Name: purification of a high molecular mass protein in streptococcus mutans
Uploaded: 2019-09-14T14:00:00.000+00:00
Duration: 9 min 51 s
Description: Watch this Scientific Journal Video about Purification of a High Molecular Mass Protein in Streptococcus mutans at JoVE.com

This work was supported by the Japan Society for the Promotion of Science (JSPS) (grant numbers 16K15860 and 19K10471 to T. M., 17K12032 to M. I., and 18K09926 to N. H.) and the SECOM Science and Technology Foundation (SECOM) (grant number 2018.09.10 No. 1).

NOTE: Generation of S. mutans &#8710;gtfC, in which the entire coding region of the gtfC gene is replaced with spcr, must be completed prior to performing these protocols. Refer to the published article for details on generation5.
1. Primer design
<ol>
	<li>Prepare primers for the construction of S. mutans His-gtfC. 
	NOTE: The primer sequences used in this protocol are shown in Table 1. Two-step fusion PCR method for the generation of S. mutans His-gtfC is schematically illustrated in Figure 2.
	<ol>
		<li>Design primers (gtfC-reverse and spcr-forward) for the attachment of His-tag-coding sequence, intervening between the gtfC gene and spcr (Figure 2A).
		<ol>
			<li>Include GS linker and His-tag-coding sequence into both gtfC-reverse and spcr-forward primers, in which 24 bases at the 5&#8217; regions are complementary to each other. 
			NOTE: The amino acid sequence of the GS linker and His-tag (Gly-Gly-Gly-Gly-Ser-His-His-His-His-His-His) is attached to the C-terminus of GTF-SI through gene translation.</li>
			<li>Design a gtfC-forward primer to target the gtfC gene in the S. mutans WT genome &#62;1 kb downstream of the gene and the spcr-reverse primer to target the downstream flanking region of spcr in the S. mutans &#8710;gtfC. Set the melting temperature8 (Tm) of the gtfC-forward and spcr-reverse primers to match with the melting temperatures of the gtfC-reverse and spcr-forward primers, respectively.</li>
		</ol>
		</li>
		<li>Design nested primers (nested-forward and nested-reverse) for the second PCR (Figure 2B).</li>
		<li>Design primers (gtfC-forward and colony-reverse) specific for the genomic DNA of the transformant (Figure 2C; the primers are used for colony PCR). 
		NOTE: The amplicons straddle the border between gtfC and spcr. The gtfC-forward primer can be applied as the forward primer.</li>
		<li>Design primers (up-forward and down-reverse) for final confirmation of the generation of S. mutans His-gtfC (Figure 2C; the PCR product amplified by the primers is used for DNA sequencing).</li>
	</ol>
	</li>
</ol>
2. Genomic DNA Extraction from S. mutans
NOTE: Each S. mutans strain should be cultured in brain heart infusion (BHI) medium at 37 &#176;C under anaerobic conditions. The mutant strains of S. mutans &#8710;gtfC and S. mutans His-gtfC are cultured in BHI supplemented with 100 &#181;g/mL spectinomycin.
<ol>
	<li>Streak S. mutans WT and S. mutans &#8710;gtfC separately onto each of the BHI agar plates. Incubate them overnight at 37 &#176;C.</li>
	<li>Pick single colonies of S. mutans WT or S. mutans &#8710;gtfC using a sterilized toothpick and inoculate into 1.5 mL of BHI broth. Incubate them overnight at 37 &#176;C. 
	NOTE: The colonies may be used as a source of template DNA for the first PCR (step 3.1).</li>
	<li>Transfer 1 mL of each bacterial culture to a 1.5 mL microcentrifuge tube. Centrifuge the culture for 1 min at 15,000 x g.</li>
	<li>Remove the supernatant and add 1 mL of the Tris-EDTA buffer (pH 8.0) to resuspend the cell pellet.</li>
	<li>Centrifuge the suspension for 1 min at 15,000 x g. Remove the supernatant. Resuspend the cell pellet in 50 &#181;L of Tris-EDTA buffer (pH 8.0).</li>
	<li>Heat the suspension using a block incubator for 5 min at 95 &#176;C. Centrifuge the suspension for 5 min at 15,000 x g.</li>
	<li>Transfer the supernatant to a new 1.5 mL microcentrifuge tube (the supernatant will serve as template DNA for the first PCR).</li>
</ol>
3. PCR Amplification
NOTE: Table 1, Table 2, and Table 3 summarize the PCR primers, reagents, and amplification cycles, respectively.
<ol>
	<li>Perform the first PCR using the S. mutans WT and S. mutans &#8710;gtfC genome as the PCR templates. Amplify the regions harboring the downstream part of the gtfC gene and those harboring spcr using the primers described in step 1.1.1.2 (Figure 2A).</li>
	<li>Electrophorese each PCR product on 1% agarose gel. Excise the desired DNA fragments of approximately 1,000 bp and 2,000 bp. Purify the fragments from the gels using silica membrane-based gel extraction method. 
	NOTE: The basic procedures for PCR9, DNA gel electrophoresis10, and DNA purification11 are detailed elsewhere.</li>
	<li>Perform a second PCR using the products of the first PCR (approximately equimolar) as PCR templates with the nested-forward and nested-reverse primers (Figure 2B).</li>
	<li>Electrophorese one-tenth of the PCR mixture on the agarose gel. Confirm the generation of the appropriate amplicon of approximately 3,000 bp.</li>
	<li>Precipitate the remaining PCR product. 
	NOTE: Purification of the PCR product is not necessary, because non-specific amplicons generated by the second PCR do not interfere with homologous recombination.
	<ol>
		<li>Add nuclease-free water to the PCR mixture and bring the total volume to 100 &#181;L, followed by 0.1 volume (10 &#181;L) of 3 M sodium acetate (pH 5.2) and 2.5 volumes (250 &#181;L) of absolute ethanol. Mix and store the mixture for 10 min at room temperature (RT).</li>
		<li>Centrifuge the sample for 20 min at 15,000 x g at 4 &#176;C. Discard the supernatant. Add 1 mL of 70% ethanol to wash the DNA pellet.</li>
		<li>Centrifuge the sample for 5 min at 15,000 x g at 4 &#176;C. Discard the supernatant. Air-dry and dissolve the DNA pellet with 10 &#181;L of nuclease-free water.</li>
	</ol>
	</li>
</ol>
4. Cell Transformation
<ol>
	<li>Prepare competent S. mutans WT to introduce the second PCR product by following the steps described in the previous publication5. Store the cells at -80 &#176;C. 
	NOTE: For this experiment, the competent S. mutans WT cells have already been preserved in -80 &#176;C to generate S. mutans &#8710;gtfC.</li>
	<li>Mix 5 &#956;L of the concentrated second PCR product to the 50 &#956;L aliquot of ice-cold competent cells frozen previously. Add the mixture into electroporation cuvettes. Give a single electric pulse (1.8 kV, 2.5 ms, 600 &#937;, 10 &#181;F) to the cells using the electroporation apparatus.</li>
