The authors would like to thank both Jean-Pierre Baudoin and Olivier Mbarek for their advice and Claire Andr&#233;ani for her help in English corrections and modifications. This work was supported by a grant from the French State managed by the National Research Agency under the &#34;Investissements d&#8217;avenir (Investments for the Future)&#34; program with the reference ANR-10-IAHU-03 (M&#233;diterran&#233;e Infection) and by R&#233;gion Provence Alpes C&#244;te d&#8217;Azur and European funding FEDER PRIMI.

1. Amoeba Culture
<ol>
	<li>Use Vermamoeba vermiformis (strain CDC19) as a cell support.</li>
	<li>Add 30 mL of protease-peptone-yeast extract-glucose medium (PYG) (Table 1) and 3 mL of the amoebae at a concentration of 1 x 106 cells/mL in a 75 cm2 cell culture flask.</li>
	<li>Maintain the culture at 28 &#176;C.</li>
	<li>After 48 h, quantify the amoebae using counting slides.</li>
	<li>To rinse, harvest the cells at a concentration of 1 x 106 cells/mL and pellet the amoebae by centrifugation at 720 x g for 10 min. Remove the supernatant and resuspend the pellet in the appropriate volume of starvation medium to obtain 1 x 106 cells/mL (Table 1).</li>
</ol>
2. Propagation of Stock Virus in Amoebae
NOTE: Before dilution, it is important to culture the stock sample to obtain enough fresh culture, then proceed to filtration.
<ol>
	<li>Use 1 x 106 of amoeba culture in starvation medium.</li>
	<li>Inoculate the mixture of viruses issued from the stock solution (Faustovirus/Usurpativirus LCD7 or Faustovirus/Clandestinovirus ST1) after the co-culture process on the cell support at a multiplicity of infection (MOI)&#160;of 0.01. 
	NOTE: The MOI is important to reduce the abundance of the major viral population and the number of infected cells.</li>
	<li>Incubate at 30 &#176;C until cytopathic effects (CPE) are induced, such as amoebal rounding or lysis, approximately 10 to 14 h after infection.</li>
	<li>Collect the media and filtrate through a 5 &#181;m filter to remove cellular debris.</li>
</ol>
3. End-point dilution
<ol>
	<li>Perform a serial dilution (10-1 to 10-11) of the viral sample in starvation medium (Table 1).</li>
	<li>Inoculate 2 mL of 1 x 106 Vermamoeba vermiformis contained in each Petri dish with 100 &#181;L of the mixture inoculum.</li>
	<li>Place the Petri dishes into a sealable plastic bag at 30 &#176;C.</li>
	<li>Begin observing the Petri dishes with inverted optical microscopy at 6 h postinfection and check cell morphology every 4 to 8 h.</li>
	<li>At the appearance of the cytopathic effect characterized by rounding cells, begin the single cell micro-aspiration process.</li>
</ol>
4. Single Cell Micro-aspiration
<ol>
	<li>Prepare the host. 
	NOTE: This preparation is made for the release of infected single cells to a fresh cell support.
	<ol>
		<li>Treat the amoebae in the culture with an antimicrobial agent containing 10 &#181;g/mL of vancomycin, 10 &#181;g/mL of imipenem, 20 &#181;g/mL of ciprofloxacin, 20 &#181;g/mL of doxycycline, and 20 &#181;g/mL of voriconazole. This mixture is used to avoid bacterial and fungal contamination. 
		NOTE: The procedure takes place on a bench outside the microbiological safety station. Add 2 mL of amoebae concentrated at 1 x 106 cells/mL each into 15 Petri dishes. For amoeba adherence, incubate the culture at 30 &#176;C for 30 min.</li>
	</ol>
	</li>
	<li>Select the Petri dish used for the micro-aspiration from the limit dilution according to the following criteria: 1) absence of any visible contamination by fungal and bacterial agents, 2) evidence of cytopathic effect of amoebae due to the viruses, and 3) prelysis and rounding phase of the amoebae (to avoid aspiration of viral particles).</li>
	<li>Set up a workstation with the following materials (see Figure 1A,B): 
	Micromanipulator, which allows microcapillary positioning; 
	Manual control pressure device, used to aspirate and release the cells into the microcapillary; 
	Inverted microscope; 
	Plug and play motor modules; 
	Camera; 
	Computer module to visualize manipulation and take pictures.</li>
	<li>Choose a microcapillary (see Figure 1C). 
	NOTE: The size of the cells, the deformation and adhesion of their membranes to the surfaces, and the cellular motility can impact the smooth progress of the micro-aspiration. The microcapillary diameter can be precisely chosen and adapted to specific cell types depending on their sizes and methods of aspiration. A microcapillary of 20 &#181;m inner diameter was used to aspirate a rounding amoeba (diameter ~10 &#181;m). This allows the upkeep of an internal position and an easy release of the cell.</li>
	<li>Mount the system.
	<ol>
		<li>Fix the operating angle of the gripping system on the motorized module at 45&#176;.</li>
		<li>Perform a double installation, first on the gripping system, and then on the microcapillary.</li>
		<li>Focus on the cells after running a few drops of oil through the microcapillary. 
		NOTE: The mineral oil with biological compatibility is supplied by the device.</li>
		<li>Complete mounting following manufacturer&#39;s recommendations.</li>
	</ol>
	</li>
	<li>Clone cells (see Figure 2A,B). 
	NOTE: This procedure is similar to the one described by Fr&#246;hlich and K&#246;nig31.
	<ol>
		<li>Place the Petri dish containing 2 mL of infected amoebae under the microscope.</li>
		<li>Focus first on the cells, and then on the microcapillary immersed in the culture.</li>
		<li>Pick a rounded single cell and bring the microcapillary closer to the micromanipulator.</li>
		<li>Exert soft aspiration with manual pressure control on the cell, taking it inside the microcapillary. Remove the single cell from the first sample and release in the cellular support, then incubate it at 30 &#176;C.</li>
		<li>Conduct daily observations with an inverted optical microscope to observe the appearance of the cells and to monitor the emergence of the cytopathic effect.</li>
	</ol>
	</li>
</ol>
5. PCR Screening
NOTE: Following step 4, a systematic screening by PCR is crucial to confirm the separation. In both Usurpativirus/Faustovirus and Clandestinovirus/Faustovirus, the design and application of the specific primer and probe systems were done using Primer-BLAST online32 (Table 2).
<ol>
	<li>Extract DNA from a part of the positive culture samples (i.e., where a cytopathic effect is observed), using an automated extraction system according to the manufacturer&#39;s protocol.</li>
	<li>Use appropriately designed primers. 
	NOTE: Here we designed primers to amplify core genes annotated as RpB2 (Faustovirus), LCD7 major capsid protein (Usurpatvirus) and minor capsid protein (Clandestinovirus)</li>
	<li>Perform standard PCR using a thermocycler.
	<ol>
		<li>Carry out 20 &#181;L PCR reactions with 50 &#181;M of each primer (Table 2), 1x Master Mix, and RNase free water.</li>
		<li>Activate the Taq DNA polymerase for 5 min at 95 &#176;C, then follow with 45 cycles of 10 s denaturation at 95 &#176;C, annealing of the primers for 30 s at 58 &#176;C, and extension for 30 s at 72 &#176;C.</li>
	</ol>
	</li>
	<li>Run the PCR products on a 1.5% agarose gel, stain with DNA gel stain (Table of Materials), and visualize with UV.</li>
</ol>
6. Virus Production and Purification
<ol>
	<li>Put the rest of the Petri dish culture back in a small flask.</li>
	<li>For the virus production, prepare 15 flasks of 145 cm2, containing 40 mL of Vermamoeba vermiformis in starvation medium and 5 mL of the isolated virus already transferred from the Petri dish to small flasks.</li>
	<li>Treat with the same antibiotic and antifungal mixture used in step 4.1.</li>
	<li>Incubate at 30 &#176;C. Observe every day with inverted optical microscopy.</li>
	<li>After the complete infection, pool all flasks. Use a 0.45 &#181;m filter to eliminate debris.</li>
	<li>Ultracentrifuge all supernatants at&#160;50,000 x g for&#160;45 min.</li>
	<li>After centrifugation, remove the supernatant from each tube by aspiration and resuspend the pellet in 1 mL of phosphate buffered saline (PBS).</li>
	<li>Purify the virus produced using 25% sucrose (27.5 g sucrose in 100 mL of PBS, sterilized by filtration).</li>
	<li>Centrifuge 8 mL of sucrose and 2 mL of the viral suspension at&#160;80,000 x g for&#160;30 min. Resuspend the viral pellet in 1 mL of PBS. Store it at -80 &#176;C.</li>
</ol>
7. Negative Staining and Transmission Electron Microscopy
NOTE: Bou Khalil et al. previously published this protocol27.
<ol>
	<li>Deposit 5 &#956;L of the lysis supernatant onto the glow-discharged grid. Leave for approximately 20 min at room temperature. 
	NOTE: The glow-discharge allows us to obtain a hydrophilic grid by plasma application.</li>
	<li>Dry the grid carefully and deposit a small drop of 1% ammonium molybdate on it for 10 s. Leave the grid to dry for 5 min.</li>
	<li>Proceed to electron microscopy observations at 200 keV.</li>
</ol>
8. Characterization of Clandestinovirus ST1 and Usurpativirus LCD7
<ol>
	<li>Characterize pure populations of Clandestinovirus ST1 and Usurpativirus LCD7 using genome sequencing, genome assembly, bioinformatics analyses, and study of their replicative cycle as we have done for other viruses10,20,29.</li>
</ol>

