This work was supported by the National Institutes of Health (NIH) grants R44GM113545 and P20GM103434.

<ol><li>Gellatly, S. L., Hancock, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Pseudomonas+aeruginosa%3A+new+insights+into+pathogenesis+and+host+defenses%5BTitle%5D)+AND+%22Pathogens+and+Disease%22%5BJournal%5D)">Pseudomonas aeruginosa: new insights into pathogenesis and host defenses.</a> Pathogens and Disease. 67 (3), 159-173 (2013).</li>
<li>Valentine, M. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Generation+of+a+highly+attenuated+strain+of+Pseudomonas+aeruginosa+for+commercial+production+of+alginate%5BTitle%5D)+AND+%22Microbial+Biotechnology%22%5BJournal%5D)">Generation of a highly attenuated strain of Pseudomonas aeruginosa for commercial production of alginate.</a> Microbial Biotechnology. , (2019).</li>
<li>Schweizer, H. P., Hoang, T. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+improved+system+for+gene+replacement+and+xylE+fusion+analysis+in+Pseudomonas+aeruginosa%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa.</a> Gene. 158 (1), 15-22 (1995).</li>
<li>Damron, F. H., Qiu, D., Yu, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((The+Pseudomonas+aeruginosa+sensor+kinase+KinB+negatively+controls+alginate+production+through+AlgW-dependent+MucA+proteolysis%5BTitle%5D)+AND+%22Journal+of+Bacteriology%22%5BJournal%5D)">The Pseudomonas aeruginosa sensor kinase KinB negatively controls alginate production through AlgW-dependent MucA proteolysis.</a> Journal of Bacteriology. 191 (7), 2285-2295 (2009).</li>
<li>Yu, H., Boucher, J. C., Hibler, N. S., Deretic, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Virulence+properties+of+Pseudomonas+aeruginosa+lacking+the+extreme-stress+sigma+factor+AlgU+%28sigmaE%29%5BTitle%5D)+AND+%22Infection+and+Immunity%22%5BJournal%5D)">Virulence properties of Pseudomonas aeruginosa lacking the extreme-stress sigma factor AlgU (sigmaE).</a> Infection and Immunity. 64 (7), 2774-2781 (1996).</li>
<li>Baeshen, M. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+of+Biopharmaceuticals+in+E.+coli%3A+Current+Scenario+and+Future+Perspectives%5BTitle%5D)+AND+%22Journal+of+Microbiology+and+Biotechnology%22%5BJournal%5D)">Production of Biopharmaceuticals in E. coli: Current Scenario and Future Perspectives.</a> Journal of Microbiology and Biotechnology. 25 (7), 953-962 (2015).</li>
<li>Marisch, K., Bayer, K., Cserjan-Puschmann, M., Luchner, M., Striedner, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+three+industrial+Escherichia+coli+strains+in+fed-batch+cultivations+during+high-level+SOD+protein+production%5BTitle%5D)+AND+%22Microbial+Cell+Factories%22%5BJournal%5D)">Evaluation of three industrial Escherichia coli strains in fed-batch cultivations during high-level SOD protein production.</a> Microbial Cell Factories. 12, 58(2013).</li>
<li>Ferrer-Miralles, N., Domingo-Espin, J., Corchero, J. L., Vazquez, E., Villaverde, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Microbial+factories+for+recombinant+pharmaceuticals%5BTitle%5D)+AND+%22Microbial+Cell+Factories%22%5BJournal%5D)">Microbial factories for recombinant pharmaceuticals.</a> Microbial Cell Factories. 8, 17(2009).</li>
<li>Horton, R. M., Cai, Z. L., Ho, S. N., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Gene+splicing+by+overlap+extension%3A+tailor-made+genes+using+the+polymerase+chain+reaction%5BTitle%5D)+AND+%22Biotechniques%22%5BJournal%5D)">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> Biotechniques. 8 (5), 528-535 (1990).</li>
<li>Horton, R. M., Hunt, H. D., Ho, S. N., Pullen, J. K., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineering+hybrid+genes+without+the+use+of+restriction+enzymes%3A+gene+splicing+by+overlap+extension%5BTitle%5D)+AND+%22Gene%22%5BJournal%5D)">Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension.</a> Gene. 77 (1), 61-68 (1989).</li>
<li>Sambrook, J., Fritsch, E. F., Maniatis, T. <a target="_blank" href="http://scholar.google.com/scholar?hl=en&safe=off&q=author%3aSambrook%2C+J+%22Molecular+cloning%3A+a+laboratory+manual%22">Molecular cloning: a laboratory manual</a>. , Cold Spring Harbor Laboratory Press. (1989).</li>
<li>Figurski, D. H., Helinski, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Replication+of+an+origin-containing+derivative+of+plasmid+RK2+dependent+on+a+plasmid+function+provided+in+trans%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+of+the+United+States+of+America%22%5BJournal%5D)">Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans.</a> Proceedings of the National Academy of Sciences of the United States of America. 76 (4), 1648-1652 (1979).</li>
<li>Choi, K. H., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((mini-Tn7+insertion+in+bacteria+with+single+attTn7+sites%3A+example+Pseudomonas+aeruginosa%5BTitle%5D)+AND+%22Nature+Protocols%22%5BJournal%5D)">mini-Tn7 insertion in bacteria with single attTn7 sites: example Pseudomonas aeruginosa.</a> Nature Protocols. 1 (1), 153-161 (2006).</li>
<li>Choi, K. H., Kumar, A., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((A+10-min+method+for+preparation+of+highly+electrocompetent+Pseudomonas+aeruginosa+cells%3A+application+for+DNA+fragment+transfer+between+chromosomes+and+plasmid+transformation%5BTitle%5D)+AND+%22Journal+of+Microbiological+Methods%22%5BJournal%5D)">A 10-min method for preparation of highly electrocompetent Pseudomonas aeruginosa cells: application for DNA fragment transfer between chromosomes and plasmid transformation.</a> Journal of Microbiological Methods. 64 (3), 391-397 (2006).</li>
<li>Liang, R., Liu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Scarless+and+sequential+gene+modification+in+Pseudomonas+using+PCR+product+flanked+by+short+homology+regions%5BTitle%5D)+AND+%22BMC+Microbiology%22%5BJournal%5D)">Scarless and sequential gene modification in Pseudomonas using PCR product flanked by short homology regions.</a> BMC Microbiology. 10, 209(2010).</li>
<li>Martinez-Garcia, E., de Lorenzo, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Engineering+multiple+genomic+deletions+in+Gram-negative+bacteria%3A+analysis+of+the+multi-resistant+antibiotic+profile+of+Pseudomonas+putida+KT2440%5BTitle%5D)+AND+%22Environmental+Microbiology%22%5BJournal%5D)">Engineering multiple genomic deletions in Gram-negative bacteria: analysis of the multi-resistant antibiotic profile of Pseudomonas putida KT2440.</a> Environmental Microbiology. 13 (10), 2702-2716 (2011).</li>
<li>Song, C. W., Lee, S. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Rapid+one-step+inactivation+of+single+or+multiple+genes+in+Escherichia+coli%5BTitle%5D)+AND+%22Biotechnology+Journal%22%5BJournal%5D)">Rapid one-step inactivation of single or multiple genes in Escherichia coli.</a> Biotechnology Journal. 8 (7), 776-784 (2013).</li>
<li>Yan, M. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((CRISPR-Cas12a-Assisted+Recombineering+in+Bacteria%5BTitle%5D)+AND+%22Applied+and+Environmental+Microbiology%22%5BJournal%5D)">CRISPR-Cas12a-Assisted Recombineering in Bacteria.</a> Applied and Environmental Microbiology. 83 (17), (2017).</li>
<li>Prakash, O., Nimonkar, Y., Shouche, Y. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Practice+and+prospects+of+microbial+preservation%5BTitle%5D)+AND+%22FEMS+Microbiology+Letters%22%5BJournal%5D)">Practice and prospects of microbial preservation.</a> FEMS Microbiology Letters. 339 (1), 1-9 (2013).</li>
</ol>