	<li>Resuspend the cells in 500 &#956;L of BHI broth. Immediately, spread 10&#8211;100 &#956;L of the suspension onto BHI agar plates containing spectinomycin. Incubate the plates for 2&#8211;6 days at 37 &#176;C until colonies have grown sufficiently to be picked up.</li>
</ol>
5. Verification of Genome Recombination and Storage
<ol>
	<li>Perform colony PCR, using gtfC-forward and colony-reverse primers to screen for the recombination. Electrophorese each colony PCR product on an agarose gel. Confirm the DNA fragment of approximately 1,500 bp.</li>
	<li>Pick one of the positive colonies using a sterilized toothpick and subculture the cells overnight in 2 mL of BHI broth containing spectinomycin.</li>
	<li>Mix 0.8 mL of bacterial culture with 0.8 mL of sterile 50% glycerol and stock at -80 &#176;C or -20 &#176;C.</li>
	<li>Transfer the remaining 1 mL of cell suspension to a 1.5 mL microcentrifuge tube. Repeat steps 2.3&#8211;2.7 to extract the genomic DNA from the cells.</li>
	<li>Perform PCR using the up-forward and down-reverse primers and genomic DNA as a template. Repeat step 3.2 to purify the amplified DNA product from the gels.</li>
	<li>Determine the DNA sequence of the purified amplicon by DNA sequencing. 
	NOTE: Make sure to confirm the generation of S. mutans His-gtfC by DNA sequencing.</li>
</ol>
6. Purification of Polyhistidine-tagged GTF-SI
<ol>
	<li>Streak S. mutans His-gtfC onto a spectinomycin-containing BHI agar plate. Incubate them overnight at 37 &#176;C.</li>
	<li>Pick up a single colony using a sterilized toothpick and subculture cells in 3 mL of BHI broth. Incubate overnight at 37 &#176;C.</li>
	<li>Prepare two conical flasks with 1 L of BHI broth without spectinomycin. Inoculate 1 mL of the overnight culture suspension into 1 L of the BHI broth. Incubate overnight at 37 &#176;C.</li>
	<li>Concentrate proteins from the culture supernatant by ammonium sulfate precipitation. 
	NOTE: Extract from cell bodies if a target protein is intracellular. The basic procedures for ammonium sulfate precipitation are detailed elsewhere12.
	<ol>
		<li>Centrifuge the bacterial culture suspension for 20 min at 10,000 x g at 4 &#176;C. Recover the culture supernatant into a 3 L glass beaker.</li>
		<li>Add 1,122 g of ammonium sulfate to 2 L of the supernatant (80% saturation) with vigorous stirring using a magnetic stirrer. Allow the precipitate to form for 4 h or more at 4 &#176;C with stirring. 
		NOTE: The precipitate formation can be continued overnight.</li>
		<li>Centrifuge the ammonium sulfate-precipitated solution at 15,000 x g for 20 min at 4 &#176;C. Decant the supernatant.</li>
		<li>Collect the precipitate with a spatula and transfer into a 200 mL glass beaker. Resuspend the pellets in 35 mL of binding buffer (50 mM NaH2PO4, 300 mM NaCl, 5 mM imidazole, pH 8.0).</li>
		<li>Dialyze the suspension against 2,500 mL of the binding buffer using a regenerated cellulose dialysis tubing, at 4 &#176;C, with stirring. Replace the dialysis solution after 2 h and continue dialysis overnight.</li>
		<li>Replace the dialysis solution again. Continue to dialyze for an additional 2 h.</li>
	</ol>
	</li>
	<li>Centrifuge the dialyzed suspension at 20,000 x g for 10 min at 4 &#176;C. Filter the supernatant through a membrane filter using suction filtration equipment. Transfer the filtrate to a 75 cm2 flask.</li>
	<li>Fractionate the polyhistidine-tagged GTF-SI from the filtrated suspension by immobilized metal affinity chromatography (IMAC).
	<ol>
		<li>Transfer 2 mL of the Ni-charged IMAC resin slurry (approximately 1 mL of resin) to a chromatographic column whose outlet is fitted to a silicone tube. Remove the storage solution by the gravity flow. 
		CAUTION: Do not allow the resin to dry out throughout the IMAC.</li>
		<li>Add 3 mL of distilled water into the column to wash the resin. Add 5 mL of the binding buffer to equilibrate the resin.</li>
		<li>Shut off the flow with a Hoffmann pinch cock. Add 5 mL of the filtered suspension from step 6.5 to make the slurry.</li>
		<li>Add all the slurry to the remaining filtered suspension. Swirl the mixture gently for 30 min at 4 &#176;C.</li>
		<li>Load the mixture back on the column. Remove the suspension by the gravity flow. Wash the IMAC resin with 20 mL of binding buffer. 
		NOTE: Adjust the flow rate to approximately 2 mL/min with a Hoffmann pinch cock throughout the subsequent IMAC.</li>
		<li>Elute the recombinant GTF-SI with 20 mL of the elution buffer (50 mM NaH2PO4, 300 mM NaCl, 500 mM imidazole, pH 8.0). 
		NOTE: The protocol can be paused here. The eluate should be stored at 4 &#176;C. IMAC resin can be reused. Refer to the instructions for the IMAC resin.</li>
	</ol>
	</li>
	<li>Replace the elution buffer with the storage buffer (50 mM phosphate buffer, pH 6.5) and concentrate the recombinant GTF-SI solution to approximately 1 mL using a centrifugal ultrafiltration unit. Store the recombinant GTF-SI solution at 4 &#176;C. 
	NOTE: Confirm the polyhistidine-tagged GTF-SI purification using SDS-PAGE13 and western blotting14 by employing a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Addition of CHAPS (final concentration, 0.1%) to the eluent may be required to avoid nonspecific adsorption to the unit, depending on the target protein.</li>
</ol>
7. Functional Restoration by Recombinant GTF-SI
<ol>
	<li>Streak each S. mutans strain onto a BHI agar plate individually. Incubate the plates overnight at 37 &#176;C.</li>
	<li>Using a sterilized toothpick, pick up a single colony to inoculate into 2 mL of BHI broth. Incubate overnight at 37 &#176;C.</li>
	<li>Use 20 &#956;L of the overnight culture of S. mutans &#8710;gtfC to inoculate 2 mL of BHI broth containing 1% sucrose without antibiotics in a glass test tube. Add the GTF-SI or an equivalent volume of the vehicle to the S. mutans &#8710;gtfC culture, and culture the cells with the tube placed in an inclined position overnight. 
	NOTE: Sterilize the GTF-SI solution with a sterile syringe filter and determine protein concentration using a bicinchoninic acid protein assay15 before use.</li>
	<li>Agitate the culture suspensions with a vortex mixer for 10 s. Decant the suspensions. Wash the test tubes with a sufficient amount of distilled water.</li>
	<li>Stain the biofilms on the tube wall with 1 mL of 0.25% Coomassie brilliant blue (CBB).</li>
	<li>Decant the staining solution after 1 min. Wash the test tubes with a sufficient amount of distilled water. Air-dry the test tubes.</li>
</ol>

