiation+in+vivo.">IL-15 trans-presentation promotes human NK cell development and differentiation in vivo.</a> The Journal of Experimental Medicine. 206 (1), 25-34 (2009).</li><li>Rongvaux, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+function+of+human+innate+immune+cells+in+a+humanized+mouse+model.">Development and function of human innate immune cells in a humanized mouse model.</a> Nature Biotechnology. 32 (4), 364-372 (2014).</li></ol>

The authors declare no conflicts of interests.

The severely immunocompromised mouse strain NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG) is extremely well suited for transplantation of human cells and tissues. Both innate and adaptive immune pathways in these mice are compromised. NOG and NSG mice harbor a Prkdcscid mutation that results in defective T and B cell function. Furthermore, these mice lack a functional interleukin-2 receptor &#947;-chain (common gamma chain, IL2rg) which is indispensable in the binding complexes of many key cytokines such as IL-2, IL-4, IL-7, IL-9, IL-15, and IL-21. Immunodeficient mice, such as the NOG, transplanted with a human immune system are a powerful tool for the study of HIV transmission and immunology. Contributions in these fields made using humanized mice have been extensively reviewed2,23,24,25,26. The use of these mice to study human innate immune responses are also gaining increased attention27,28.
The aim of this manuscript is to supply a comprehensive protocol of mouse and ddPCR procedures to go from a naive mouse to HIV transmission and treatment data. Our system utilized ddPCR for quantification of viral RNA and DNA. In a ddPCR reaction, the reactants are partitioned into up to 20,000 droplets, each containing a single, separate micro PCR reaction. The amplification of a target inside a droplet leads to a positive fluorescent signal for that droplet. Thus, the readout is binary and by applying Poisson statistical analyses, the number of positive reactions can be directly translated to a number of template copies in the original sample. The benefit of ddPCR lies in its ability to directly quantify a target independent of a standard curve. This is particularly attractive when analyzing RNA samples that are challenging to utilize as PCR standard curves due to their labile nature29. Moreover, by analyzing multiple replicas of the same sample and merging the individual data points for the final sample quantification, the binary nature of ddPCR makes it possible to lower the detection limit of template copies per mL of sample29. This is especially important in a humanized mouse setting, where only limited sample material is available and high sensitivity is required.
Administration of cART to humanized mice can be done either by oral gavage or intraperitoneal injections with solutions of cART30,31,32, and as shown recently, by formulation into the diet21. One of our major aims was the implementation of a cART regimen in the mouse diet to reduce potential stress on the animals due to the extra handling steps inherent in other drug delivery methods. The dose of medicine that a mouse will eat can be accurately estimated based on the average daily food intake of the mice33. Oral delivery through the diet serves as the easiest delivery route with both minimal stress for the animal and minimal workload for the handler. We based our combination of antiviral drugs on previous published studies in humanized mice21,30. Furthermore, our cART strategy is clinically relevant given that the drug combination utilized clinically is orally administered by patients around the globe.
Certain limitations are noted regarding the use of NOG mice. Importantly, human T cells in these mice are cultivated in a mouse thymic environment, as opposed to a human environment. The recent focus is on generating xenorecipient strains that have a favorable environment for the development of robust human immune responses. These new strains include immunodeficient mice that are transgenic for human MHC molecules, such as A2. These models enable HLA-restricted antigen T-cell responses that result in better maturation and effector functions of the adaptive immune system34. Another approach is to replace mouse genes with key human cytokines for IL-3/GM-CSF35, IL-636, IL-1537, TPO, M-CSF38, and IL-7/TSLP31. Such models have gained increased attention for their ability to generate better differentiation of innate cell types. Our protocol is easily adaptable for the humanization and HIV infection of mice using any such enhanced genetic background immunodeficient strain.
In summary, the ease and utility of the described approach facilitates research in HIV-related fields in vivo. Humanized mice can be a very powerful tool in guiding research towards generating better research hypotheses. Along with the generation of more &#34;human&#34; humanized mice with human transgenes, we believe our standardized protocol will contribute to the streamlining of experimental procedures across different research environments.