The author Hongwei D. Yu is the Chief Science Officer and Co-founder of Progenesis Technologies, LLC.

The pEX100T-Not1 plasmid is an efficient mediator of sequential genomic deletions that are marker-free and in-frame. When engineering bacterial strains for attenuated virulence, deletion of entire gene sequences rather than generating point mutations decreases the likelihood of reversion to a virulent phenotype. Additionally, each pathogenicity gene deletion attenuates the pathogen further, reinforcing the stability of the attenuation.
This method can also be used to generate genomic modifications other than deletions, such as point mutations and insertions, simply by modifying the design of the plasmid insert. These types of modifications may be more useful than entire gene deletions for engineering bacteria with modified metabolism, for example. Sequential genomic modification has significant potential for generating designer bacterial strains to suit specific purposes in research and industry. Other methods of generating desired marker-free genomic modifications in bacteria have been described15,16,17,18. As with all genome-editing methods, attempted modifications to essential genomic regions may be lethal, and thus unsuccessful. In these cases, identification of different genetic modifications or other candidate genes is required to generate the bacterial strain of interest.
Given the numerous replication events and passages of each colony throughout this protocol, unintended changes to the genome will occur to the generated strain. The exact genomic changes can be identified through whole-genome sequencing. However, the impact of these changes is harder to determine. When engineering bacteria for a specific purpose, genomic changes that do not negatively affect the growth of the organism or the targeted pathway(s) are tolerable. Depending on the strain being generated, it may be possible to identify a &#34;readout&#34; to ensure that the strain is still useful for its intended purpose. For example, with PGN5, the goal was to create an attenuated strain that retained the ability to produce large amounts of alginate. After deletion of five pathogenicity genes, the amount and composition of alginate produced by PGN5 was measured and determined to be comparable to other alginate-producing strains. Thus, alginate production was unaffected by the five gene deletions, nor by the unintended genomic changes that occurred during the development of PGN5.
A model of intraperitoneal mouse injection was used to determine whether an engineered strain was attenuated compared to the parent strain and E. coli BL21, a strain approved by the FDA for production of biopharmaceuticals. The most important steps taken during this animal testing procedure were preparation and validation of frozen bacterial stocks. Preparation and use of frozen bacterial cultures to inject mice is preferable to using continuous culture, as it reduces the number mutations that naturally occur in bacterial populations19. Additionally, frozen cultures should remain viable for years. Viable plate counts showed no significant difference between the CFU/mL directly after stocks were prepared and three months after preparation. The use of multiple validation steps throughout this procedure ensured that the method was reproducible, and the results were not skewed by contaminating bacteria. Additionally, with the number of precautionary steps taken to ensure reproducibility, fewer animals were needed. Using a bacterial strain that is FDA-approved for biopharmaceutical production as the control (such as E. coli strain BL21), this method could be used to test the attenuation of other genetically engineered strains of P. aeruginosa, or other species of bacteria.
Using bioluminescence as a marker provides additional validation of the bacterial strains injected, as the marker can be visualized at the injection site. Insertion of the bioluminescence marker into the bacterial chromosome is required for bioluminescence imaging but may not be possible if working with incompatible strains/species. However, marking strains with bioluminescence is not required to test for attenuation. The strains tested in this study were marked with bioluminescence, which allowed for visualization of localization differences between strains throughout the course of the infection. We observed that the pathogenic strain disseminated through the body of the mouse, but the non-pathogenic strain remained at the site of injection. While this experiment only tested two very closely related strains of P. aeruginosa, it suggests that bacterial dissemination is linked to virulence, at least in P. aeruginosa. Thus, this procedure of labeling with bioluminescence to visualize the progression of the infection could be used in the future to quickly evaluate the attenuation of engineered strains of bacteria.