<ol>
	<li>Sambrook, J., Russell, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Cloning: A Laboratory Manual 3rd Edition. , (2001).</li><li>Murata, T., Ishikawa, M., Shibuya, K., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Method+for+functional+analysis+of+a+gene+of+interest+in+Streptococcus+mutans:+gene+disruption+followed+by+purification+of+a+polyhistidine-tagged+gene+product.">Method for functional analysis of a gene of interest in Streptococcus mutans: gene disruption followed by purification of a polyhistidine-tagged gene product.</a> Journal of Microbiological Methods. 155, 49-54 (2018).</li><li>Horton, R. M., Cai, Z., Ho, S. M., Pease, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+splicing+by+overlap+extension:+tailor-made+genes+using+the+polymerase+chain+reaction.">Gene splicing by overlap extension: tailor-made genes using the polymerase chain reaction.</a> Biotechniques. 54 (3), 129-133 (2013).</li><li>Murata, T., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Contribution+of+chloride+channel+permease+to+fluoride+resistance+in+Streptococcus+mutans.">Contribution of chloride channel permease to fluoride resistance in Streptococcus mutans.</a> FEMS Microbiology Letters. 363 (11), 101 (2016).</li><li>Murata, T., Okada, A., Matin, K., Hanada, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+a+gene-disrupted+Streptococcus+mutans+strain+without+gene+cloning.">Generation of a gene-disrupted Streptococcus mutans strain without gene cloning.</a> Journal of Visualized Experiments. (128), (2017).</li><li>Hanada, N., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+and+characterization+of+the+Streptococcus+mutansgtfC+gene,+coding+for+synthesis+of+both+soluble+and+insoluble+glucans.">Isolation and characterization of the Streptococcus mutansgtfC gene, coding for synthesis of both soluble and insoluble glucans.</a> Infection and Immunity. 56 (8), 1999-2005 (1988).</li><li>LeBlanc, D. J., Lee, L. N., Inamine, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+nucleotide+base+sequence+analysis+of+a+spectinomycin+adenyltransferase+AAD(9)+determinant+from+Enterococcus+faecalis.">Cloning and nucleotide base sequence analysis of a spectinomycin adenyltransferase AAD(9) determinant from Enterococcus faecalis.</a> Antimicrobial Agents and Chemotherapy. 35 (9), 1804-1810 (1991).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+chain+reaction:+basic+protocol+plus+troubleshooting+and+optimization+strategies.">Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies.</a> Journal of Visualized Experiments. (63), e3998 (2012).</li><li>Database, J. S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR:+The+Polymerase+Chain+Reaction.">PCR: The Polymerase Chain Reaction.</a> Journal of Visualized Experiments. , (2019).</li><li>Database, J. S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+Gel+Electrophoresis.">DNA Gel Electrophoresis.</a> Journal of Visualized Experiments. , (2019).</li><li>Database, J. S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gel+Purification.">Gel Purification.</a> Journal of Visualized Experiments. , (2019).</li><li>Wingfield, P. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+precipitation+using+ammonium+sulfate.">Protein precipitation using ammonium sulfate.</a> Current Protocols in Protein Science. 84 (1), (2016).</li><li>Database, J. S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separating+Protein+with+SDS-PAGE.">Separating Protein with SDS-PAGE.</a> Journal of Visualized Experiments. , (2019).</li><li>Database, J. S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Western+Blot.">The Western Blot.</a> Journal of Visualized Experiments. , (2019).</li><li>Smith, P. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measurement+of+protein+using+bicinchoninic+acid.">Measurement of protein using bicinchoninic acid.</a> Analytical Biochemistry. 150 (1), 76-85 (1985).</li><li>Perry, D., Wondrack, L. M., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+putative+cariogenic+properties+in+Streptococcus+mutans.">Genetic transformation of putative cariogenic properties in Streptococcus mutans.</a> Infection and Immunology. 41 (2), 722-727 (1983).</li><li>Lau, P. C., Sung, C. K., Lee, J. H., Morrison, D. A., Cvitkovitch, D. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+ligation+mutagenesis+in+transformable+streptococci:+application+and+efficiency.">PCR ligation mutagenesis in transformable streptococci: application and efficiency.</a> Journal of Microbiological Methods. 49 (2), 193-205 (2002).</li><li>Ge, X., Xu, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+gene+deletions+in+Streptococcus+sanguinis+by+high+throughput+PCR.">Genome-wide gene deletions in Streptococcus sanguinis by high throughput PCR.</a> Journal of Visualized Experiments. (69), (2012).</li></ol>

The authors have nothing to disclose.

The design of primers is the most critical step in the protocol. The sequences of the gtfC-reverse and spcr-forward primers were automatically determined based on the sequences of both the 3&#8242; end region of gtfC and the 5&#8242; end region of spcr. Each primer includes 24 complementary bases that encode a GS linker and a His-tag-coding sequence at their 5&#39; regions. Disruption of the native regulatory sequences located in the upstream flanking regions can be avoided by the addition of His-tag-coding sequences to the 3&#8242; end. The DNA stop codon must be removed from the gtfC-reverse primer and added to the spcr-forward primer. Moreover, the gtfC-forward and spcr-reverse should be designed to amplify flanking regions of approximately 1 kb upstream and downstream of the target region of homologous recombination in the S. mutans WT genome, respectively. Addition of long flanking sequences improves the efficiency of homologous recombination. The nested primers were designed to be used instead of the outermost primer pair (gtfC-forward and spcr-reverse) in this protocol. Inclusion of nested primers is required for the second PCR, as detailed elsewhere5.
Transformation by electroporation is efficient1 and procedures for competent cell preparation preceding electroporation are also much simpler compared to the alternative methods16,17,18, although an electroporation apparatus is required. It is strongly recommended to prepare competent S. mutans WT anew in case of missing colonies on the plate after electroporation. Although incubation for a couple of hours after electroporation may improve transformation efficiency, the extra incubation does not affect success of the transformation. Cells in the log growth phase should be used for the competent cell preparation, as described previously5.
Since the amount of recombinant protein depends on the native expression of the gene, scale-up culture may be required in cases of proteins with lower expression.The method presented here is limited by the application of the functional restoration assay. The addition of gene of interest cannot be applied to intracellular proteins exogenously. However, the developed method presents considerable advantages in terms of facility, efficiency, and cost (e.g., no enzymatic reactions other than PCR) when working with the extracellular target protein. Additionally, the purification of the recombinant protein and confirmation of actual gene expression can be performed simply using common His-tag applications, as shown in Figure 5.
The present method, including gene disruption and gene product isolation, may be adapted for future use in other species as serial experiments for the functional analysis of a gene of interest.