Human immunodeficiency virus (HIV) is a chronic infection with more than 37 million infected individuals worldwide1. Combination antiviral therapy (cART) is a life-saving therapy, but a cure is still warranted. Thus, there is a need for animal models that mirror the human immune system and its responses in order to facilitate continued research in HIV. Multiple types of humanized mice that are capable of supporting cell and tissue engraftment have been developed by transplanting human cells into severely immunodeficient mice2. Such humanized mice are susceptible to HIV infection and provide an important alternative to nonhuman primate simian immunodeficiency virus models, as they are cheaper and simpler to use than nonhuman primates. Humanized mice have facilitated research in HIV viral transmission, pathogenesis, prevention, and treatment3,4,5,6,7,8,9,10,11.
We present a flexible humanized model system for HIV research developed by transplanting cord blood derived human stem cells into mice of the NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac (NOG) background. Besides being of non-fetal origin, the practical bioengineering of these mice is less technically demanding compared to the microsurgical procedures involved in the transplant of the blood-liver-thymus (BLT) construct.
We show how to establish HIV infection through intravaginal transmission and how to monitor the plasma viral load with a sensitive droplet digital PCR (ddPCR)-based setup. Subsequently, we describe the establishment of standard cART given as part of the daily mouse diet. The aim of these combined methods is to reduce stress to the animals and facilitate large-scale experiments where time spent handling each animal is limited12.
In humans, a CCR5&#916;32/wt or CCR5&#916;32/ &#916;32 genotype causes reduced susceptibility to HIV infection with transmitter/founder viruses13, and some precautions must be taken when bioengineering humanized mice with stem cells for the purpose of HIV studies. This is especially true in our region because naturally occurring variants in the CCR5 gene, particularly &#916;32 deletions, are more prevalent in Scandinavian and Baltic native populations compared to rest of the world14,15. Thus, our protocol includes an easy, high-throughput assay for screening donor hematopoietic stem cells for CCR5 variants prior to transplantation.
For the intravaginal exposure we chose the transmitter/founder R5 virus RHPA4259, isolated from a woman in an early stage of infection who was infected intravaginally16. We exposed the mice to a viral dose that was sufficient to yield successful transmission in the majority of mice, but below a 100% transmission rate. Choosing such a dose enables a sufficient dynamic range in transmission rate such that antiviral effects of a drug candidate can result in protected animals in HIV prevention experiments and decreased viral load for treatment studies.

<table><tbody><tr><td>Blue pad</td><td>VWR</td><td>56616-031</td><td>Should be sterilized prior to use</td></tr><tr><td>Bovine serum albumin (BSA)</td><td>Sigma</td><td>A8022</td><td></td></tr><tr><td>CD19 (clone sj25c1) PE-Cy7</td><td>BD Bioscience</td><td>557835</td><td></td></tr><tr><td>CD3 (clone OKT3) FITC</td><td>Biolegend</td><td>317306</td><td></td></tr><tr><td>CD3 (clone SK7) BUV395</td><td>BD Bioscience</td><td>564001</td><td></td></tr><tr><td>CD34 (clone AC136) FITC</td><td>Miltenyi</td><td>130-113-740</td><td></td></tr><tr><td>CD4 (clone SK3) BUV 496</td><td>BD Bioscience</td><td>564652/51</td><td></td></tr><tr><td>CD45 (clone 2D1) APC</td><td>Biolegend</td><td>368511/12</td><td></td></tr><tr><td>CD8 (clone RPA-T8) BV421</td><td>BD Bioscience</td><td>562428</td><td></td></tr><tr><td>ddPCR Supermix for probes (no dUTP)</td><td>Bio-Rad</td><td>1863025</td><td></td></tr><tr><td>DMSO</td><td>Merck</td><td>10,02,95,21,000</td><td></td></tr><tr><td>DNAse</td><td>Sigma</td><td>D4263</td><td>For suspension buffer</td></tr><tr><td>dNTP mix</td><td>Life Technologies</td><td>R0192</td><td></td></tr><tr><td>Dulbeccos phosphate-buffered saline (PBS)</td><td>Biowest</td><td>L0615-500</td><td></td></tr><tr><td>EasySep Human Cord Blood CD34 Positive Selection Kit II</td><td>Stemcell</td><td>17896</td><td></td></tr><tr><td>EDTA</td><td>Invitrogen</td><td>15575-038</td><td></td></tr><tr><td>FACS Lysing solution 10X</td><td>BD</td><td>349202</td><td>Dilute 1:10 in dH20 immediately before use</td></tr><tr><td>FACS tubes (Falcon 5 mL round-botton)</td><td>Falcon</td><td>352052</td><td></td></tr><tr><td>Fc Receptor blocking solution (Human Trustain FcX)</td><td>Biolegend</td><td>422302</td><td></td></tr><tr><td>Fetal bovine serum</td><td>Sigma</td><td>F8192-500</td><td></td></tr><tr><td>Ficoll-Paque PLUS</td><td>GE Healthcare</td><td>17144002</td><td></td></tr><tr><td>Flowjo v.10</td><td></td><td></td><td></td></tr><tr><td>Gauze</td><td>Mesoft</td><td>157300</td><td>Should be sterilized prior to use</td></tr><tr><td>Heating lamp</td><td></td><td></td><td>Custom made</td></tr><tr><td>Hemacytometer (B&amp;uuml;rker-T&amp;uuml;rk)</td><td>VWR</td><td>DOWC1597418</td><td></td></tr><tr><td>Isoflurane gas</td><td>Orion Pharma</td><td>9658</td><td></td></tr><tr><td>LSR Fortessa X20 flow cytometer</td><td>BD</td><td></td><td></td></tr><tr><td>Microcentrifuge tubes, PCR-PT approved</td><td>Sarstedt</td><td>72692405</td><td></td></tr><tr><td>Mouse cART food</td><td>ssniff Spezialdi&amp;auml;ten GmbH</td><td>Custom made product</td><td></td></tr><tr><td>Mouse restrainer</td><td></td><td>Custom made product</td><td></td></tr><tr><td>Needle, Microlance 3, 30G &amp;frac12;&quot;</td><td>BD</td><td>304000</td><td></td></tr><tr><td>NOG mice NOD.Cg-Prkdcscid Il2rgtm1Sug/JicTac</td><td>Taconic</td><td>NOG-F</td><td></td></tr><tr><td>Nuclease-free water</td><td>VWR chemicals</td><td>436912C</td><td></td></tr><tr><td>Nucleospin 96 Virus DNA and RNA isolation kit</td><td>Macherey-Nagel</td><td>740691</td><td></td></tr><tr><td>PCR-approved microcentrifuge tubes</td><td>Sarstedt</td><td>72.692.405</td><td></td></tr><tr><td>Penicillin-Streptomycin solution 100X</td><td>Biowest</td><td>L0022-100</td><td></td></tr><tr><td>Phusion Hot Start II DNA polymerase</td><td>Life Technologies</td><td>F549S</td><td></td></tr><tr><td>Pipette tips, sterile, ART 20P Barrier</td><td>ThermoScientific</td><td>2149P</td><td></td></tr><tr><td>Proteinase K</td><td>NEB</td><td>100005398</td><td></td></tr><tr><td>QuantaSoft software</td><td>Bio-Rad</td><td></td><td></td></tr><tr><td>QX100 Droplet Generator</td><td>Bio-Rad</td><td>1886-3008</td><td></td></tr><tr><td>QX100 Droplet Reader</td><td>Bio-Rad</td><td>186-3003</td><td></td></tr><tr><td>RBC lysis solution</td><td>Biolegend</td><td>420301</td><td></td></tr><tr><td>RNase-free DNAse size F + reaction buffer</td><td>Macherey-Nagel</td><td>740963</td><td></td></tr><tr><td>RNAseOUT Recombinant Ribonuclease inhibitor</td><td>ThermoScientific</td><td>10777-019</td><td></td></tr><tr><td>RPMI</td><td>Biowest</td><td>L0501-500</td><td>Dissolve in H20</td></tr><tr><td>Softject 1 mL syringe</td><td>Henke Sass Wolf</td><td>5010-200V0</td><td></td></tr><tr><td>Superscript III Reverse Transcriptase</td><td>ThermoFisher Scientific</td><td>18080044</td><td></td></tr><tr><td>Thermoshaker</td><td>VWR</td><td>89370-910</td><td></td></tr><tr><td>Trypane blue</td><td>Sigma</td><td>T8154</td><td></td></tr><tr><td>Ultrapure 0.5 EDTA, pH 8.0</td><td>ThermoFisher Scientific</td><td>15575-020</td><td></td></tr><tr><td>Virkon S (virus disinfectant)</td><td>Dupont</td><td>7511</td><td></td></tr></tbody></table>