<ol>
	<li>Iyer, L. M., Aravind, L., Koonin, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Common+Origin+of+Four+Diverse+Families+of+Large+Eukaryotic+DNA+Viruses.">Common Origin of Four Diverse Families of Large Eukaryotic DNA Viruses.</a> Journal of Virology. 75 (23), 11720-11734 (2001).</li><li>Li, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+74+kb+of+DNA+located+at+the+right+end+of+the+330-kb+chlorella+virus+PBCV-1+genome.">Analysis of 74 kb of DNA located at the right end of the 330-kb chlorella virus PBCV-1 genome.</a> Virology. 237 (2), 360-377 (1997).</li><li>Scola, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Giant+Virus+in+Amoebae.">A Giant Virus in Amoebae.</a> Science. 299 (5615), 2033 (2003).</li><li>Philippe, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pandoraviruses:+amoeba+viruses+with+genomes+up+to+2.5+Mb+reaching+that+of+parasitic+eukaryotes.">Pandoraviruses: amoeba viruses with genomes up to 2.5 Mb reaching that of parasitic eukaryotes.</a> Science. 341 (6143), 281-286 (2013).</li><li>Antwerpen, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Whole-genome+sequencing+of+a+pandoravirus+isolated+from+keratitis-inducing+acanthamoeba.">Whole-genome sequencing of a pandoravirus isolated from keratitis-inducing acanthamoeba.</a> Genome Announcements. 3 (2), 00136-00215 (2015).</li><li>Legendre, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thirty-thousand-year-old+distant+relative+of+giant+icosahedral+DNA+viruses+with+a+pandoravirus+morphology.">Thirty-thousand-year-old distant relative of giant icosahedral DNA viruses with a pandoravirus morphology.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (11), 4274-4279 (2014).</li><li>Legendre, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In-depth+study+of+Mollivirus+sibericum,+a+new+30,000-y-old+giant+virus+infecting+Acanthamoeba.">In-depth study of Mollivirus sibericum, a new 30,000-y-old giant virus infecting Acanthamoeba.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (38), 5327-5335 (2015).</li><li>Legendre, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diversity+and+evolution+of+the+emerging+Pandoraviridae+family.">Diversity and evolution of the emerging Pandoraviridae family.</a> Nature Communications. 9 (1), 2285 (2018).</li><li>Aherfi, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Large+Open+Pangenome+and+a+Small+Core+Genome+for+Giant+Pandoraviruses.">A Large Open Pangenome and a Small Core Genome for Giant Pandoraviruses.</a> Frontiers in Microbiology. 9, 166 (2018).</li><li>Andreani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cedratvirus,+a+Double-Cork+Structured+Giant+Virus,+is+a+Distant+Relative+of+Pithoviruses.">Cedratvirus, a Double-Cork Structured Giant Virus, is a Distant Relative of Pithoviruses.</a> Viruses. 8 (11), 300 (2016).</li><li>Rodrigues, R. A. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphologic+and+genomic+analyses+of+new+isolates+reveal+a+second+lineage+of+cedratviruses.">Morphologic and genomic analyses of new isolates reveal a second lineage of cedratviruses.</a> Journal of Virology. , 00372 (2018).</li><li>Bertelli, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cedratvirus+lausannensis-+digging+into+Pithoviridaediversity.">Cedratvirus lausannensis- digging into Pithoviridaediversity.</a> Environmental Microbiology. , (2017).</li><li>Levasseur, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+a+modern+and+fossil+Pithovirus+reveals+its+genetic+conservation+and+evolution.">Comparison of a modern and fossil Pithovirus reveals its genetic conservation and evolution.</a> Genome Biology and Evolution. , (2016).</li><li>Dornas, F. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Brazilian+Marseillevirus+Is+the+Founding+Member+of+a+Lineage+in+Family+Marseilleviridae.">A Brazilian Marseillevirus Is the Founding Member of a Lineage in Family Marseilleviridae.</a> Viruses. 8 (3), 76 (2016).</li><li>Yoshikawa, G., Blanc-Mathieu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Medusavirus,+a+novel+large+DNA+virus+discovered+from+hot+spring+water.">Medusavirus, a novel large DNA virus discovered from hot spring water.</a> Journal of Virology. , (2019).</li><li>Legendre, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pandoravirus+Celtis+Illustrates+the+Microevolution+Processes+at+Work+in+the+Giant+Pandoraviridae+Genomes.">Pandoravirus Celtis Illustrates the Microevolution Processes at Work in the Giant Pandoraviridae Genomes.</a> Frontiers in Microbiology. 10, 430 (2019).</li><li>Abrah&#227;o, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tailed+giant+Tupanvirus+possesses+the+most+complete+translational+apparatus+of+the+known+virosphere.">Tailed giant Tupanvirus possesses the most complete translational apparatus of the known virosphere.</a> Nature Communications. 9 (1), 749 (2018).</li><li>Reteno, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Faustovirus,+an+asfarvirus-related+new+lineage+of+giant+viruses+infecting+amoebae.">Faustovirus, an asfarvirus-related new lineage of giant viruses infecting amoebae.