Analysis of a gene&#39;s function usually involves comparison of phenotypic traits of wild-type strains to strains in which the gene of interest has been disrupted.Once the gene-disrupted strain is produced, exogenous addition of the gene product allows functional restoration.
The most common method for obtaining purified gene products required for subsequent restoration assays is by performing heterologous expression in Escherichia coli1. However, the expression of membrane proteins or high molecular mass proteins is often difficult using this system1. In these cases, the target protein is usually isolated from the cells that natively synthesizes the protein through a complex series of steps, which may lead to loss of the gene product. To overcome these issues, a simple procedure has been developed for gene product purification following a gene disruption method2, PCR-based DNA splicing method3&#160;(designated two-step fusion PCR), and electroporation for genetic transformation in Streptococcus mutans. Addition of a polyhistidine tag (His-tag) to the C-terminus of the gene product facilitates its purification by immobilized metal affinity chromatography (IMAC).
To isolate the His-tag-expressing strain, the entire genomic DNA of the gene of interest (in this His-tag-expressing gene-disrupted strain) is replaced with an antibiotic-resistant marker gene. The procedure for generating the His-tag-expressing strainis nearly identical to that for generating a gene-disrupted strain as described previously4,5. Therefore, the methods for gene disruption and gene product isolation should be performed as serial experiments for the functional analysis.
In the present work, a polyhistidine-coding sequence is attached to the 3&#8242; end of the gtfC (GenBank locus tag SMU_1005) gene, encoding glucosyltransferase-SI (GTF-SI) in S. mutans6. Then, expression studies in a streptococcal species were performed. Achieving heterologous gtfC expression by E. coli is difficult, likely because of the high molecular mass of GTF-SI. This strain is named S. mutans His-gtfC. A schematic illustration depicting the organization of the gtfC and spectinomycin resistance gene cassette (spcr)7 loci in wild-type S. mutans (S. mutans WT) and its derivatives is shown in Figure 1. The GTF-SI is a secretory protein that contributes to the development of cariogenic dental biofilm6. Under the presence of sucrose, an adherent biofilm is observed on a smooth glass surface in WT S. mutans strain but not in the S. mutans gtfC-disrupted strain (S. mutans &#916;gtfC)2,5. Biofilm formation is restored in S. mutans &#916;gtfC upon exogenous addition of the recombinant GTF-SI. The strain, S. mutans His-gtfC, is then used to produce the recombinant GTF-SI.

<table><tbody><tr><td>Agarose</td><td>Nippon Genetics</td><td>NE-AG02</td><td>For agarose gel electrophoresis</td></tr><tr><td>Anaeropack</td><td>Mitsubishi Gas Chemical</td><td>A-03</td><td>Anaerobic culture system</td></tr><tr><td>Anti-His-Tag monoclonal antibody</td><td>MBL</td><td>D291-7</td><td>HRP-conjugated</td></tr><tr><td>BCA protein assay kit</td><td>Thermo Fisher Scientific</td><td>23227</td><td>Measurement of protein concentration</td></tr><tr><td>Brain heart infusion broth</td><td>Becton, Dickinson</td><td>237500</td><td>Bacterial culture medium</td></tr><tr><td>CBB R-250</td><td>Wako</td><td>031-17922</td><td>For biofilm staining</td></tr><tr><td>Centrifugal ultrafiltration unit</td><td>Sartorius</td><td>VS2032</td><td>Buffer replacement and protein concentration</td></tr><tr><td>Centrifuge</td><td>Kubota</td><td>7780II</td><td></td></tr><tr><td>Chromatographic column</td><td>Bio-Rad</td><td>7321010</td><td>For IMAC</td></tr><tr><td>Dialysis membrane clamp</td><td>Fisher brand</td><td>21-153-100</td><td></td></tr><tr><td>Dialysis tubing</td><td>As One</td><td>2-316-06</td><td></td></tr><tr><td>DNA polymerase</td><td>Takara</td><td>R045A</td><td>High-fidelity DNA polymerase</td></tr><tr><td>DNA sequencing</td><td>Eurofins Genomics</td><td></td><td></td></tr><tr><td>ECL substrate</td><td>Bio-Rad</td><td>170-5060</td><td>For western blotting</td></tr><tr><td>EDTA (0.5 M pH 8.0)</td><td>Wako</td><td>311-90075</td><td>Tris-EDTA buffer preparation</td></tr><tr><td>Electroporation cuvette</td><td>Bio-Rad</td><td>1652086</td><td>0.2 cm gap</td></tr><tr><td>Electroporator</td><td>Bio-Rad</td><td>1652100</td><td></td></tr><tr><td>EtBr solution</td><td>Nippon Gene</td><td>315-90051</td><td>For agarose gel electrophoresis</td></tr><tr><td>Gel band cutter</td><td>Nippon Genetics</td><td>FG-830</td><td></td></tr><tr><td>Gel extraction kit</td><td>Nippon Genetics</td><td>FG-91202</td><td>DNA extraction from agarose gel</td></tr><tr><td>Imager</td><td>GE Healthcare</td><td>29083461</td><td>For SDS-PAGE and western blotting</td></tr><tr><td>Imidazole</td><td>Wako</td><td>095-00015</td><td>Binding buffer and elution buffer preparation</td></tr><tr><td>Incubator</td><td>Nippon Medical &amp;amp; Chemical Instruments</td><td>EZ-022</td><td>Temperature setting: 4 &amp;deg;C</td></tr><tr><td>Incubator</td><td>Nippon Medical &amp;amp; Chemical Instruments</td><td>LH-100-RDS</td><td>Temperature setting: 37 &amp;deg;C</td></tr><tr><td>Membrane filter</td><td>Merck Millipore</td><td>JGWP04700</td><td>0.2 &amp;micro;m diameter</td></tr><tr><td>Microcentrifuge</td><td>Kubota</td><td>3740</td><td></td></tr><tr><td>NaCl</td><td>Wako</td><td>191-01665</td><td>Preparation of binding buffer and elution buffer</td></tr><tr><td>NaH&lt;sub&gt;2&lt;/sub&gt;PO&lt;sub&gt;4&lt;/sub&gt;&amp;middot;2H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Wako</td><td>192-02815</td><td>Preparation of binding buffer and elution buffer</td></tr><tr><td>NaOH</td><td>Wako</td><td>198-13765</td><td>Preparation of binding buffer and elution buffer</td></tr><tr><td>(NH&lt;sub&gt;4&lt;/sub&gt;)&lt;sub&gt;2&lt;/sub&gt;SO&lt;sub&gt;4&lt;/sub&gt;</td><td>Wako</td><td>015-06737</td><td>Ammonium sulfate precipitation</td></tr><tr><td>Ni-charged resin</td><td>Bio-Rad</td><td>1560133</td><td>For IMAC</td></tr><tr><td>PCR primers</td><td>Eurofins Genomics</td><td>Custom-ordered</td><td></td></tr><tr><td>Protein standard</td><td>Bio-Rad</td><td>161-0381</td><td>For SDS-PAGE and western blotting</td></tr><tr><td>Solvent filtration apparatus</td><td>As One</td><td>FH-1G</td><td></td></tr><tr><td>Spectinomycin</td><td>Wako</td><td>195-11531</td><td>Antibiotics; use at 100 &amp;mu;g/mL</td></tr><tr><td>Sterile syringe filter</td><td>Merckmillipore</td><td>SLGV004SL</td><td>0.22 &amp;micro;m diameter</td></tr><tr><td>&lt;em&gt;Streptococus mutans&lt;/em&gt; &amp;#916;&lt;em&gt;gtfC&lt;/em&gt;</td><td>Stock strain in the lab.</td><td></td><td>&lt;em&gt;gtfC&lt;/em&gt; replaced with &lt;em&gt;spc&lt;sup&gt;r&lt;/sup&gt;&lt;/em&gt;</td></tr><tr><td>&lt;em&gt;Streptococus mutans&lt;/em&gt; UA159</td><td>Stock strain in the lab.</td><td></td><td>&lt;em&gt;S. mutans&lt;/em&gt; ATCC 700610, Wild-type strain</td></tr><tr><td>Sucrose</td><td>Wako</td><td>196-00015</td><td>For biofilm development</td></tr><tr><td>TAE (50 &amp;times; )</td><td>Nippon Gene</td><td>313-90035</td><td>For agarose gel electrophoresis</td></tr><tr><td>Thermal cycler</td><td>Bio-Rad</td><td>PTC-200</td><td></td></tr><tr><td>Tris-HCl (1 M, pH 8.0)</td><td>Wako</td><td>314-90065</td><td>Tris-EDTA buffer preparation</td></tr></tbody></table>