humanized nog mice for intravaginal hiv exposure and treatment of hiv infection

Humanized mice provide a sophisticated platform to study human immunodeficiency virus (HIV) virology and to test antiviral drugs. This protocol describes the establishment of a human immune system in adult NOG mice. Here, we explain all the practical steps from isolation of umbilical cord blood derived human CD34+ cells and their subsequent intravenous transplantation into the mice, to the manipulation of the model through HIV infection, combination antiretroviral therapy (cART), and blood sampling. Approximately 75,000 hCD34+ cells are injected intravenously into the mice and the level of human chimerism, also known as humanization, in the peripheral blood is estimated longitudinally for months by flow cytometry. A total of 75,000 hCD34+ cells yields 20%&#8211;50% human CD45+ cells in the peripheral blood. The mice are susceptible to intravaginal infection with HIV and blood can be sampled once weekly for analysis, and twice monthly for extended periods. This protocol describes an assay for quantification of plasma viral load using droplet digital PCR (ddPCR). We show how the mice can be effectively treated with a standard-of-care cART regimen in the diet. The delivery of cART in the form of regular mouse chow is a significant refinement of the experimental model. This model can be used for preclinical analysis of both systemic and topical pre-exposure prophylaxis compounds as well as for testing of novel treatments and HIV cure strategies.