</a> Journal of Virology. 89 (13), 6585-6594 (2015).</li><li>Bajrai, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kaumoebavirus,+a+New+Virus+That+Clusters+with+Faustoviruses+and+Asfarviridae.">Kaumoebavirus, a New Virus That Clusters with Faustoviruses and Asfarviridae.</a> Viruses. 8 (12), 278 (2016).</li><li>Andreani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Orpheovirus+IHUMI-LCC2:+A+New+Virus+among+the+Giant+Viruses.">Orpheovirus IHUMI-LCC2: A New Virus among the Giant Viruses.</a> Frontiers in Microbiology. 8, 779 (2018).</li><li>Fischer, M. G., Allen, M. J., Wilson, W. H., Suttle, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Giant+virus+with+a+remarkable+complement+of+genes+infects+marine+zooplankton.">Giant virus with a remarkable complement of genes infects marine zooplankton.</a> Proceedings of the National Academy of Sciences of the United States of America. 107 (45), 19508-19513 (2010).</li><li>Moniruzzaman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+of+brown+tide+virus+(AaV),+the+little+giant+of+the+Megaviridae,+elucidates+NCLDV+genome+expansion+and+host-virus+coevolution.">Genome of brown tide virus (AaV), the little giant of the Megaviridae, elucidates NCLDV genome expansion and host-virus coevolution.</a> Virology. 466-467, 60-70 (2014).</li><li>Gallot-Lavall&#233;e, L., Blanc, G., Claverie, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparative+genomics+of+Chrysochromulina+Ericina+Virus+(CeV)+and+other+microalgae-infecting+large+DNA+viruses+highlight+their+intricate+evolutionary+relationship+with+the+established+Mimiviridae+family.">Comparative genomics of Chrysochromulina Ericina Virus (CeV) and other microalgae-infecting large DNA viruses highlight their intricate evolutionary relationship with the established Mimiviridae family.</a> Journal of Virology. , (2017).</li><li>Deeg, C. M., Chow, C. -. E. T., Suttle, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+kinetoplastid-infecting+Bodo+saltans+virus+(BsV),+a+window+into+the+most+abundant+giant+viruses+in+the+sea.">The kinetoplastid-infecting Bodo saltans virus (BsV), a window into the most abundant giant viruses in the sea.</a> eLife. 7, 235 (2018).</li><li>Boughalmi, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-throughput+isolation+of+giant+viruses+of+the+Mimiviridae+and+Marseilleviridae+families+in+the+Tunisian+environment.">High-throughput isolation of giant viruses of the Mimiviridae and Marseilleviridae families in the Tunisian environment.</a> Environmental Microbiology. 15 (7), 2000-2007 (2013).</li><li>Khalil, J. Y. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Throughput+Isolation+of+Giant+Viruses+in+Liquid+Medium+Using+Automated+Flow+Cytometry+and+Fluorescence+Staining.">High-Throughput Isolation of Giant Viruses in Liquid Medium Using Automated Flow Cytometry and Fluorescence Staining.</a> Frontiers in Microbiology. 7 (120), 26 (2016).</li><li>Bou Khalil, J. Y., Andreani, J., Raoult, D., La Scola, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Rapid+Strategy+for+the+Isolation+of+New+Faustoviruses+from+Environmental+Samples+Using+Vermamoeba+vermiformis.">A Rapid Strategy for the Isolation of New Faustoviruses from Environmental Samples Using Vermamoeba vermiformis.</a> Journal of Visualized Experiments : JoVE. (112), e54104 (2016).</li><li>Khalil, J. Y. B., Andreani, J., La Scola, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Updating+strategies+for+isolating+and+discovering+giant+viruses.">Updating strategies for isolating and discovering giant viruses.</a> Current Opinion in Microbiology. 31, 80-87 (2016).</li><li>Andreani, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pacmanvirus,+a+new+giant+icosahedral+virus+at+the+crossroads+between+Asfarviridae+and+Faustoviruses.">Pacmanvirus, a new giant icosahedral virus at the crossroads between Asfarviridae and Faustoviruses.</a> Journal of Virology. , (2017).</li><li>Khalil, J. Y. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+Cytometry+Sorting+to+Separate+Viable+Giant+Viruses+from+Amoeba+Co-culture+Supernatants.">Flow Cytometry Sorting to Separate Viable Giant Viruses from Amoeba Co-culture Supernatants.</a> Frontiers in Cellular and Infection Microbiology. 6, 17722 (2017).</li><li>Fr&#246;hlich, J., K&#246;nig, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+techniques+for+isolation+of+single+prokaryotic+cells.">New techniques for isolation of single prokaryotic cells.</a> FEMS Microbiology Reviews. 24 (5), 567-572 (2000).</li><li>Ye, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Primer-BLAST:+A+tool+to+design+target-specific+primers+for+polymerase+chain+reaction.">Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction.</a> BMC Bioinformatics. 13 (1), 134 (2012).</li><li>Kimura, Y., Yanagimachi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intracytoplasmic+sperm+injection+in+the+mouse.">Intracytoplasmic sperm injection in the mouse.</a> Biology of Reproduction. 52 (4), 709-720 (1995).</li></ol>