purification of a high molecular mass protein in streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has been disrupted. Loss of function following gene disruption is subsequently restored by exogenous addition of the product of the disrupted gene. This helps to determine the function of the gene. A method previously described involves generating a gtfC gene-disrupted Streptococcus mutans strain. Here, an undemanding method is described for purifying the gtfC gene product from the newly generated S. mutans strain following the gene disruption. It involves the addition of a polyhistidine-coding sequence at the 3&#8242; end of the gene of interest, which allows simple purification of the gene product using immobilized metal affinity chromatography. No enzymatic reactions other than PCR are required for the genetic modification in this method. The restoration of the gene product by exogenous addition after gene disruption is an efficient method for determining gene function, which may also be adapted to different species.

Figure 3 shows the size of each amplicon from the first PCR (Figure 3A) and second PCR (Figure 3B). The size of each amplicon corresponded with the predicted size, as described in Table 1. Figure 4A shows S. mutans colonies transformed with the second PCR product and plated on the BHI agar plates containing spectinomycin. Colony PCR products were then run on the agarose gel (Figure 4B). Each amplicon was of the predicted size, as described in Table 1. Figure 5 shows images of SDS-PAGE and western blot. Protein purified with IMAC was observed as a single band by SDS-PAGE (Figure 5A). Western blot was performed using the anti-polyhistidine antibody to confirm that the observed band was the expected polyhistidine-tagged protein (Figure 5B) of 160 kDa. Figure 6 shows the sucrose-derived biofilm-forming ability of each S. mutans strain. Only S. mutans WT and S. mutans His-gtfC could form an adherent biofilm on the tube wall in the presence of 1% sucrose. This was not observed in S. mutans &#916;gtfC (Figure 6A). However, the addition of the recombinant GTF-SI restored the adherent biofilm formation ability in S. mutans &#916;gtfC (Figure 6B).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59804/59804fig1.jpg" /> 
Figure 1: Organization of gtfC and spcr loci in the S. mutans UA159 genome and its derivatives. A schematic illustration of the His-tag between gtfC and spcr. The lengths of the genes and gaps are not to scale. Shaded pentagon: SMU_1004; solid pentagon: SMU_1006. This figure has been modified from a previous publication2. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59804/59804fig2.jpg" /> 
Figure 2: Strategy for two-step fusion PCR. A schematic illustration of S. mutans His-gtfC construction. The lengths of the genes and gaps are not to scale. The primer-binding sites in the template are indicated by patterns. (A) The regions harboring part of the gtfC gene in the S. mutans WT genome and harboring spcr in the S. mutans &#916;gtfC genome were amplified using the first PCR. (B) The second PCR was performed with nested primers using the two fragments that were amplified by the first PCR as templates, and a DNA construct for homologous recombination was obtained. (C) The mutant strain was generated upon homologous recombination in the bacteria. This figure has been modified from a previous publication2. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59804/59804fig3.jpg" /> 
Figure 3: Agarose gel electrophoresis of first and second PCR products. (A) Products of the first PCR of a part of gtfC (gtfC; left image) and the region harboring spcr (spcr; right image) are shown. The single electrophoretic image is divided to label the marker bands. (B) The second PCR products amplified with the nested primers are shown. Each arrowhead indicates the predicted size of each PCR product. M = molecular marker. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59804/59804fig4.jpg" /> 
Figure 4: Colony PCR to screen generation of S. mutans His-gtfC. (A) S. mutans colonies transformed by the second PCR product are shown. Colony ID is indicated by circled numbers. (B)&#160;Agarose gel electrophoresis of the colony PCR products is shown. Circled lane number corresponds to the colony ID in Figure 4A. M = molecular marker. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/59804/59804fig5.jpg" /> 
Figure 5: Confirmation of polyhistidine-tagged GTF-SI purification. (A) Representative SDS-PAGE image is shown. (B) Representative western blot image is shown. A nitrocellulose membrane on which GTF-SI was transferred was probed with a horseradish peroxidase-conjugated anti-polyhistidine monoclonal antibody. Immunoreactive bands were visualized using a chemiluminescence reaction. The arrowheads indicate the predicted size of the recombinant GTF-SI. M: molecular marker; 1 = sample prior to IMAC; 2 = sample obtained by IMAC. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/59804/59804fig6.jpg" /> 
Figure 6: Functional restoration by addition of the recombinant GTF-SI. (A) The ability of sucrose-derived adherent biofilm formation is shown for each S. mutans strain. (B) The ability of forming adherent biofilms was restored in S. mutans &#916;gtfC by addition of recombinant GTF-SI (25 &#181;g). WT =&#160;S. mutans WT; &#916;gtfC =&#160;S. mutans &#916;gtfC; His-gtfC =&#160;S. mutans His-gtfC. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59804/59804fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer pairs</td>
			<td colspan="3">Sequence (5&#8242; to 3&#8242;)</td>
			<td>Expected band size (bp)</td>
		</tr>
		<tr>
			<td>1st PCR</td>
			<td colspan="3"></td>
			<td></td>
		</tr>
		<tr>
			<td>gtfC-forward 
			gtfC-reverse A,B</td>
			<td colspan="3">TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC 
			ATGATGATGATGATGACTACCACCACCTCCAAATCTAAAGAAATTGTCAA</td>
			<td>1,090</td>
		</tr>
		<tr>
			<td>spcr-forward A,C 
			 