The gating strategy for the analysis of stem cell purity is depicted in Figure 1. Figure 1A&#8211;C shows the purified CD34+ population and Figure 1D&#8211;F the CD34- flow-through used to illustrate that the minimal amount of the CD34+ population is lost in the isolation process. The purity of isolated CD34+ stem cells was between 85%&#8211;95% with less than 1% T-cell contamination. Figure 1G depicts CCR5 bands from one adult human control donor with the CCR5&#916;32/wt genotype, followed by bands from two CCR5wt/wt and one CCR5&#916;32/wt stem cell donors. The frequency of the genotype CCR5&#916;32/wt in a group of 19 donors was 15.8% (Figure 1H). This is in agreement with larger epidemiological studies14,15 reporting the genotype in up to 23.6% of investigated persons in Denmark.
Human CD45+ levels in mice peripheral blood was assessed via flow cytometry 3&#8211;5 months after transplantation of human CD34+ stem cells. The gating strategy is presented in Figure 2A&#8211;E. Figure 3A and Figure 3B illustrate the variability between 10 and 16 individual mice receiving stem cells from two different donors. Transplantation of 75,000 hCD34+ cells yielded 20%&#8211;50% human CD45+ in the peripheral blood. All mice developed human B and T cells, including both CD4- and CD8+ T cells.
For atraumatic intravaginal exposures, the setup depicted in Figure 4 was used. Mice were anaesthetized in a closed chamber and kept under anesthesia during the exposure. Mice were held with the vagina facing up for 5 min after exposure to ensure virus solution engagement with mucosal surfaces.
Figure 5A shows the 64% HIV transmission success rate observed using this model. Mice were challenged with 21,400 infectious units (IU) of RHPA4259 intravaginally. This dose resulted in 64% of mice becoming HIV infected following vaginal exposure. For comparison, data from two different cohorts of mice exposed through an intravenous route are included. As expected, 100% of the mice became HIV+ with similar doses of RHPA and an additional strain (YU2) using this route.
Figure 5B depicts representative results from three mice that were infected with HIV and switched to a diet containing standard cART. Mice were switched back to regular mouse chow after 40 days of cART. In this assay setup, the limit for viral load detection was 725 copies/mL. Viral loads were all below the detection limit after 4 weeks of cART. After cessation of cART, the virus rebounded, mirroring clinical data22. Mice on cART tolerated the change in diet well as indicated in Figure 5C.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60723/60723fig01.jpg" /> 
Figure 1: Representative flow cytometry gating strategy for validation of stem cell purity and CCR5 donor variant status. (A&#8211;C) The gating strategy used for the isolated CD34+ cell population. Doublets and debris are excluded in panel A and B respectively (FSC-A vs. FSC-H and FSC-A vs. SSC-A). (C) The frequency of CD34+ stem cells and CD3+ T cell contamination. (D&#8211;F) The CD34- flow-through gating strategy. Percentages in gates are calculated as a fraction of the parent population. (G) The results of a CCR5&#916;32/wt PCR analysis. Lane 1: DNA from a human CCR5&#916;32/wt donor, lanes 2 and 3: two CCR5wt/wt human stem cell donors, lane 4: A CCR5&#916;32/wt human stem cell donor. (H) Frequency of the genotype CCR5&#916;32/wt in our group of 19 stem cell samples is 15.8%. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60723/60723fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60723/60723fig02.jpg" /> 
Figure 2: Flow cytometry gating strategy for validation of human cell engraftment and differentiation. The total mononuclear cell population from humanized mice was analyzed via flow cytometry. (A) The percentage of human CD45+ cells was determined as a fraction of the total recorded events. (B) Doublets were subsequently excluded based on FSC-A/FSC-H gating. (C) The true lymphocyte population was defined based on size and granularity. (D) Lymphocytes were then characterized as either CD3+ (T cells) or CD19+ (B cells). (E) CD3+ T cells were either CD4+ T cells or CD8+ T cells. Percentages in gates were calculated as a fraction of the parent population. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60723/60723fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60723/60723fig03.jpg" /> 
Figure 3: Representative humanization levels 4&#8211;5 months after stem cell transplantation with cell subtype fractions for 10 and 16 mice generated from two different human donors. (A) The mononuclear cell population (MNC) from 10 and (B) 16 humanized mice were analyzed via flow cytometry and gated as presented in Figure 2. The fraction of human CD45+ cells is presented as %hCD45 (of total MNC), and %B and %T cells as a fraction of hCD45. T cells were subsequently divided into %CD4 and %CD8. Each data point represents one mouse. Data is presented as mean &#177; SD. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60723/60723fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60723/60723fig04.jpg" /> 
Figure 4: Experimental lab bench setup for intravaginal exposure of mice. Experimental setup for HIV exposure of humanized mice through the intravaginal route. The procedure is performed in a flow bench where all reagents and surfaces have been sterilized prior to use. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60723/60723fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/60723/60723fig05.jpg" /> 