All authors have nothing to disclose.

The duration of the single cell micro-aspiration handling and its good functioning is operator-dependent. The different steps of the experiment require precision. The use of the micromanipulation components of the workstation must be under constant control by observing the process of micro-aspiration and the release of the cell. The follow-up by microscopic observation is necessary for capture and transfer of a cell. An experienced operator can take 1 to 2 h to isolate 10 cells and retransfer them one by one depending on the abundance of viruses to be isolated. The number of manipulations can vary. We advise beginning with 10 manipulations. By definition, we do not know the intrinsic characteristics of the unknown virus. Thus, the use and development of different strategies for isolation are necessary to optimize the success of separating these viruses.
The micro-aspiration process is performed under unsterile conditions (on a bench outside the microbiological safety station) and thus restricts its usage and prevents its application for the study of human pathogens. Therefore, the use of a mixture of antibiotics and antifungals to limit contaminants is mandatory. Another limitation of the method is that it can only be performed on microorganisms observable by light microscopy on which the micromanipulation components were mounted, thus, conceptually eliminating any work on microorganisms not observable by light microscopy. However, we were able to separate giant viruses of about 200 nm which remain invisible under the light microscope by using an indirect strategy consisting of separating and cloning the infected hosts.
The development of single cell micro-aspiration for amoebal capture is a part of the development of population-sorting methods. Single cell micro-aspiration allowed us to isolate two new giant viruses, Clandestinovirus ST1 and Usurpativirus LCD7, with characteristics distinctive from Faustoviruses. The highly similar morphological properties of both Clandestinovirus ST1 and Usurpativirus LCD7 to Faustovirus LCD7 and their difference of replication shows the limit of FACS, which is usually used in giant viruses sorting. It is represented by the superposition of two viral populations, Clandestinovirus ST1 and Faustovirus ST1 (Figure 5A) and also by the detection for Usupartivirus LCD7 and Faustovirus LCD7. However, with this new method, the entire manipulation is under visual control with careful monitoring of the cell and its integrity even after its release. The use of flow cytometry to directly sort infected amoebae could be an alternative solution to indirectly sort novel viruses. This method is usually followed by the screening of the plate in order to detect cytopathic effects or lysis. The presence of non-lytic viruses in the mix could represent a limit to amoebal sorting. However, this was not explored in the creation of this protocol and for these two novel isolations.
Beyond the application of the micromanipulation in the positioning and holding of cells in general and oocytes for intracytoplasmic sperm injection (ICSI)33, single cell micro-aspiration has proven to be a practical method for the isolation of single prokaryotic cells observable under an optical microscope31. Other applications could be tested, including cell sorting on a morphological basis to have different pure samples from a mixed sample of microorganisms. The observable separation of microorganisms can be envisioned using the strategy described above.

Nucleocytoplasmic large DNA viruses (NCLDV) are extremely diverse, defined by four families that infect eukaryotes1. The first described viruses with genomes above 300 kbp were Phydcodnaviridae, including Paramecium bursaria Chlorella virus 1 PBCV12. The isolation and the first description of Mimivirus, showed that the size of viruses doubled in terms of both the size of the particle (450 nm) and the length of the genome (1.2 Mb)3. Since then, many giant viruses have been described, usually isolated using an amoeba co-culture procedure. Several giant viruses with different morphologies and genetic contents can be isolated from Acanthamoeba sp. cells, including Marseilleviruses, Pandoraviruses, Pithoviruses, Mollivirus, Cedratviruses, Pacmanvirus, Tupanvirus, and recently Medusavirus4,5,6,7,8,9,10,11,12,13,14,15,16,17. In parallel, the isolation of Vermamoeba vermiformis allowed the isolation and description of the giant viruses Faustovirus, Kaumoebavirus, and Orpheovirus18,19,20. Other giant viruses were isolated with their host protists, such as Cafeteria roenbergensis21, Aureococcus anophagefferens22, Chrysochromulina ericina23, and Bodo saltans24. All of these isolations were the result of an increasing number of teams working on isolation and the introduction of high throughput strategy updates25,26,27,28, such as the improvement of the co-culture system with the use of flow cytometry.
In 2016, we used a strategy associating co-culture and flow cytometry to isolate giant viruses27. This strategy was developed to increase the number of samples inoculated, to diversify protists used as cell supports, and to quickly detect the lysis of the cell support. The system was updated by adding a supplemental step to avoid preliminary molecular biology identification and quick detection of an unknown viral population as in the case of Pacmanvirus29. Coupling flow cytometry to cell sorting allowed for separation of a mixture of Mimivirus and Cedratvirus A1130. However, we later encountered the limitations of the separation and detection of these viral subpopulations by flow cytometry. After sequencing, when we assembled the genomes of Faustovirus ST125 and Faustovirus LCD7 (unpublished data), we surprisingly found in each assembly two supplemental genomes of two novel viruses not identified in public genome databases. However, neither flow cytometry nor transmission electronic microscopy (TEM) showed that the amoebaes were infected by two different viruses, Clandestinovirus ST1 and Usurpativirus LCD7. We designed specific PCR systems to amplify Faustovirus, Usurpativirus, and Clandestinovirus markers respectively based on their genomes; our purpose was to have PCR-based systems that enable verification of the purity of the viruses being separated. However, end-point dilution and flow cytometry failed to separate them. The isolation of this single viral population was difficult because neither the morphology nor replicative elements of Clandestinovirus and Usurpativirus populations have been characterized. We detected only one viral population by flow cytometry due to the overlapping of the two populations (tested after the effective separation). We tried to separate them using single particle sorting on 96-well plates, but we did not observe any cytopathic effects, and we detected neither Clandestinovirus nor Usurpativirus by PCR amplification. Finally, it was only the combination of end point dilution followed by single amoeba micro-aspiration that enabled separation of these two low-abundance giant viruses from Faustoviruses. This method of separation is the object of this article.