Pseudomonas aeruginosa is an opportunistic bacterial pathogen that can cause life-threatening diseases in humans, especially in the immunocompromised. The pathogenicity of P. aeruginosa is due to the expression of many virulence factors, including proteases and lipopolysaccharide, as well as its ability to form a protective biofilm1. Because of its ability to produce virulence factors and cause disease in humans, using P. aeruginosa to make commercial products presents safety concerns. Nonpathogenic strains of E. coli have traditionally been used to bioengineer medical and commercial products for human use. However, some products are difficult for E. coli to make, and many are packaged in inclusion bodies, making extraction laborious. Engineered bacterial strains with the ability to make and secrete specific products is highly desirable, as secretion would likely increase yield and ease purification processes. Thus, nonpathogenic strains of other species of bacteria (e.g., species that utilize more secretion pathways) may provide useful alternatives to E. coli. We recently reported the development of a strain of P. aeruginosa, PGN5, in which the pathogenicity and toxicity of the organism is highly attenuated2. Importantly, this strain still produces large quantities of the polysaccharide alginate, a commercially interesting component of the P. aeruginosa biofilm.
The PGN5 strain was generated using a two-step allelic exchange procedure with the pEX100T-NotI plasmid to sequentially delete five genes (toxA, plcH, phzM, wapR, aroA) known to contribute to the pathogenicity of the organism. pEX100T-NotI was generated by changing the SmaI to a NotI restriction enzyme recognition site within the multiple cloning site of the plasmid pEX100T, which was developed in Herbert Schweizer&#39;s lab3,4. The recognition site for the restriction enzyme NotI is a rarer DNA sequence compared to SmaI and less likely to be present in sequences being cloned, thus it is more convenient for cloning purposes. The plasmid carries genes that allow for selection, including the bla gene, which encodes &#223;-lactamase and confers resistance to carbenicillin, and the B. subtilissacB gene, which confers sensitivity to sucrose (Figure 1A). The plasmid also carries an origin of replication (ori) compatible with E. coli, and an origin of transfer (oriT) that allows for plasmid transfer from E. coli to Pseudomonas species via conjugation. However, the plasmid lacks an origin of replication compatible with Pseudomonas, and thus cannot replicate within Pseudomonas species (i.e., it is a Pseudomonas suicide vector). These characteristics make pEX100T-NotI ideal for targeting genetic deletions from the Pseudomonas chromosome. Plasmid cloning steps are carried out using E. coli and the resultant plasmid is transferred to Pseudomonas by transformation or conjugation. Then, through homologous recombination events and selective steps, the targeted in-frame deletion is generated, marker-free. This method of sequentially deleting genomic regions from the chromosome of P. aeruginosa could be used to generate highly attenuated Pseudomonas strains, like PGN5, or to design strains for other specific uses (e.g., strains deficient in endonucleases for plasmid propagation or strains deficient in proteases for production of proteins of interest).
The overall virulence of strains of bacteria is affected by growth conditions and phases, during which mutations occur frequently. Therefore, measuring the safety of genetically-engineered strains can be challenging. To evaluate bacterial isolates for systemic virulence, we adapted a previously published protocol of infection by intraperitoneal injection of C57BL/6 mice5. We modified this procedure to use frozen bacterial stocks for injection, which allowed for precise dosing and easy validation of the strains used. In this model, the E. coli strain BL21, which has been FDA-approved for production of biopharmaceuticals, was used as a control safety standard for determining the relative pathogenesis of the strain6,7,8. The main advantage to using this method is that it is reproducible and minimizes sources of variation, as infecting strains are validated for bacterial cell number, phenotype, and genetic markers both before and after infection. With these controlled steps, the number of animals required is reduced. In this model, P. aeruginosa strains that result in C57BL/6 murine mortality rates equal to or less than E. coli BL21 when injected intraperitoneally may be considered attenuated. This simple mouse model of infection may also be used to assess the attenuated pathogenicity of genetically engineered strains from other species using the FDA-approved E. coli strain as the reference. Steps 1-7 detail the generation of sequential genomic deletions in P. aeruginosa (Figure 1) and steps 8-12 detail the use of a mouse model to test the pathogenicity of P. aeruginosa strains.