Figure 5: Rate of HIV strain transmission through different exposure routes and efficacy and safety of cART-containing chow in viral suppression. (A) Humanized NOG mice were successfully infected with two different strains of HIV through either the intravaginal or the intravenous route. Mice were exposed with 21,400 IUs of RHPA4259 intravaginally, 5,157 IUs IV with RHPA4259, or 3,000 IUs IV with YU2. Details regarding IV exposure of humanized mice are not included in this protocol. HIV infections were successfully treated with a cART regimen delivered through mouse chow. (B) The viral load decreased to below detection for all three mice on cART and rebound emerged after the cessation of cART. The dotted line indicates limit of quantification at 725 copies/mL. Mice fed with cART chow had similar weight development as mice housed on non-cART chow during the same time period, indicating no taste-preference or side effects of the cART diet. (C) Weights are presented as fold change compared to the start of cART. Each data point represents the mean of three animals &#177; SD. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60723/60723fig05large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody target</td>
			<td>Clone</td>
			<td>Fluorophore</td>
		</tr>
		<tr>
			<td>CD3</td>
			<td>clone SK7</td>
			<td>BUV395</td>
		</tr>
		<tr>
			<td>CD34</td>
			<td>clone AC136</td>
			<td>FITC</td>
		</tr>
		<tr>
			<td>CD45</td>
			<td>clone 2D1</td>
			<td>APC</td>
		</tr>
	</tbody>
</table>
Table 1: Antibodies used for determination of stem cell purity. Suggested multicolor flow cytometry panel for evaluation of stem cell purity. Listed are the antibody target, the clone, and the fluorophore.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>CCR5&#916;32 detection</td>
			<td>Primers</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>5&#39;CTTCATTACACCTGCAGCT&#39;3</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>5&#39;TGAAGATAAGCCTCACAGCC&#39;3</td>
		</tr>
	</tbody>
</table>
Table 2: CCR5&#916;32 variant detection PCR primers. Forward and reverse primers used for detection of the 32 bp deletion in the CCR5 gene.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No. of Cycles</td>
			<td>1</td>
			<td>45</td>
			<td>1</td>
			<td>&#8734;</td>
		</tr>
		<tr>
			<td>Temperature (&#176;C)</td>
			<td>98</td>
			<td>98/63/72</td>
			<td>72</td>
			<td>10</td>
		</tr>
		<tr>
			<td>Time</td>
			<td>30 s</td>
			<td>10 s/30 s/15 s</td>
			<td>5 min</td>
			<td>&#8734;</td>
		</tr>
	</tbody>
</table>
Table 3: CCR5&#916;32 variant detection PCR program. PCR cycling program used for amplification of the CCR5 gene.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Antibody target</td>
			<td>Clone</td>
			<td>Fluorophore</td>
		</tr>
		<tr>
			<td>CD4</td>
			<td>SK3</td>
			<td>BUV 496</td>
		</tr>
		<tr>
			<td>CD8</td>
			<td>RPA-T8</td>
			<td>BV421</td>
		</tr>
		<tr>
			<td>CD3</td>
			<td>OKT3</td>
			<td>FITC</td>
		</tr>
		<tr>
			<td>CD19</td>
			<td>sj25c1</td>
			<td>PE-Cy7</td>
		</tr>
		<tr>
			<td>CD45</td>
			<td>2D1</td>
			<td>APC</td>
		</tr>
	</tbody>
</table>
Table 4: Antibodies used for determination of mouse humanization. Suggested multicolor flow cytometry panel for humanization. Listed are the antibody target, the clone, and the fluorophore.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No. of Cycles</td>
			<td>1</td>
			<td>1</td>
			<td>&#8734;</td>
		</tr>
		<tr>
			<td>Temperature (&#176;C)</td>
			<td>51</td>
			<td>80</td>
			<td>4</td>
		</tr>
		<tr>
			<td>Time</td>
			<td>45 min</td>
			<td>15 min</td>
			<td>&#8734;</td>
		</tr>
	</tbody>
</table>
Table 5: cDNA amplification program. Program used for amplification of complementary strand DNA to the viral RNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>HIV quantification</td>
			<td>Primers</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>5&#39;AGGGCAGCATAGAGCAAAAA&#39;3</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>5&#39;CAAAGGAATGGGGGTTCTTT&#39;3</td>
		</tr>
		<tr>
			<td>FAM probe</td>
			<td>5&#39;ATCCCCACTTCAACAGATGC&#39;3</td>
		</tr>
	</tbody>
</table>
Table 6: HIV ddPCR primers. Primers and probes used for ddPCR amplification of viral cDNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No. of Cycles</td>
			<td>1</td>
			<td>39</td>
			<td>1</td>
			<td>&#8734;</td>
		</tr>
		<tr>
			<td>Temperature (&#176;C)</td>
			<td>95</td>
			<td>95/54.5</td>
			<td>98</td>
			<td>4</td>
		</tr>
		<tr>
			<td>Time</td>
			<td>10 min</td>
			<td>30 s/1 min</td>
			<td>10 min</td>
			<td>&#8734;</td>
		</tr>
	</tbody>
</table>
Table 7: HIV ddPCR program. PCR cycling program used for amplification of viral RNA.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Raltegravir (RAL)</td>
			<td>4800 mg/kg</td>
		</tr>
		<tr>
			<td>Tenofovir disoproxil fumarate (TDF)</td>
			<td>720 mg/kg</td>
		</tr>
		<tr>
			<td>Emtricitabine (FTC)</td>
			<td>520 mg/kg</td>
		</tr>
	</tbody>
</table>
Table 8: Mouse cART chow diet. Mouse chow diet was formulated as previously published21. The chow diet was made on a base of standard mouse chow, and after production, the food was &#947;-irradiated with 25 kGy and double-bagged. The chow was stored at -20 &#176;C until use.