<table><tbody><tr><td>Agarose Standard</td><td>Euromedex</td><td>Unkown</td><td>Standard PCR</td></tr><tr><td>AmpliTaq Gold 360 Master Mix</td><td>Applied Biosystems</td><td>4398876</td><td>Standard PCR</td></tr><tr><td>CellTram 4r Oil</td><td>Eppendorf</td><td>5196000030</td><td>Control the cells during the microaspiration process</td></tr><tr><td>Corning cell culture flasks 150 cm&lt;sup&gt;2&lt;/sup&gt;</td><td>Sigma-aldrich</td><td>CLS430825</td><td>Culture</td></tr><tr><td>Corning cell culture flasks 25 cm&lt;sup&gt;2&lt;/sup&gt;</td><td>Sigma-aldrich</td><td>CLS430639</td><td>Culture</td></tr><tr><td>Corning cell culture flasks 75 cm&lt;sup&gt;2&lt;/sup&gt;</td><td>Sigma-aldrich</td><td>CLS430641</td><td>Culture</td></tr><tr><td>DFC 425C camera</td><td>LEICA</td><td>Unkown</td><td>Observation/Monitoring</td></tr><tr><td>Eclipse TE2000-S Inverted Microscope</td><td>Nikon</td><td>Unkown</td><td>Observation/Monitoring</td></tr><tr><td>EZ1 advanced XL</td><td>Quiagen</td><td>9001874</td><td>DNA extraction</td></tr><tr><td>Glasstic Slide 10 with Counting Grids</td><td>Kova International</td><td>87144E</td><td>Cell count</td></tr><tr><td>Mastercycler nexus</td><td>Eppendorf</td><td>6331000017</td><td>Standard PCR</td></tr><tr><td>Microcapillary 20 &amp;micro;m</td><td>Eppendorf</td><td>5175 107.004</td><td>Microaspiration and release of cells</td></tr><tr><td>Micromanipulator InjectMan NI2</td><td>Eppendorf</td><td>631-0210</td><td>Microcapillary positioning</td></tr><tr><td>Nuclease-Free Water</td><td>ThermoFischer</td><td>AM9920</td><td>Standard PCR</td></tr><tr><td>Optima XPN Ultracentrifuge</td><td>BECKMAN COULTER</td><td>A94469</td><td>Virus purification</td></tr><tr><td>Petri dish 35 mm</td><td>Ibidi</td><td>81158</td><td>Culture/observation</td></tr><tr><td>Sterile syringe filters 5 &amp;micro;m</td><td>Sigma-aldrich</td><td>SLSV025LS</td><td>Filtration</td></tr><tr><td>SYBR green Type I</td><td>Invitrogen</td><td>unknown</td><td>Fluorescent molecular probes/flow cytometry</td></tr><tr><td>SYBR Safe</td><td>Invitrogen</td><td>S33102</td><td>Standard PCR; DNA gel stain</td></tr><tr><td>Tecnai G20</td><td>FEI</td><td>Unkown</td><td>Electron microscopy</td></tr><tr><td>Type 70 Ti Fixed-Angle Titanium Rotor</td><td>BECKMAN COULTER</td><td>337922</td><td>Virus purification</td></tr><tr><td>Ultra-Clear Tube, 25 x 89 mm&lt;sup&gt;2&lt;/sup&gt;</td><td>BECKMAN COULTER</td><td>344058</td><td>Virus purification</td></tr></tbody></table>