<table><tbody><tr><td>0.2 mL tubes with flat caps</td><td>ThermoScientific</td><td>AB-0620</td><td>via Fisher Scientific</td></tr><tr><td>1 mL Syringe</td><td>BD</td><td>22-253-260</td><td>via Fisher Scientific</td></tr><tr><td>1.5 mL disposable polystyrene cuvette</td><td>Fisher Scientific</td><td>14955127</td><td></td></tr><tr><td>1.5 mL Microcentrifuge Tubes</td><td>Fisher Scientific</td><td>05-408-129</td><td></td></tr><tr><td>2.0 mL Cryogenic Vials</td><td>Corning</td><td>430659</td><td>via Fisher Scientific</td></tr><tr><td>27G needle</td><td>BD</td><td>14-821-13B</td><td>via Fisher Scientific</td></tr><tr><td>50 mL tubes</td><td>Fisher Scientific</td><td>05-539-13</td><td>via Fisher Scientific</td></tr><tr><td>Accu block Digital Dry Bath</td><td>Labnet</td><td>NC0205808</td><td>via Fisher Scientific</td></tr><tr><td>Benchtop Centrifuge 5804R</td><td>Eppendorf</td><td>04-987-372</td><td>via Fisher Scientific</td></tr><tr><td>Benchtop Microcentrifuge</td><td>Sorvall</td><td>75-003-287</td><td>via Fisher Scientific</td></tr><tr><td>Cabinet Incubator</td><td>VWR</td><td>1540</td><td></td></tr><tr><td>Carbenicillin disodium salt</td><td>Fisher Scientific</td><td>BP2648250</td><td></td></tr><tr><td>Culture Test Tube, Polystyrene</td><td>Fisher Scientific</td><td>14-956-6D</td><td>via Fisher Scientific</td></tr><tr><td>Diposable Inoculation Loops</td><td>Fisher Scientific</td><td>22-363-597</td><td></td></tr><tr><td>Dneasy UltraClean Microbial Kit (50)</td><td>Qiagen</td><td>12224-50</td><td>or preferred method/vendor</td></tr><tr><td>E.Z.N.A. Cycle Pure Kit (50)</td><td>Omega bio-tek</td><td>D6493-01</td><td>or preferred method/vendor</td></tr><tr><td>EcoRI-HF, restriction endonuclease</td><td>New England BioLabs</td><td>R3101L</td><td></td></tr><tr><td>Electroporation Cuvettes</td><td>Bulldog Bio</td><td>NC0492929</td><td>via Fisher Scientific</td></tr><tr><td>FastLink II DNA Ligation Kit</td><td>Epicentre Technologies</td><td>LK6201H</td><td>via Fisher Scientific</td></tr><tr><td>Gentamycin Sulfate</td><td>Fisher Scientific</td><td>BP918-1</td><td></td></tr><tr><td>Glycerol</td><td>Fisher Scientific</td><td>BP229-4</td><td></td></tr><tr><td>GoTaq G2 Colorless Master Mix</td><td>Promega</td><td>M7833</td><td>via Fisher Scientific</td></tr><tr><td>Isothesia Isoflurane</td><td>Henry Schein Animal Health</td><td>29405</td><td></td></tr><tr><td>IVIS Lumina XRMS Series III In Vivo Imaging System</td><td>Perkins and Elmer</td><td>CLS136340</td><td></td></tr><tr><td>Kanamycin monosulfate</td><td>Fisher Scientific</td><td>BP906-5</td><td></td></tr><tr><td>LE agarose</td><td>Genemate</td><td>3120-500</td><td>via Fisher Scientific</td></tr><tr><td>Luria Broth</td><td>Difco</td><td>240230</td><td>via Fisher Scientific</td></tr><tr><td>MicroPulser Electroporator</td><td>BioRad</td><td>1652100</td><td></td></tr><tr><td>Noble agar, ultrapure</td><td>Affymetris/USB</td><td>AAJ10907A1</td><td>via Fisher Scientific</td></tr><tr><td>NotI-HF, restriction endonuclease</td><td>New England BioLabs</td><td>R3189</td><td></td></tr><tr><td>One Shot TOP10 Electrocomp &lt;em&gt;E. coli&lt;/em&gt;</td><td>Invitrogen</td><td>C404052</td><td>via Fisher Scientific</td></tr><tr><td>Phosphate buffered saline powder</td><td>Sigma</td><td>P3813-10PAK</td><td>Sigma-Aldrich</td></tr><tr><td>Prism 7</td><td>GraphPad</td><td></td><td>&lt;a href=&quot;https://www.graphpad.com/scientific-software/prism/&quot; target=&quot;_blank&quot;&gt;https://www.graphpad.com/scientific-software/prism/&lt;/a&gt;</td></tr><tr><td>&lt;em&gt;Pseudomonas&lt;/em&gt; isolation agar</td><td>Difco</td><td>292710</td><td>via Fisher Scientific</td></tr><tr><td>&lt;em&gt;Pseudomonas&lt;/em&gt; isolation broth</td><td>Alpha Biosciences</td><td>P16-115</td><td>Custom made batch</td></tr><tr><td>QIAprep Spin Miniprep Kit (250)</td><td>Qiagen</td><td>27106</td><td>or preferred method/vendor</td></tr><tr><td>Shaking Incubator</td><td>New Brunswick Scientific</td><td>Innova 4080</td><td>shake at 200 rpm</td></tr><tr><td>SimpliAmp Thermal Cycler</td><td>Applied Biosystems</td><td>A24811</td><td></td></tr><tr><td>Skim Milk</td><td>Difco</td><td>DF0032-17-3</td><td>via Fisher Scientific</td></tr><tr><td>Small Plates (100 O.D. x 10 mm)</td><td>Fisher Scientific</td><td>FB0875713</td><td></td></tr><tr><td>SmartSpec Plus Spectrophotometer</td><td>Bio-Rad</td><td>170-2525</td><td>or preferred method/vendor</td></tr><tr><td>Sucrose</td><td>Fisher Scientific</td><td>S5-500</td><td></td></tr><tr><td>Toothpicks, round</td><td>Diamond</td><td></td><td>Any brand of toothpicks, autoclaved</td></tr><tr><td>TOPO TA Cloning Kit, for seqeuncing</td><td>Invitrogen</td><td>45-0030</td><td></td></tr><tr><td>XAF-8 Anesthesia System Filters</td><td>Perkins and Elmer</td><td>118999</td><td></td></tr><tr><td>XGI 8 Gas Anesthesia System</td><td>Caliper Life Sciences/Xenogen</td><td></td><td></td></tr></tbody></table>