			spcr-reverse</td>
			<td colspan="3">GGTGGTAGTCATCATCATCATCATCATTAAATCGATTTTCGTTCGTGAAT 
			TTAAGAGCAAGTTTAAGATAGAACATGTTACTCAC</td>
			<td>2,232</td>
		</tr>
		<tr>
			<td>2nd PCR</td>
			<td colspan="3"></td>
			<td></td>
		</tr>
		<tr>
			<td>Nested-forward 
			Nested-reverse</td>
			<td colspan="3">TGGTATTATTTCGATAATAACGGTTATATGGTCAC 
			GCCATACTTAGAGAAATTTCTTTGCTAAATTCTTG</td>
			<td>3,179</td>
		</tr>
		<tr>
			<td>Verification of recombination</td>
			<td colspan="3"></td>
			<td></td>
		</tr>
		<tr>
			<td>Colony PCR</td>
			<td colspan="3"></td>
			<td></td>
		</tr>
		<tr>
			<td>gtfC-forward 
			Colony-reverse</td>
			<td colspan="3">TAAAGGTTATGTTTATTATTCAACGAGTGGTAACC 
			CCACTCTCAACTCCTGATCCAAACATGTAAGTACC</td>
			<td>1,482</td>
		</tr>
		<tr>
			<td>Final verification</td>
			<td colspan="3"></td>
			<td></td>
		</tr>
		<tr>
			<td>Up-forward 
			Down-reverse</td>
			<td colspan="3">TACGGCCGTATCAGTTATTACGATGCTAACTCTGG 
			TTGTCCACTTTGAAGTCAACGTCTTGCAAGGCATG</td>
			<td>6,173</td>
		</tr>
	</tbody>
</table>
Table 1: Primers used in the protocol.&#160;AThe underlined sequences of &#39;gtfC-reverse and spcr-forward&#39; are complementary, and the bold-typed sequencescode for the His-tag (gtfC-reverse; ATGATGATGATGATG, spcr-forward; CATCATCATCATCATCAT) and GS linker (gtfC-reverse; ACTACCACCACCTCC, spcr-forward; GGTGGTAGT).&#160;BThe DNA stop codon of gtfC has been removed.&#160;CA DNA stop codon (TAA) has been added immediately after the polyhistidine-coding sequences.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Reagent</td>
			<td>Concentration of stock solution</td>
			<td>Volume</td>
			<td>Final concentration</td>
		</tr>
		<tr>
			<td>DNA polymerase premix</td>
			<td>2x</td>
			<td>25 &#956;L</td>
			<td>1x</td>
		</tr>
		<tr>
			<td>Forward primer</td>
			<td>5 &#181;M</td>
			<td>2 &#956;L</td>
			<td>0.2 &#181;M</td>
		</tr>
		<tr>
			<td>Reverse primer</td>
			<td>5 &#181;M</td>
			<td>2 &#956;L</td>
			<td>0.2 &#181;M</td>
		</tr>
		<tr>
			<td>Template DNA</td>
			<td>Variable</td>
			<td>Variable</td>
			<td>Variable</td>
		</tr>
		<tr>
			<td>Deionized water</td>
			<td>-</td>
			<td>Up to 50 &#956;L</td>
			<td>-</td>
		</tr>
	</tbody>
</table>
Table 2: PCR reagents: For the first PCR, 2 &#181;L of the DNA template was added. For the second PCR, 0.5-2 &#181;L of first PCR amplicon was added to the reaction mixture. For colony PCR, bacterial cells were directly added to the reaction mixture.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Step</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Number of cycles</td>
		</tr>
		<tr>
			<td>Initial denaturation</td>
			<td>98 &#176;C</td>
			<td>2 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation 
			Annealing 
			Extension</td>
			<td>98 &#176;C 
			50 &#176;C 
			72 &#176;C</td>
			<td>10 s 
			5 s 
			Amplicon-dependent 
			(1 min/1 kbp)</td>
			<td>35</td>
		</tr>
		<tr>
			<td>Final extension</td>
			<td>72 &#176;C</td>
			<td>Amplicon-dependent 
			(1 min/1 kbp)</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 3: PCR amplification cycles.

Watch this Scientific Journal Video about Purification of a High Molecular Mass Protein in Streptococcus mutans at JoVE.com

Purification of a High Molecular Mass Protein in Streptococcus mutans

Described here is a simple method for the purification of a gene product in Streptococcus mutans. This technique may be advantageous in the purification of proteins, especially membrane proteins and high molecular mass proteins, and can be used with various other bacterial species.

Purification of a High Molecular Mass Protein in Streptococcus mutans

Elucidation of a gene&#39;s function typically involves comparison of phenotypic traits of wild-type strains and strains in which the gene of interest has ...

purification-of-a-high-molecular-mass-protein-in-streptococcus-mutans

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

5.8K Views.  Tsurumi University School of Dental Medicine. Deze methode kan helpen bij het beantwoorden van belangrijke vragen in de microbiologie veld, zoals, hoe een gen product dat moeilijk uit te drukken in E.Coli zuivert. De belangrijkste voordelen van deze techniek zijn dat geen enzymatische reactie, andere dan PCR, is de drager, en gemeenschappelijke toepassingen voor eiwitzuivering kan worden gebruikt. Hoewel deze methode inzicht kan geven in eiwitzuivering in streptokokken mutans, kan het ook een op de hoogte zijn van andere microbiota soort...

Video: Purification of a High Molecular Mass Protein in Streptococcus mutans

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Genetics

Au-Interaction of Slp1 Polymers and Monolayer from Lysinibacillus sphaericus JG-B53 - QCM-D, ICP-MS and AFM as Tools for Biomolecule-metal Studies

In this publication the gold sorption behavior of surface layer (S-layer) proteins (Slp1) of Lysinibacillus sphaericus JG-B53 is described. These biomolecules arrange in paracrystalline two-dimensional arrays on surfaces, bind metals, and are thus interesting for several biotechnical applications, such as biosorptive materials for the removal or recovery of different elements from the environment and industrial processes. The deposition of Au(0) nanoparticles on S-layers, either by S-layer directed synthesis 1 or adsorption of nanoparticles, opens new possibilities for diverse sensory applications. Although numerous studies have described the biosorptive properties of S-layers 2-5, a deeper understanding of protein-protein and protein-metal interaction still remains challenging. In the following study, inductively coupled mass spectrometry (ICP-MS) was used for the detection of metal sorption by suspended S-layers. This was correlated to measurements of quartz crystal microbalance with dissipation monitoring (QCM-D), which allows the online detection of proteinaceous monolayer formation and metal deposition, and thus, a more detailed understanding on metal binding.
The ICP-MS results indicated that the binding of Au(III) to the suspended S-layer polymers is pH dependent. The maximum binding of Au(III) was obtained at pH 4.0. The QCM-D investigations enabled the detection of Au(III) sorption as well as the deposition of Au(0)-NPs in real-time during the in situ experiments. Further, this method allowed studying the influence of metal binding on the protein lattice stability of Slp1. Structural properties and protein layer stability could be visualized directly after QCM-D experiment using atomic force microscopy (AFM). In conclusion, the combination of these different methods provides a deeper understanding of metal binding by bacterial S-layer proteins in suspension or as monolayers on either bacterial cells or recrystallized surfaces.