Watch this Scientific Journal Video about Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection at JoVE.com

Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection

We have developed a protocol for the generation and evaluation of a humanized and human immunodeficiency virus-infected NOG mouse model based on stem cell transplant, intravaginal human immunodeficiency virus exposure, and droplet digital PCR RNA quantification.

Humanized mice provide a sophisticated platform to study human immunodeficiency virus (HIV) virology and to test antiviral drugs. This protocol describes ...

humanized-nog-mice-for-intravaginal-hiv-exposure-treatment-hiv

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.4K Views.  Aarhus University. Het vaststellen van dit gehumaniseerde muismodel kan helpen bij preklinische HIV-onderzoeken. Zo kunnen bijvoorbeeld zowel verschillende virale stammen als nieuwe hiv-interventies worden geëvalueerd. Deze protocollen kunnen worden gebruikt om de status van stamceldonor CCR5 te evalueren en om gehumaniseerde muizen efficiënt te infecteren met HIV en om virale belasting van muisplasma te kwantificeren.Het RNA-kwantificeringsprotocol kan eenvoudig worden aangepast om elke virale RNA-seq...

Video: Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection

Visualizing Cell-to-cell Transfer of HIV using Fluorescent Clones of HIV and Live Confocal Microscopy

By fusing the green fluorescent protein to their favorite proteins, biologists now have the ability to study living complex cellular processes using fluorescence video microscopy. To track the movements of the human immunodeficiency virus core protein during cell-to-cell transmission of human immunodeficiency virus, we have GFP-tagged the Gag protein in the context of an infectious molecular clone of HIV, called HIV Gag-iGFP. We study this viral clone using video confocal microscopy. In the following visualized experiment, we transfect a human T cell line with HIV Gag-iGFP, and we use fluorescently labeled uninfected CD4+ T cells to serve as target cells for the virus. Using the different fluorescent labels we can readily follow viral production and transport across intercellular structures called virological synapses. Simple gas permeable imaging chambers allow us to observe synapses with live confocal microscopy from minutes to days. These approaches can be used to track viral proteins as they move in from one cell to the next.

This visualized experiment is a guide for utilizing a fluorescent molecular clone of HIV for live confocal imaging experiments.

By fusing the green fluorescent protein to their favorite proteins, biologists now have the ability to study living complex cellular processes using ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Stem-cell Based Engineered Immunity Against HIV Infection in the Humanized Mouse Model

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic differentiation and immune function of the genetically modified cells. The humanized Bone-marrow/Liver/Thymus (BLT) mouse model allows for full reconstitution of a human immune system in the periphery, which includes T cells, B cells, NK cells and monocytes. The human thymic implant also allows for thymic selection of T cells in autologous thymic tissue. In addition to the study of HIV infection, the model stands as a powerful tool to study differentiation, development and functionality of cells derived from hematopoietic stem cells (HSCs). Here we outline the construction of humanized non-obese diabetic (NOD)-severe combined immunodeficient (SCID)-common gamma chain knockout (c&#947;-/-)-Bone-marrow/Liver/Thymus (NSG-BLT) mice with HSCs transduced with CD4 chimeric antigen receptor (CD4CAR) lentivirus vector. We show that the CD4CAR HSCs can successfully differentiate into multiple lineages and have anti-HIV activity. The goal of the study is to demonstrate the use of NSG-BLT mouse model as an in vivo model for engineered immunity against HIV. It is worth noting that, because lentivirus and human tissue is used, experiments and surgeries should be performed in a Class II biosafety cabinet in a Biosafety Level 2 (BSL2) with special precautions (BSL2+) facility.

This protocol describes the methods in constructing a humanized bone-marrow/liver/thymus mouse model with stem cell-based engineered immunity against HIV infection.

With the rapid development of stem cell-based gene therapies against HIV, there is pressing requirement for an animal model to study the hematopoietic ...

Medicine

Humanized NOD/SCID/IL2r&#947;null (hu-NSG) Mouse Model for HIV Replication and Latency Studies

Ethical regulations and technical challenges for research in human pathology, immunology, and therapeutic development have placed small animal models in high demand. With a close genetic and behavioral resemblance to humans, small animals such as the mouse are good candidates for human disease models, through which human-like symptoms and responses can be recapitulated. Further, the mouse genetic background can be altered to accommodate diverse demands. The NOD/SCID/IL2r&#947;null (NSG) mouse is one of the most widely used immunocompromised mouse strains; it allows engraftment with human hematopoietic stem cells and/or human tissues and the subsequent development of a functional human immune system. This is a critical milestone in understanding the prognosis and pathophysiology of human-specific diseases such as HIV/AIDS and aiding the search for a cure. Herein, we report a detailed protocol for generating a humanized NSG mouse model (hu-NSG) by hematopoietic stem cell transplantation into a radiation-conditioned neonatal NSG mouse. The hu-NSG mouse model shows multi-lineage development of transplanted human stem cells and susceptibility to HIV-1 viral infection. It also recapitulates key biological characteristics in response to combinatorial antiretroviral therapy (cART).