generation of in-frame gene deletion mutants in pseudomonas aeruginosa and testing for virulence attenuation in a simple mouse model of infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of these products are naturally produced by the organisms, other products require genetic engineering of the organism to increase the yields of production. Avirulent strains of Escherichia coli have traditionally been the preferred bacterial species for producing biopharmaceuticals; however, some products are difficult for E. coli to produce. Thus, avirulent strains of other bacterial species could provide useful alternatives for production of some commercial products. Pseudomonas aeruginosa is a common and well-studied Gram-negative bacterium that could provide a suitable alternative to E. coli. However, P. aeruginosa is an opportunistic human pathogen. Here, we detail a procedure that can be used to generate nonpathogenic strains of P. aeruginosa through sequential genomic deletions using the pEX100T-NotI plasmid. The main advantage of this method is to produce a marker-free strain. This method may be used to generate highly attenuated P. aeruginosa strains for the production of commercial products, or to design strains for other specific uses. We also describe a simple and reproducible mouse model of bacterial systemic infection via intraperitoneal injection of validated test strains to test the attenuation of the genetically engineered strain in comparison to the FDA-approved BL21 strain of E. coli.

As shown in Figure 2, the targeted genomic deletion can be confirmed using colony PCR with specific primers that amplify the region of interest. Colonies that carry a genomic deletion will yield a shorter PCR band size in comparison to wild-type colonies. A PCR-screen of 10-12 colonies is usually sufficient to detect at least one colony that carries the targeted deletion. If no deletions are detected after multiple rounds of screens, repeat the procedure beginning with the conjugation. If the deletion still fails, the plasmid insert may need to be confirmed through sequencing, redesigned, or the deletion may be lethal. Upon the verification of a gene deletion via PCR, confirm the deletion through sequencing. The resulting strain may be subjected to the procedure repeatedly to generate sequential genomic modifications.
As shown in Figure 3, mortality associated with intraperitoneal injection of the attenuated strain of P. aeruginosa PGN5 (+mucE) was 0%, which was equivalent to mortality observed with E. coli BL21. On the other hand, intraperitoneal injection of the parent strain (VE2) was fatal to 80% of mice. These results were obtained with extensive steps to validate the strains injected. While the exact cause of death in these mice is unknown, it can at least in part be attributed to the expression of virulence factors in the parent strain that were deleted from the attenuated PGN5 strain. Differences in the infection progression was tracked using bioluminescence-marked parent and attenuated strains. The attenuated strain remained localized at the site of injection until bioluminescence faded (Figure 4). The clearance of the infection most likely coincided with the fading of the bioluminescence. Bioluminescence was not detected 24 h after injection and mice lived for weeks following injection until sacrificed, with no adverse effects observed.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60297/60297fig1a.jpg" /> 
Figure 1: Generating gene deletions in P. aeruginosa with pEX100T-NotI. (A) Map of the pEX100T-NotI plasmid. (B) Generation of a construct composed of regions directly upstream (yellow) and downstream (blue) of the region of interest (ROI), flanked with NotI restriction enzyme recognition sites. First, PCR-amplify upstream and downstream regions independently with specific primers that add 5&#39; NotI digestion sites (e.g., NotI-aroA F CGCGGCCGCTGAAGGTCCTGGGCTCCTATCCGAAAGCGGTGCTCT and NotI-aroA R GCGGCCGCAGTTGGGTTGTTCTGCGATGGCGCCAGGCA) and 3&#39; overlapping homologous regions as shown (e.g., aroA-crossover F CTCCAGGCGCTGGGCAAGGTGCTGGCGCATGACTGAGGTCACGCCGGTCGCCGTGGAGAACA and aroA-crossover R TGTTCTCCACGGCGACCGGCGTGACCTCAGTCATGCGCCAGCACCTTGCCCAGCGCCTGGAG. Then, use PCR withNotI-containing primers to join the upstream and downstream products generated in the first PCR reaction. (C) The pEX100T-NotI plasmid, armed and ready. Ligate the NotI-digested cross-over PCR product into the NotI-digested plasmid. (D) Flow diagram of the process to delete genomic regions from the P. aeruginosa chromosome using the pEX100T-NotI plasmid. After the desired deletion has been confirmed and purified, the resultant strain can be taken through the procedure repeatedly to delete other genomic regions from the chromosome. When the desired strain is obtained, sequence the whole genome to confirm deletions and other changes to the chromosome. The pathogenicity of the strain can then be tested in mice using the procedure outlined in Part II of the Protocol. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60297/60297fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60297/60297fig2a.jpg" /> 