single cell micro-aspiration as an alternative strategy to fluorescence-activated cell sorting for giant virus mixture separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Single cell micro-aspiration is a micromanipulation process optimized in this manuscript (Figure 1). This technique enables capture of a rounded, infected amoeba (Figure 2A) and its release in a novel plate containing uninfected amoebae (Figure 2). It is a functional prototype that applies to the co-culture system and has successfully isolated non-lytic giant viruses. This approach was used for the first time in the field of giant viruses and made it possible to isolate two new low-abundance giant viruses. We named the new viruses Clandestinovirus ST1 and Usurpativirus LCD7, that were in low abundance compared to the high abundance Faustoviruses. In order to analyze the viral presence in each plate after the micro-aspiration procedure, we applied PCR on the 15 micro-aspirations. We observed pure Usurpativirus (presence of Usurpativirus LCD7 [+] and absence of Faustovirus [&#8211;]) only in clone 7 (Figure 3). The purity of the clone was confirmed by PCR with specific protocols targeting Clandestinovirus ST1 and Usurpativirus LCD7 (Table 2). Electron microscopy revealed the appearance of Clandestinovirus ST1 and Usurpativirus LCD7 (Figure 4), which have a typical icosahedral morphology without fibrils and an icosahedral capsid of about 250 nm, respectively. After the confirmation of the production purity, the clonal virus was produced and purified for whole genome sequencing and further characterization, especially transmission electronic microscopy (TEM) for multiplication cycle studies. We confirmed the overlapping of populations (Faustovirus/novel virus) by flow cytometry (Figure 5).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/60148/60148fig1v2.jpg" /> 
Figure 1: Materials for micromanipulation. (A) Actual setup of the workstation. (B) Schematic illustration of the workstation&#8217;s components. (C) Schematic illustration of the microcapillary. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60148/60148fig1v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/60148/60148fig2.jpg" /> 
Figure 2: Micro-aspiration steps. (A) Single cell isolation procedure (zoom x40). (B) Schematic illustration of the different steps of single cell aspiration: 1) Localization of the cell. 2) Aspiration of the cell. 3) Release step. The black arrows show the microcapillary and the white ones show the single cell. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60148/60148fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/60148/60148fig3.jpg" /> 
Figure 3: PCR screening and confirmation. Screening PCR of micro-aspirations carried out for Usurpativirus LCD7 and Faustovirus. Presence of Usurpativirus LCD7 DNA (+) and absence of Faustovirus DNA (&#8211;) observed for clone 7 after micro-aspiration procedure. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60148/60148fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/60148/60148fig4.jpg" /> 
Figure 4: Negative staining micrograph. Negative staining of the viral suspension, showing pure Clandestinovirus ST1 (A) and Usurpativirus LCD7 (B). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60148/60148fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/60148/60148fig5.jpg" /> 
Figure 5: Representative gate plots. (A) Superimposition of each single viral population previously stained with fluorescent molecular probes for virus DNA labelling (following previously described protocol26,30). The left part of the picture shows the superposition of five strains of Faustovirus (dark green, light green, orange, red, and blue). On the right, the superposition of Faustovirus ST1 and Clandestinovirus ST1 (light purple and dark purple) is visible. (B) The presence of two viral population of Faustovirus and Usurpativirus in the same gate as Faustovirus (left). &#160;A dot plot of pure Usurpativirus shows the same gate defined previously for Faustovirus (right). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/60148/60148fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>PYG composition</td>
			<td>quantities</td>
		</tr>
		<tr>
			<td>Proteose peptone</td>
			<td>20 g</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>20 g</td>
		</tr>
		<tr>
			<td>MgSO4&#183;7H2O</td>
			<td>0.980 g</td>
		</tr>
		<tr>
			<td>CaCl2</td>
			<td>0.059 g</td>
		</tr>
		<tr>
			<td>Citrate sodium. Dihydrate</td>
			<td>1 g</td>
		</tr>
		<tr>
			<td>Fe (NH4) 2(SO4) 2 x 6H2O</td>
			<td>0.02 g</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>18 g</td>
		</tr>
		<tr>
			<td>Distilled water</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>Adjust pH at 6.8 with HCl or KOH</td>
			<td></td>
		</tr>
		<tr>
			<td>Autoclave 15 min at 121 &#176;C</td>
			<td></td>
		</tr>
		<tr>
			<td>Starvation medium</td>
			<td>quantites</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>2 g</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>18 g</td>
		</tr>
		<tr>
			<td>Fe (NH4) 2(SO4) 2 x 6H2O</td>
			<td>0.02 g</td>
		</tr>
		<tr>
			<td>PAS (detailed below)</td>
			<td>1 L</td>
		</tr>
		<tr>
			<td>PAS solution A</td>
			<td>quantites</td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>0.136 g</td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>0.142 g</td>
		</tr>
		<tr>
			<td>PAS solution B</td>
			<td>quantites</td>
		</tr>
		<tr>
			<td>MgSO4&#183;7H2O</td>
			<td>4.0 mg</td>
		</tr>
		<tr>
			<td>CaCl2&#183;2H2O</td>
			<td>4.0 mg</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>0.120 g</td>
		</tr>
		<tr>
			<td>10 mL each of solution A and B are added into 1 L of distilled water.</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1: Composition of Culture Media.
<table border="1" fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Virus target</td>
			<td>Target gene</td>
			<td>Foward primer (5-&#62;3)</td>
			<td>Reverse primer (5-&#62;3)</td>
		</tr>
		<tr>
			<td>Faustovirus RpB2</td>
			<td>RpB2</td>
			<td>CWCAATCHGCYGATACHGGTGA</td>
			<td>TGATTWGCYAATGGNGCYGC</td>
		</tr>
		<tr>
			<td>Usurpatvirus LCD7 Major capsid gene</td>
			<td>Major capsid gene</td>
			<td>GGGCAAGAAGCTCCAAGCTA</td>
			<td>GGGTTGAGGAGGAGTCAACG</td>
		</tr>
		<tr>
			<td>Clandestinovirus ST1 Minor capsid gene</td>
			<td>Minor capsid gene</td>
			<td>AAAATGAACGCGTTGGAGGC</td>
			<td>ACCGGCGAATGTTCCTATGG</td>
		</tr>
	</tbody>
</table>
Table 2: Primmer Sequences Used for the PCR.

Watch this Scientific Journal Video about Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation at JoVE.com

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...

single-cell-micro-aspiration-as-an-alternative-strategy-to

Nanyang Technological University

Research

JoVE Journal

Biology

7.0K Views.  Institut Hospitalo-Universitaire (IHU) - Méditerranée Infection. Single Cell Micro-Aspiration is een methode om de verschillende technieken die worden gebruikt op het gebied van microbiologie in het algemeen en in de virologie in het bijzonder aan te vullen. Het zou kunnen beantwoorden belangrijke vraag en problemen op te lossen ondervonden tijdens gigantische virussen isolatie door het scheiden van een virus van een virale mengsel presenteren een lage overvloed Virus zoals het geval was voor omzet virussen, clandisinal virus, en uzibati virus van een ande...

Video: Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

Isolation and Genome Analysis of Single Virions using 'Single Virus Genomics'

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which are ubiquitous and the most numerous entities on our planet 4 and important in all environments 5, have yet to be revealed via similar approaches. Here we describe an approach for isolating and characterizing the genomes of single virions called 'Single Virus Genomics' (SVG). SVG utilizes flow cytometry to isolate individual viruses and whole genome amplification to obtain high molecular weight genomic DNA (gDNA) that can be used in subsequent sequencing reactions.

Single Virus Genomics (SVG) is a method to isolate and amplify the genomes of single virons. Viral suspensions of a mixed assemblage are sorted using flow cytometry onto a microscope slide with discrete wells containing agarose, thereby capturing the virion and reducing genome shearing during downstream processing. Whole genome amplification is achieved using multiple displacement amplification (MDA) resulting in genomic material that is suitable for sequencing.

Whole genome amplification and sequencing of single microbial cells enables genomic characterization without the need of cultivation 1-3. Viruses, which ...

Immunology and Infection

A Microfluidic Platform for Precision Small-volume Sample Processing and Its Use to Size Separate Biological Particles with an Acoustic Microdevice

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. However, to achieve robust sample manipulation it is necessary to address device integration with the macroscale environment. To realize repeatable, sensitive particle separation with microfluidic devices, this protocol presents a complete automated and integrated microfluidic platform that enables precise processing of 0.15&#8211;1.5 ml samples using microfluidic devices. Important aspects of this system include modular device layout and robust fixtures resulting in reliable and flexible world to chip connections, and fully-automated fluid handling which accomplishes closed-loop sample collection, system cleaning and priming steps to ensure repeatable operation. Different microfluidic devices can be used interchangeably with this architecture. Here we incorporate an acoustofluidic device, detail its characterization, performance optimization, and demonstrate its use for size-separation of biological samples. By using real-time feedback during separation experiments, sample collection is optimized to conserve and concentrate sample. Although requiring the integration of multiple pieces of equipment, advantages of this architecture include the ability to process unknown samples with no additional system optimization, ease of device replacement, and precise, robust sample processing.