Au-Interaction of Slp1 Polymers and Monolayer from Lysinibacillus sphaericus JG-B53 - QCM-D, ICP-MS and AFM as Tools for Biomolecule-metal Studies

To obtain basic information on the sorption and recycling of gold from aqueous systems the interaction of Au(III) and Au(0) nanoparticles on S-layer proteins were investigated. The sorption of protein polymers was investigated by ICP-MS and that of proteinaceous monolayers by QCM-D. Subsequent AFM enables the imaging of the nanostructures.

In this publication the gold sorption behavior of surface layer (S-layer) proteins (Slp1) of Lysinibacillus sphaericus JG-B53 is described. These ...

Chemistry

Membrane-SPINE: A Biochemical Tool to Identify Protein-protein Interactions of Membrane Proteins In Vivo

Membrane proteins are essential for cell viability and are therefore important therapeutic targets1-3. Since they function in complexes4, methods to identify and characterize their interactions are necessary5. To this end, we developed the Membrane Strep-protein interaction experiment, called Membrane-SPINE6. This technique combines in vivo cross-linking using the reversible cross-linker formaldehyde with affinity purification of a Strep-tagged membrane bait protein. During the procedure, cross-linked prey proteins are co-purified with the membrane bait protein and subsequently separated by boiling. Hence, two major tasks can be executed when analyzing protein-protein interactions (PPIs) of membrane proteins using Membrane-SPINE: first, the confirmation of a proposed interaction partner by immunoblotting, and second, the identification of new interaction partners by mass spectrometry analysis. Moreover, even low affinity, transient PPIs are detectable by this technique. Finally, Membrane-SPINE is adaptable to almost any cell type, making it applicable as a powerful screening tool to identify PPIs of membrane proteins.

Membrane-SPINE: A Biochemical Tool to Identify Protein-protein Interactions of Membrane Proteins In Vivo

A biochemical approach is described to identify in vivo protein-protein interactions (PPI) of membrane proteins. The method combines protein cross-linking, affinity purification and mass spectrometry, and is adaptable to almost any cell type or organism. With this approach, even the identification of transient PPIs becomes possible.

Membrane proteins are essential for cell viability and are therefore important therapeutic targets1-3. Since they function in complexes4, methods to ...

Bioengineering

Recombinant Production of Bifidobacterial Endoglycosidases for N-glycan Release

Protein glycosylation is a diverse and common post-translational modification that has been associated with many important roles such as protein function, including protein folding, stability, enzymatic protection, and biological recognition. N-glycans attached to glycoproteins (such as lactoferrin, lactadherin, and immunoglobulins) cannot be digested by the host and reach the large intestine, where they are consumed by certain beneficial microbes. Therefore, they are considered next-generation prebiotic compounds that can selectively stimulate the gut microbiome's beneficial microorganisms. However, the isolation of these new classes of prebiotics requires novel enzymes. Here, we describe the recombinant production of novel glycosidases from different Bifidobacteria strains (isolated from infants, rabbits, chicken, and bumblebee) for improved N-glycan isolation from glycoproteins. The method presented in this study includes the following steps: molecular cloning of Bifidobacterial genes by an in vivo recombinational cloning strategy, control of transformation success, protein induction, and protein purification.

Recombinant Production of Bifidobacterial Endoglycosidases for N-glycan Release

Bifidobacteria possess a unique genomic capability for N-glycan cleavage. Recombinantly producing these enzymes would be a promising novel tool to release bioactive N-glycans from glycoprotein-rich substrates such as colostrum.

Protein glycosylation is a diverse and common post-translational modification that has been associated with many important roles such as protein function, ...

Biochemistry

Purification of the M. magneticum Strain AMB-1 Magnetosome Associated Protein MamA&Delta;41

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is believed to aid their search for suitable environments (1). This capability is conferred by the magnetosome, a subcellular organelle that consists of a linear-chain assembly of lipid vesicles each able to biomineralize and enclose a ~50-nm crystal of magnetite or greigite. A principle component of the magnetosome that was shown to be required for the formation of functional vesicles is MamA. MamA is a highly abundant magnetosome-associated protein which is one of the most characterized magnetosome-associated proteins in vivo (2-6). This article focuses on the purification of MamA, which despite being studied in vivo, no clear functional or structural details have been identified for it. Bioinformatics analysis suggested that MamA is a tetra-tricopeptide repeat (TPR) containing protein. TPR is a structural motif found as such or forming part of a bigger fold in a wide range of proteins, it serves as a template for protein-protein interactions and mediates multi-protein complexes (7). TPRs are involved in many crucial tasks in eukaryotic cell organelle processes and many bacterial pathways (8-14). In order to understand MamA, a unique TPR containing protein, highly purified protein is required as a first step. In this article, we present the purification protocol for a stable MamA deletion mutant (MamA&Delta;41) from M. magneticum AMB-1.

MamA is a unique Magnetosome associated protein which was shown to be involved in magnetosome activation. Here we present the purification protocol of MamA deletion mutant (MamA&Delta;41) from M. magneticum AMB-1.

Magnetotactic bacteria comprise a diverse group of aquatic microorganisms that are able to orientate themselves along geomagnetic fields. This behavior is ...

Biology

Bacterial Expression and Purification of Human Matrix Metalloproteinase-3 using Affinity Chromatography

Matrix metalloproteinases (MMPs) belong to the family of metzincin proteases with central roles in extracellular matrix (ECM) degradation and remodeling, as well as interactions with several growth factors and cytokines. Overexpression of specific MMPs is responsible in several diseases such as cancer, neurodegenerative diseases, and cardiovascular disease. MMPs have been the center of attention recently as targets to develop therapeutics that can treat diseases correlated to MMP overexpression.
To study the MMP mechanism in solution, more facile and robust recombinant protein expression and purification methods are needed for the production of active, soluble MMPs. However, the catalytic domain of most MMPs cannot be expressed in Escherichia coli (E. coli) in soluble form due to lack of posttranslational machinery, whereas mammalian expression systems are usually costly and have lower yields. MMP inclusion bodies must undergo the tedious and laborious process of extensive purification and refolding, significantly reducing the yield of MMPs in native conformation. This paper presents a protocol using Rosetta2(DE3)pLysS (hereafter referred to as R2DP) cells to produce matrix metalloproteinase-3 catalytic domain (MMP-3cd), which contains an N-terminal His-tag followed by pro-domain (Hisx6-pro-MMP-3cd) for use in affinity purification. R2DP cells enhance the expression of eukaryotic proteins through a chloramphenicol-resistant plasmid containing codons normally rare in bacterial expression systems. Compared to the traditional cell line of choice for recombinant protein expression, BL21(DE3), purification using this new strain improved the yield of purified Hisx6-pro-MMP-3cd. Upon activation and desalting, the pro domain is cleaved along with the N-terminal His-tag, providing active MMP-3cd for immediate use in countless in vitro applications. This method does not require expensive equipment or complex fusion proteins and describes rapid production of recombinant human MMPs in bacteria.