Figure 2: Gel electrophoresis of colony PCR products from a screen for aroA deletion to generate the attenuated P. aeruginosa strain, PGN5. Colony PCR products run in lanes 2-5 and 8-11 indicate colonies with wild-type aroA. Colony PCR products run in lanes 6 and 7 carry the aroA gene deletion, indicated by the smaller PCR product (yellow asterisks). Primers used specifically amplified the genomic region containing the aroA gene: aroA-F: GCGAACGCCAACAGCCGATAAAGC, and aroA-R: ATCTGGCTCGCGATGCCGGTCC. Expected PCR product size in wild-type colonies was 2,548 nucleotides (nt). Expected PCR product size in colonies with aroA deletion was 307 nt. A DNA ladder was run in lanes 1 and 12. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60297/60297fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60297/60297fig3a.jpg" /> 
Figure 3: Overall mortality of mice injected with pathogenic P. aeruginosa strain (VE2), attenuated P. aeruginosa strain (PGN5+mucE), and FDA control E. coli strain (BL21). Only mice injected with pathogenic parent strain exhibited mortality at 80%. Attenuated P. aeruginosa strain and FDA control E. coli strain exhibited 0% mortality. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60297/60297fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60297/60297fig4a.jpg" /> 
Figure 4: Image of mouse 3 h post-injection of attenuated strain of P. aeruginosa PGN5+mucE carrying a bioluminescent marker. The bioluminescent bacteria were detectable until 18-24 h following injection. During this period, the bioluminescence remained at the site of injection indicating the bacteria stayed localized to injection site. This mouse fully recovered with no adverse effects. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60297/60297fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection at JoVE.com

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Here, we describe a simple and reproducible protocol of mouse model of infection to evaluate the attenuation of the genetically modified strains of Pseudomonas aeruginosa in comparison to the United States Food and Drug Administration (FDA)-approved Escherichia coli for commercial applications.

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Microorganisms are genetically versatile and diverse and have become a major source of many commercial products and biopharmaceuticals. Though some of ...

generation-frame-gene-deletion-mutants-pseudomonas-aeruginosa-testing

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

6.7K Views.  Progenesis Technologies, LLC. Dit protocol is belangrijk voor het creëren en bepalen van geest-lichaam gewenste mutaties in het genoom van Pseudomonas aeruginosa, evenals het testen van het effect van mutaties op virulentiereductie in een reproduceerbaar muismodel. Het belangrijkste voordeel van deze techniek is een chroomvalidatie en een reproduceerbaarheid van muisinfectiemodel. Bacteriën werken voortdurend, voortdurend veranderen.Om dit proces te vertragen, gebruiken we een bevroren stops, verpakken ze, hangen...

Video: Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

Genetics

Tractable Mammalian Cell Infections with Protozoan-primed Bacteria

Many intracellular bacterial pathogens use freshwater protozoans as a natural reservoir for proliferation in the environment. Legionella pneumophila, the causative agent of Legionnaires' pneumonia, gains a pathogenic advantage over in vitro cultured bacteria when first harvested from protozoan cells prior to infection of mammalian macrophages. This suggests that important virulence factors may not be properly expressed in vitro. We have developed a tractable system for priming L. pneumophila through its natural protozoan host Acanthamoeba castellanii prior to mammalian cell infection. The contribution of any virulence factor can be examined by comparing intracellular growth of a mutant strain to wild-type bacteria after protozoan priming. GFP-expressing wild-type and mutant L. pneumophila strains are used to infect protozoan monolayers in a priming step and allowed to reach late stages of intracellular growth. Fluorescent bacteria are then harvested from these infected cells and normalized by spectrophotometry to generate comparable numbers of bacteria for a subsequent infection into mammalian macrophages. For quantification, live bacteria are monitored after infection using fluorescence microscopy, flow cytometry, and by colony plating. This technique highlights and relies on the contribution of host cell-dependent gene expression by mimicking the environment that would be encountered in a natural acquisition route. This approach can be modified to accommodate any bacterium that uses an intermediary host as a means for gaining a pathogenic advantage.