This protocol provides a method to establish humanized mice (hu-NSG) via intrahepatic injection of human hematopoietic stem cells into radiation-conditioned neonatal NSG mice. The hu-NSG mouse is susceptible to HIV infection and combinatorial antiretroviral therapy (cART) and serves as a suitable pathophysiological model for HIV replication and latency investigations.

Ethical regulations and technical challenges for research in human pathology, immunology, and therapeutic development have placed small animal models in ...

Establishment of the Dual Humanized TK-NOG Mouse Model for HIV-associated Liver Pathogenesis

Despite the increased life expectancy of patients infected with human immunodeficiency virus-1 (HIV-1), liver disease has emerged as a common cause of their morbidity. The liver immunopathology caused by HIV-1 remains elusive. Small xenograft animal models with human hepatocytes and human immune system can recapitulate the human biology of the disease&#39;s pathogenesis. Herein, a protocol is described to establish a dual humanized mouse model through human hepatocytes and CD34+ hematopoietic stem/progenitor cells (HSPCs) transplantation, to study liver immunopathology as observed in HIV-infected patients. To achieve dual reconstitution, male TK-NOG (NOD.Cg-Prkdcscid Il2rgtm1Sug Tg(Alb-TK)7-2/ShiJic) mice are intraperitoneally injected with ganciclovir (GCV) doses to eliminate mouse transgenic liver cells, and with treosulfan for nonmyeloablative conditioning, both of which facilitate human hepatocyte (HEP) engraftment and human immune system (HIS) development. Human albumin (ALB) levels are evaluated for liver engraftment, and the presence of human immune cells in blood detected by flow cytometry confirms the establishment of human immune system. The model developed using the protocol described here resembles multiple components of liver damage from HIV-1 infection. Its establishment could prove to be essential for studies of hepatitis virus co-infection and for the evaluation of antiviral and antiretroviral drugs.

This protocol provides a reliable method to establish humanized mice with both human immune system and liver cells. Dual reconstituted immunodeficient mice achieved via intrasplenic injection of human hepatocytes and CD34+ hematopoietic stem cells are susceptible to human immunodeficiency virus-1 infection and recapitulate liver damage as observed in HIV-infected patients.

Despite the increased life expectancy of patients infected with human immunodeficiency virus-1 (HIV-1), liver disease has emerged as a common cause of ...

Chronic, Acute, and Reactivated HIV Infection in Humanized Immunodeficient Mouse Models

Humanized NOD/SCID/IL-2 receptor &#947;-chainnull mice recapitulate some features of human immunity, which can be exploited in basic and pre-clinical research on infectious diseases. Described here are three models of humanized immunodeficient mice for studying the dynamics of HIV infection. The first is based on the intrahepatic injection of CD34+ hematopoietic stem cells in newborn mice, which allows for the reconstitution of several blood and lymphoid tissue-confined cells, followed by infection with a reference HIV strain. This model allows monitoring for up to 36 weeks post-infection and is hence called the chronic model. The second and third models are referred to as the acute and reactivation models, in which peripheral blood mononuclear cells are intraperitoneally injected in adult mice. In the acute model, cells from a healthy donor are engrafted through the intraperitoneal route, followed by infection with a reference HIV strain. Finally, in the reactivation model, cells from an HIV-infected donor under antiretroviral therapy are engrafted via the intraperitoneal route. In this case, a drug-free environment in the mouse allows for virus reactivation and an increase in viral load. The protocols provided here describe the conventional experimental approach for humanized, immunodeficient mouse models of HIV infection.

Described here are three experimental approaches for studying the dynamics of HIV infection in humanized mice. The first permits the study of chronic infection events, whereas the two latter allows for the study of acute events after primary infection or viral reactivation.

Humanized NOD/SCID/IL-2 receptor &#947;-chainnull mice recapitulate some features of human immunity, which can be exploited in basic and pre-clinical ...