This protocol describes a system architecture for performing automated small volume (0.15&#8211;1.5 ml) particle separations using a microfluidic device, and discusses methods to optimize acoustofluidic device performance and operation.

A major advantage of microfluidic devices is the ability to manipulate small sample volumes, thus reducing reagent waste and preserving precious sample. ...

Bioengineering

Optimization of Flow Cytometric Sorting Parameters for High-Throughput Isolation and Purification of Small Extracellular Vesicles

Small extracellular vesicles (sEV) can be released from all cell types and carry protein, DNA, and RNA. Signaling molecules serve as indicators of the physiological and pathological state of a cell. However, there is no standard method for sEV isolation, which prevents downstream biomarker identification and drug intervention studies. In this article, we provide a detailed protocol for the isolation and purification of 50-200 nm sEV by a flow cell sorter. For this, a 50 &#181;m nozzle and 80 psi sheath fluid pressure were selected to obtain a good sorting rate and stable side stream. Standard sized polystyrene microspheres were used to locate populations of 100, 200, and 300 nm particles. With additional optimization of the voltage, gain, and forward scatter (FSC) triggering threshold, the sEV signal could be separated from the background noise. These optimizations provide a panel of critical sort settings that enables one to obtain a representative population of sEV using FSC vs. side scatter (SSC) only. The flow cytometry-based isolation method not only allows for high-throughput analysis but also allows for synchronous classification or proteome analysis of sEV based on the biomarker expression, opening numerous downstream research applications.

This protocol provides a rapid and size-specific isolation method for small extracellular vesicles by optimizing the size of the air spray nozzle, sheath fluid pressure, sample flow pressure, voltage, gain, and triggering threshold parameters.

Small extracellular vesicles (sEV) can be released from all cell types and carry protein, DNA, and RNA. Signaling molecules serve as indicators of the ...

Biochemistry

Flow Virometry to Analyze Antigenic Spectra of Virions and Extracellular Vesicles

Cells release small extracellular vesicles (EVs) into the surrounding media. Upon virus infection cells also release virions that have the same size of some of the EVs. Both virions and EVs carry proteins of the cells that generated them and are antigenically heterogeneous. In spite of their diversity, both viruses and EVs were characterized predominantly by bulk analysis. Here, we describe an original nanotechnology-based high throughput method that allows the characterization of antigens on individual small particles using regular flow cytometers. Viruses or extracellular vesicles were immunocaptured with 15 nm magnetic nanoparticles (MNPs) coupled to antibodies recognizing one of the surface antigens. The captured virions or vesicles were incubated with fluorescent antibodies against other surface antigens. The resultant complexes were separated on magnetic columns from unbound antibodies and analyzed with conventional flow cytometers triggered on fluorescence. This method has wide applications and can be used to characterize the antigenic composition of any viral- and non-viral small particles generated by cells in vivo and in vitro. Here, we provide examples of the usage of this method to evaluate the distribution of host cell markers on individual HIV-1 particles, to study the maturation of individual Dengue virions (DENV), and to investigate extracellular vesicles released into the bloodstream.

Viruses or extracellular vesicles were immunocaptured with 15 nm magnetic nanoparticles coupled to antibodies recognizing surface antigens. The captured virions or vesicles were labeled with fluorescent antibodies against other surface antigens. The resultant complexes were separated in high magnetic field and analyzed with conventional flow cytometers triggered on fluorescence.

Cells release small extracellular vesicles (EVs) into the surrounding media. Upon virus infection cells also release virions that have the same size of ...

An Ultrahigh-throughput Microfluidic Platform for Single-cell Genome Sequencing

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of cellular heterogeneity in biological systems. However, single-cell sequencing of large populations has been hampered by limitations in processing genomes for sequencing. In this paper, we describe a method for single-cell genome sequencing (SiC-seq) which uses droplet microfluidics to isolate, amplify, and barcode the genomes of single cells. Cell encapsulation in microgels allows the compartmentalized purification and tagmentation of DNA, while a microfluidic merger efficiently pairs each genome with a unique single-cell oligonucleotide barcode, allowing &gt;50,000 single cells to be sequenced per run. The sequencing data is demultiplexed by barcode, generating groups of reads originating from single cells. As a high-throughput and low-bias method of single-cell sequencing, SiC-seq will enable a broader range of genomic studies targeted at diverse cell populations.

Single-cell sequencing reveals genotypic heterogeneity in biological systems, but current technologies lack the throughput necessary for the deep profiling of community composition and function. Here, we describe a microfluidic workflow for sequencing &gt;50,000 single-cell genomes from diverse cell populations.

Sequencing technologies have undergone a paradigm shift from bulk to single-cell resolution in response to an evolving understanding of the role of ...

Purification of High Yield Extracellular Vesicle Preparations Away from Virus

One of the major hurdles in the field of extracellular vesicle (EV) research today is the ability to achieve purified EV preparations in a viral infection setting. The presented method is meant to isolate EVs away from virions (i.e., HIV-1), allowing for a higher efficiency and yield compared to conventional ultracentrifugation methods. Our protocol contains three steps: EV precipitation, density gradient separation, and particle capture. Downstream assays (i.e., Western blot, and PCR) can be run directly following particle capture. This method is advantageous over other isolation methods (i.e., ultracentrifugation) as it allows for the use of minimal starting volumes. Furthermore, it is more user friendly than alternative EV isolation methods requiring multiple ultracentrifugation steps. However, the presented method is limited in its scope of functional EV assays as it is difficult to elute intact EVs from our particles. Furthermore, this method is tailored towards a strictly research-based setting and would not be commercially viable.

This protocol isolates extracellular vesicles (EVs) away from virions with high efficiency and yield by incorporating EV precipitation, density gradient ultracentrifugation, and particle capture to allow for a streamlined workflow and a reduction of starting volume requirements, resulting in reproducible preparations for use in all EV research.

One of the major hurdles in the field of extracellular vesicle (EV) research today is the ability to achieve purified EV preparations in a viral infection ...