This technique provides a method to harvest, normalize and quantify intracellular growth of bacterial pathogens that are pre-cultivated in natural protozoan host cells prior to infections of mammalian cells. This method can be modified to accommodate a wide variety of host cells for the priming stage as well as target cell types.

Many intracellular bacterial pathogens use freshwater protozoans as a natural reservoir for proliferation in the environment. Legionella pneumophila, the ...

Following in Real Time the Impact of Pneumococcal Virulence Factors in an Acute Mouse Pneumonia Model Using Bioluminescent Bacteria

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. Despite advances in knowledge of this illness, the availability of intensive care units (ICU), and the use of potent antimicrobial agents and effective vaccines, the mortality rates remain high1. Streptococcus pneumoniae is the leading pathogen of community-acquired pneumonia (CAP) and one of the most common causes of bacteremia in humans. This pathogen is equipped with an armamentarium of surface-exposed adhesins and virulence factors contributing to pneumonia and invasive pneumococcal disease (IPD). The assessment of the in vivo role of bacterial fitness or virulence factors is of utmost importance to unravel S. pneumoniae pathogenicity mechanisms. Murine models of pneumonia, bacteremia, and meningitis are being used to determine the impact of pneumococcal factors at different stages of the infection. Here we describe a protocol to monitor in real-time pneumococcal dissemination in mice after intranasal or intraperitoneal infections with bioluminescent bacteria. The results show the multiplication and dissemination of pneumococci in the lower respiratory tract and blood, which can be visualized and evaluated using an imaging system and the accompanying analysis software.

Streptococcus pneumoniae is the leading pathogen causing severe community-acquired pneumonia and responsible for over 2&#160;million deaths worldwide. The impact of bacterial factors implicated in fitness or virulence can be monitored in real-time in an acute mouse pneumonia or bacteremia model using bioluminescent bacteria.

Pneumonia is one of the major health care problems in developing and industrialized countries and is associated with considerable morbidity and mortality. ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Studying Microbial Communities In Vivo: A Model of Host-mediated Interaction Between Candida Albicans and Pseudomonas Aeruginosa in the Airways

Studying host-pathogen interaction enables us to understand the underlying mechanisms of the pathogenicity during microbial infection. The prognosis of the host depends on the involvement of an adapted immune response against the pathogen1. Immune response is complex and results from interaction of the pathogens and several immune or non-immune cellular types2. In vitro studies cannot characterise these interactions and focus on cell-pathogen interactions. Moreover, in the airway3, particularly in patients with suppurative chronic lung disease or in mechanically ventilated patients, polymicrobial communities are present and complicate host-pathogen interaction. Pseudomonas aeruginosa and Candida albicans are both problem pathogens4, frequently isolated from tracheobronchial samples, and associated to severe infections, especially in intensive care unit5. Microbial interactions have been reported between these pathogens in vitro but the clinical impact of these interactions remains unclear6. To study the interactions between C. albicans and P. aeruginosa, a murine model of C. albicans airways colonization, followed by a P. aeruginosa-mediated acute lung infection was performed.

Studying Microbial Communities In Vivo: A Model of Host-mediated Interaction Between Candida Albicans and Pseudomonas Aeruginosa in the Airways

While in vitro study of host-pathogen interactions allow the characterization of specific immune responses, in vivo models are required to observe the effects of complex responses. Using Candida albicans exposure followed by Pseudomonas aeruginosa-mediated lung infection, we established a murine model of microbial interactions involved in ventilator-associated pneumonia pathogenicity.

Studying host-pathogen interaction enables us to understand the underlying mechanisms of the pathogenicity during microbial infection. The prognosis of ...

A Non-invasive and Technically Non-intensive Method for Induction and Phenotyping of Experimental Bacterial Pneumonia in Mice

Although community-acquired pneumonia remains a major public health problem, murine models of bacterial pneumonia have recently facilitated significant preclinical advances in our understanding of the underlying cellular and molecular pathogenesis. In vivo mouse models capture the integrated physiology and resilience of the host defense response in a manner not revealed by alternative, simplified ex vivo approaches. Several methods have been described in the literature for intrapulmonary inoculation of bacteria in mice, including aerosolization, intranasal delivery, peroral endotracheal cannulation under &#39;blind&#39; and visualized conditions, and transcutaneous endotracheal cannulation. All methods have relative merits and limitations. Herein, we describe in detail a non-invasive, technically non-intensive, inexpensive, and rapid method for intratracheal delivery of bacteria that involves aspiration (i.e., inhalation) by the mouse of an infectious inoculum pipetted into the oropharynx while under general anesthesia. This method can be used for pulmonary delivery of a wide variety of non-caustic biological and chemical agents, and is relatively easy to learn, even for laboratories with minimal prior experience with pulmonary procedures. In addition to describing the aspiration pneumonia method, we also provide step-by-step procedures for assaying the subsequent in vivo pulmonary innate immune response of the mouse, in particular, methods for quantifying bacterial clearance and the cellular immune response of the infected airway. This integrated and simple approach to pneumonia assessment allows for rapid and robust evaluation of the effect of genetic and environmental manipulations upon pulmonary innate immunity.