Oral Combinational Antiretroviral Treatment in HIV-1 Infected Humanized Mice

The human immunodeficiency virus (HIV-1) pandemic continues to spread unabated worldwide, and currently, there is no vaccine available against HIV. Although combinational antiretroviral therapy (cART) has been successful in suppressing viral replication, it cannot completely eradicate the reservoir from HIV-infected individuals. A safe and effective cure strategy for HIV infection will require multipronged methods, and therefore the advancements of animal models for HIV-1 infection are pivotal for the development of HIV cure research. Humanized mice recapitulate key features of HIV-1 infection. The humanized mouse model can be infected by HIV-1 and viral replication can be controlled with cART regimens. Moreover, cART interruption results in a prompt viral rebound in humanized mice. However, administration of cART to the animal can be ineffective, difficult, or toxic, and many clinically relevant cART regimens are unable to be optimally utilized. Along with being potentially unsafe for researchers, administration of cART by a commonly used intensive daily injection procedure induces stress by physical restraint of the animal. The novel oral cART method to treat HIV-1 infected humanized mice described in this article resulted in suppression of viremia below the detection level, increased rate of CD4+ restoration, and improved overall health in HIV-1 infected humanized mice.

This protocol describes a novel method to deliver oral combinational antiretroviral drugs that successfully suppress HIV-1 RNA replication in humanized mice.

The human immunodeficiency virus (HIV-1) pandemic continues to spread unabated worldwide, and currently, there is no vaccine available against HIV. ...

EcoHIV Infection in Tmem119-EGFP Mice for Studying Microglial Alterations

Identification of EcoHIV-Infected Cells in Microglia-Manipulated Transgenic Mice

Combined antiretroviral therapy (cART) has dramatically improved the quality of life for people living with HIV (PLWH). However, over 4 million PLWH are over the age of fifty and experience accompanying HIV-associated neurocognitive disorders (HAND). To understand how HIV impacts the central nervous system, a reliable and feasible model of HIV is necessary. Previously, a novel biological system using chimeric HIV (EcoHIV) inoculation was developed in a rat model to investigate neurocognitive impairments and synaptic dysfunction. Nevertheless, a significant challenge remains in clarifying EcoHIV's neuroanatomical distribution, particularly its differential expression in various cell types in the brain. In the current study, EcoHIV with mScarlet fluorescence labeling was modified and retro-orbitally injected into Tmem119-EGFP knock-in mice (which express enhanced green fluorescence protein primarily in microglia) to determine if microglia are the major cell type responsible for viral expression and reservoirs of HIV in the brain. The current data show that: (1) in vitro, EcoHIV-mScarlet fluorescence signals were predominantly localized in microglia-like cells among primary rodent brain cells; (2) in vivo, injection of EcoHIV-mScarlet into Tmem119-EGFP mice induced significant HIV expression in the mouse brain. The co-localization of mScarlet and EGFP signals suggests that microglia are the main cell type harboring HIV in the brain. Overall, EcoHIV in rodents offers a valuable biological system to study microglial alterations, viral reservoirs in the brain, and the neurological mechanisms of HIV-associated neurocognitive disorders.

This protocol describes how the combination of EcoHIV infection with Tmem119-EGFP mice offers a valuable biological system for investigating microglial alterations and viral reservoirs in rodent models of HIV-associated neurocognitive disorders.

Combined antiretroviral therapy (cART) has dramatically improved the quality of life for people living with HIV (PLWH). However, over 4 million PLWH are ...

Neuroscience

Oral Combinational Antiretroviral Therapy to Treat HIV-1 Infection in a Humanized Mouse Model

Source: Mu, W., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/63696">Oral Combinational Antiretroviral Treatment in HIV-1 Infected Humanized Mice.</a> J. Vis. Exp. (2022).
This video demonstrates an assay to evaluate the effectiveness of oral combined antiretroviral therapy (oral cART) in a human immunodeficiency virus-1 (HIV-1)-infected humanized mouse model. A combination of drugs targeting HIV-1, including nucleoside reverse transcriptase inhibitors and integrase strand transfer inhibitors, is administered along with a nutritional supplement and antibiotics. Following the consumption of this mixture by the humanized mice infected with HIV-1, the effective suppression of viral replication is assessed through periodic examinations of the mice.

All procedures involving animal models have been reviewed by the local institutional animal care committee and the JoVE veterinary review board.
1. ...

JoVE Encyclopedia of Experiments

Immunology

Immunotherapy

Model Development and Disease Study

Constructing a Humanized Mouse Model with Engineered Immunity against HIV

Source: Zhen, A., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/54048">Stem-cell Based Engineered Immunity Against HIV Infection in the Humanized Mouse Model.</a> J. Vis. Exp. (2016).
The video demonstrates a technique to generate a humanized mouse model with stem-cell-based engineered immunity against the human immunodeficiency virus (HIV). Human fetal thymus tissue and engineered hematopoietic stem cells (HSCs) are implanted into the kidney capsule of a severely immunocompromised mouse. The HSCs, which express chimeric antigen receptors (CARs) against HIV, are mixed in a gelatinous protein mixture that promotes their co-localization with thymus tissue. Post-procedure, the HSCs differentiate into various human immune cells, resulting in the development of a humanized mouse model with a functional human immune system against HIV.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines. All procedures involving animal ...

Humanized NOG Mice for Intravaginal HIV Exposure and Treatment of HIV Infection

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video