Microfluidic Device for Continuous Extracellular Vesicle Isolation from Human Urine

Single Step Isolation of Extracellular Vesicles from Large-Volume Samples with a Bifurcated A4F Microfluidic Device

Extracellular vesicles (EVs) hold immense potential for various biomedical applications, including diagnostics, drug delivery, and regenerative medicine. Nevertheless, the current methodologies for isolating EVs present significant challenges, such as complexity, time consumption, and the need for bulky equipment, which hinders their clinical translation. To address these limitations, we aimed to develop an innovative microfluidic system based on cyclic olefin copolymer-off-stoichiometry thiol-ene (COC-OSTE) for the efficient isolation of EVs from large-volume samples in a continuous manner. By utilizing size and buoyancy-based separation, the technology used in this study achieved a significantly narrower size distribution compared to existing approaches from urine and cell media samples, enabling the targeting of specific EV size fractions in future applications. Our innovative COC-OSTE microfluidic device design, utilizing bifurcated asymmetric flow field-flow fractionation technology, offers a straightforward and continuous EV isolation approach for large-volume samples. Furthermore, the potential for mass manufacturing of this microfluidic device offers scalability and consistency, making it feasible to integrate EV isolation into routine clinical diagnostics and industrial processes, where high consistency and throughput are essential requirements.

Author Spotlight: Asymmetric Field Flow Fractionation for Bioreactor Integration

Extracellular vesicles hold immense promise for biomedical applications, but current isolation methods are time-consuming and impractical for clinical use. In this study, we present a microfluidic device that enables the direct isolation of extracellular vesicles from large volumes of biofluids in a continuous manner with minimal steps.

Extracellular vesicles (EVs) hold immense potential for various biomedical applications, including diagnostics, drug delivery, and regenerative medicine. ...

Sample Preparation for Single Virion Atomic Force Microscopy and Super-resolution Fluorescence Imaging

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule imaging assays which allows adhesion of single virions to glass surfaces with specificity. This preparation is based on grafting the surface of the glass with a mixture of PLL-g-PEG and PLL-g-PEG-Biotin, adding a layer of avidin, and finally creating virion anchors through attachment of biotinylated virus specific antibodies. We have applied this technique across a range of experiments including atomic force microscopy (AFM) and super-resolution fluorescence imaging. This sample preparation method results in a control adhesion of the virions to the surface.

The attachment of virions to a surface is a requirement for single virion imaging by Super-resolution fluorescence imaging or atomic force microscopy (AFM). Here we demonstrate a sample preparation method for controlled adhesion of virions to glass surfaces suitable for use in AFM and super-resolution fluorescence imaging.

Immobilization of virions to glass surfaces is a critical step in single virion imaging. Here we present a technique&#160;adopted from single molecule ...

Analysis of SARS-CoV-2 Using Dual-Reporter and Multiplex Technology

Profiling of Surface Protein Epitopes on Viral Particles by Multiplex Dual-Reporter Strategy

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of viral particles to host cells, host-virus interactions, and disease pathogenesis. Furthermore, viral membrane proteins on virus particles and presented on host cell surfaces have proven to be excellent targets for antivirals and vaccines. Here, we describe a protocol to investigate surface proteins on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) particles using the dual-reporter flow cytometric system. The assay exploits multiplex technology to obtain a triple detection of viral particles by three independent affinity reactions. Magnetic beads conjugated to recombinant human angiotensin-converting enzyme-2 (ACE2) were used to capture viral particles from the supernatant of cells infected with SARS-CoV-2. Then, two detection reagents labeled with R-phycoerythrin (PE) or Brilliant Violet 421 (BV421) were applied simultaneously. As a proof-of-concept, antibody fragments targeting different epitopes of the SARS-CoV-2 surface protein Spike (S1) were used. The detection of viral particles by three independent affinity reactions provides strong specificity and confirms the capture of intact virus particles. Dose-dependency curves of SARS-CoV-2 infected cell supernatant were generated with replicate coefficient variances (mean/SD) &#706;14%. Good assay performance in both channels confirmed that two virus surface target protein epitopes are detectable in parallel. The protocol described here could be applied for (i) high-multiplex, high-throughput profiling of surface proteins expressed on enveloped viruses; ii) detection of active intact viral particles; and (iii) assessment of specificity and affinity of antibodies and antiviral drugs for surface epitopes of viral antigens.The application can be potentially extended to any type of extracellular vesicles and bioparticles, exposing surface antigens in body fluids or other liquid matrices.

Author Spotlight: Advancing Antiviral Strategies Through Novel Immunocapture and Mass Spectrometry Techniques

Here, we describe a newly developed multiplex fluorescent immunoassay that uses a dual-reporter flow cytometric system to concurrently detect two unique spike protein epitopes on intact severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) viral particles that had been captured by angiotensin-converting enzyme-2-coupled magnetic microspheres.

Membrane proteins on enveloped viruses play an important role in many biological functions involving virus attachment to target cell receptors, fusion of ...

Fluorescence-Based Sorting of Adipose-Derived Extracellular Vesicles

Setting a Successful Sorting for Extracellular Vesicle Isolation

Extracellular vesicles (EVs) released by mesenchymal stromal cells (MSCs) contain a set of microRNAs with regenerative and anti-inflammatory roles. Therefore, purified MSC-EVs are envisioned as a next-generation therapeutic option for a wide array of diseases. In this protocol, we report the strategy for successfully sorting EVs from the supernatant of adipose-derived MSCs (ASCs), often used in orthopedics regenerative medicine applications.
First, we described the sample preparation, focusing on EV isolation and labeling steps with carboxyfluorescein succinimidyl ester (CFSE) for fluorescence detection; subsequently, we detailed the sorting process, which constitutes the main part of the protocol. 
In addition to the rules defined by MISEV 2023 and MIFlowCyt EV guidelines, we applied specific experimental conditions concerning nozzle size, frequency, and sheath pressure. Morphological parameters are established using beads of diameters selected to cover the theoretical range of EV size. After ASC-EVs sorting, we performed a purity check of the sorted fraction by re-analyzing it with the sorter and verifying the EV size distribution with the nanoparticle tracking analysis technique.
Due to the increasing importance of EVs, having a pure population to study and characterize is becoming crucial. Here, we demonstrate a winner strategy to set up sorting to achieve this goal.

This protocol provides a detailed description of sorting extracellular vesicles (EVs) released by mesenchymal stromal cells. In particular, it focuses on the instrument setting and the optimization of the sorting conditions. The goal is to sort extracellular vesicles while preserving their characteristics.

Extracellular vesicles (EVs) released by mesenchymal stromal cells (MSCs) contain a set of microRNAs with regenerative and anti-inflammatory roles. ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

Samenvatting

Meer video's verkennen