Several methods have been described in the literature for modeling bacterial pneumonia in mice. Herein, we describe a non-invasive, inexpensive, rapid method for inducing pneumonia via aspiration (i.e., inhalation) of a bacterial inoculum pipetted into the oropharynx. Downstream methods for assessment of the pulmonary innate immune response are also detailed.

Although community-acquired pneumonia remains a major public health problem, murine models of bacterial pneumonia have recently facilitated significant ...

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or A. baumannii

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, preferably in models which mimic the intended clinical indication. A method for inducing robust lung infections in immunocompetent rats and mice is described which allows for the assessment of treatments in a model of serious pneumonia caused by S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae or A. baumannii. Animals are anesthetized, and an agar-based inoculum is deposited deep into the lung via nonsurgical intratracheal intubation. The resulting infection is consistent, reproducible, and stable for at least 48 h and up to 96 h for most isolates. Studies with marketed antibacterials have demonstrated good correlation between in vivo efficacy and in vitro susceptibility, and concordance between pharmacokinetic/pharmacodynamic targets determined in this model and clinically accepted targets has been observed. Although there is an initial time investment when learning the technique, it can be performed quickly and efficiently once proficiency is achieved. Benefits of the model include elimination of the neutropenic requirement, increased robustness and reproducibility, ability to study more pathogens and isolates, improved flexibility in study design and establishment of a challenging infection in an immunocompetent host.

A Robust Pneumonia Model in Immunocompetent Rodents to Evaluate Antibacterial Efficacy against S. pneumoniae, H. influenzae, K. pneumoniae, P. aeruginosa or  A. baumannii

A method for establishing lung infections in immunocompetent rodents is described. With proficiency, this method can be performed quickly and easily to induce stable infection with many isolates of S. pneumoniae, H. influenzae, P. aeruginosa, K. pneumoniae and A. baumannii.

Efficacy of candidate antibacterial treatments must be demonstrated in animal models of infection as part of the discovery and development process, ...

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa is able to form biofilms, develop antibiotic resistance, produce virulence factors, and rapidly evolve in the course of a chronic infection. Thus P. aeruginosa can cause both acute and chronic, difficult to treat infections, resulting in significant morbidity in certain patient populations. P. aeruginosa strain PA14 is a human clinical isolate with a conserved genome structure that infects a variety of mammalian and nonvertebrate hosts making PA14 an attractive strain for studying this pathogen. In 2006, a nonredundant transposon insertion mutant library containing 5,459 mutants corresponding to 4,596 predicted PA14 genes was generated. Since then, distribution of the PA14 library has allowed the research community to better understand the function of individual genes and complex pathways of P. aeruginosa. Maintenance of library integrity through the replication process requires proper handling and precise techniques. To that end, this manuscript presents protocols that describe in detail the steps involved in library replication, library quality control and proper storage of individual mutants.

Replication of the Ordered, Nonredundant Library of Pseudomonas aeruginosa strain PA14 Transposon Insertion Mutants

Pseudomonas aeruginosa infection causes significant morbidity in vulnerable hosts. The nonredundant transposon insertion mutant library of P. aeruginosa strain PA14, designated as PA14NR Set, facilitates analysis of gene functionality in numerous processes. Presented here is a protocol to generate high-quality copies of the PA14NR Set mutant library.

Pseudomonas aeruginosa is a phenotypically and genotypically diverse and adaptable Gram-negative bacterium ubiquitous in human environments. P. aeruginosa ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

A Delayed Inoculation Model of Chronic Pseudomonas aeruginosa Wound Infection

Pseudomonas aeruginosa (P. aeruginosa) is a major nosocomial pathogen of increasing relevance to human health and disease, particularly in the setting of chronic wound infections in diabetic and hospitalized patients. There is an urgent need for chronic infection models to aid in the investigation of wound pathogenesis and the development of new therapies against this pathogen. Here, we describe a protocol that uses delayed inoculation 24 hours after full-thickness excisional wounding. The infection of the provisional wound matrix present at this time forestalls either rapid clearance or dissemination of infection and instead establishes chronic infection lasting 7&#8211;10 days without the need for implantation of foreign materials or immune suppression. This protocol mimics a typical temporal course of post-operative infection in humans. The use of a luminescent P. aeruginosa strain (PAO1:lux) allows for quantitative daily assessment of bacterial burden for P. aeruginosa wound infections. This novel model may be a useful tool in the investigation of bacterial pathogenesis and the development of new therapies for chronic P. aeruginosa wound infections.

A Delayed Inoculation Model of Chronic Pseudomonas aeruginosa Wound Infection

We describe a delayed inoculation protocol for generating chronic wound infections in immunocompetent mice.

Pseudomonas aeruginosa (P. aeruginosa) is a major nosocomial pathogen of increasing relevance to human health and disease, particularly in the setting of ...

Generation of In-Frame Gene Deletion Mutants in Pseudomonas aeruginosa and Testing for Virulence Attenuation in a Simple Mouse Model of Infection

Samenvatting

Meer video's verkennen