His-tag purification, dialysis, and activation are employed to increase yields of soluble, active matrix metalloproteinase-3 catalytic domain protein expression in bacteria. Protein fractions are analyzed via SDS-PAGE gels.

Matrix metalloproteinases (MMPs) belong to the family of metzincin proteases with central roles in extracellular matrix (ECM) degradation and remodeling, ...

Nonspecific Proteolysis-Based Glycomics Strategy for Bacterial Glycoproteins

Protein glycosylation is one of the most common and complex post-translational modifications. Many techniques have been developed to characterize the specific roles of glycans, the relationship between their structures and their impact on the functions of proteins. A common method for glycan analysis is to employ exoglycosidase cleavage to release N-linked glycans from glycoproteins or glycopeptides using Peptide-N-Glycosidase F (PNGase F). However, the glycan-protein linkages in bacteria are different and there is no enzyme available to release glycans from bacterial glycoproteins. In addition, free glycans have also been described in mammalian cells, bacteria, yeast, plants, and fish. In this article, we present a method that can characterize the N-linked glycosylation system in Campylobacter jejuni by detecting asparagine (Asn)-linked and free glycans that are not attached to their target proteins. In this method, total proteins from C. jejuni were digested by Pronase E with a higher enzyme to protein ratio (2:1&#8722;3:1) and a longer incubation time (48&#8722;72 h). The resulted Asn-glycans and free glycans were then purified using porous graphitic carbon cartridges, permethylated, and analyzed by mass spectrometry.

This study presents a method for glycomics analysis of glycoproteins by a combination of pronase E digestion, permethylation, and mass spectrometry analysis. This method is capable of analyzing all types of N-linked glycans, including bacterial N-glycans.

Protein glycosylation is one of the most common and complex post-translational modifications. Many techniques have been developed to characterize the ...

A Purification and In Vitro Activity Assay for a (p)ppGpp Synthetase from Clostridium difficile

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to substrates to create phosphorylated products. The use of &#947;-32-P labeled NTP precursors allows simultaneous monitoring of substrate utilization and product formation by radiography. Thin layer chromatography (TLC) on cellulose plates allows rapid separation and sensitive quantification of substrate and product. We present a method for utilizing the thin-layer chromatography to assay the pyrophosphokinase activity of a purified (p)ppGpp synthetase. This method has previously been used to characterize the activity of cyclic nucleotide and dinucleotide synthetases and is broadly suitable for characterizing the activity of any enzyme that hydrolyzes a nucleotide triphosphate bond or transfers a terminal phosphate from a phosphate donor to another molecule.

A Purification and In Vitro Activity Assay for a pppGpp Synthetase from Clostridium difficile

Here, we describe a method for purifying histidine-tagged pyrophosphokinase enzymes and utilizing thin layer chromatography of radiolabelled substrates and products to assay for the enzymatic activity in vitro. The enzyme activity assay is broadly applicable to any kinase, nucleotide cyclase, or phosphor-transfer reaction whose mechanism includes nucleotide triphosphate hydrolysis.

Kinase and pyrophosphokinase enzymes transfer the gamma phosphate or the beta-gamma pyrophosphate moiety from nucleotide triphosphate precursors to ...

Purification of Human S100A12 and Its Ion-induced Oligomers for Immune Cell Stimulation

In this protocol, we describe a method to purify human calcium-binding protein S100A12 and its ion-induced oligomers from Escherichia coli culture for immune cell stimulations. This protocol is based on a two-step chromatography strategy, which comprises protein pre-purification on an anion-exchange chromatography column and a subsequent polishing step on a hydrophobic-interaction column. This strategy produces S100A12 protein of high purity and yield at manageable costs. For functional assays on immune cells eventual remnant endotoxin contamination requires careful monitoring and further cleaning steps to obtain endotoxin-free protein. The majority of endotoxin contaminations can be excluded by anion-exchange chromatography. To deplete residual contaminations, this protocol describes a removal step with centrifugal filters. Depending on the available ion-strength S100A12 can arrange into different homomultimers. To investigate the relationship between structure and function, this protocol further describes ion-treatment of S100A12 protein followed by chemical crosslinking to stabilize S100A12 oligomers and their subsequent separation by size-exclusion chromatography. Finally, we describe a cell-based assay that confirms the biological activity of the purified protein and confirms LPS-free preparation.

This protocol describes a purification method for recombinant tag-free calcium binding protein S100A12 and its ion-induced oligomers for human monocyte stimulation assays.

In this protocol, we describe a method to purify human calcium-binding protein S100A12 and its ion-induced oligomers from Escherichia coli culture for ...

One-step Purification of Twin-Strep-tagged Proteins and Their Complexes on Strep-Tactin Resin Cross-linked With Bis(sulfosuccinimidyl) Suberate (BS3)

Affinity purification of Strep-tagged fusion proteins on resins carrying an engineered streptavidin (Strep-Tactin) has become a widely used method for isolation of protein complexes under physiological conditions. Fusion proteins containing two copies of Strep-tag II, designated twin-Strep-tag or SIII-tag, have the advantage of higher affinity for Strep-Tactin compared to those containing only a single Strep-tag, thus allowing more efficient protein purification. However, this advantage is offset by the fact that elution of twin-Strep-tagged proteins with biotin may be incomplete, leading to low protein recovery. The recovery can be dramatically improved by using denaturing elution with sodium dodecyl sulfate (SDS), but this leads to sample contamination with Strep-Tactin released from the resin, making the assay incompatible with downstream proteomic analysis. To overcome this limitation, we have developed a method whereby resin-coupled tetramer of Strep-Tactin is first stabilized by covalent cross-linking with Bis(sulfosuccinimidyl) suberate (BS3) and the resulting cross-linked resin is then used to purify target protein complexes in a single batch purification step. Efficient elution with SDS ensures good protein recovery, while the absence of contaminating Strep-Tactin allows downstream protein analysis by mass spectrometry. As a proof of concept, we describe here a protocol for purification of SIII-tagged viral protein VPg-Pro from nuclei of virus-infected N. benthamiana plants using the Strep-Tactin polymethacrylate resin cross-linked with BS3. The same protocol can be used to purify any twin-Strep-tagged protein of interest and characterize its physiological binding partners.

One-step Purification of Twin-Strep-tagged Proteins and Their Complexes on Strep-Tactin Resin Cross-linked With Bissulfosuccinimidyl Suberate BS3

A method is described for efficient purification of twin-Strep-tagged fusion proteins and their specific complexes on modified streptavidin (Strep-Tactin) resin covalently cross-linked with Bis(sulfosuccinimidyl) suberate (BS3). The method has the advantages of fast speed, good target protein recovery and high purity, and is compatible with subsequent analysis by mass spectrometry.

Affinity purification of Strep-tagged fusion proteins on resins carrying an engineered streptavidin (Strep-Tactin) has become a widely used method for ...

Purification of a High Molecular Mass Protein in Streptococcus mutans

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video