The authors are grateful to Drs. Craig Duvall and Rebecca Cook for access to data and lab resources for conducting this research. The authors are grateful to the Vanderbilt Institute for Nanoscale Science and Engineering (VINSE) for access to DLS and TEM (NSF EPS 1004083) instruments. The authors are grateful to the National Science Foundation for supporting the Graduate Research Fellowship Program (NSF#1445197). The authors are grateful to the National Institutes of Health for financial support (NIH R01 EB019409). The authors are grateful to the Department of Defense Congressionally Directed Medical Research program for financial support (DOD CDMRP OR130302).

1. Preparation and characterization of si-NPs
<ol>
	<li>si-NP preparation
	<ol>
		<li>Dissolve polymer in 10 mM citric acid buffer (pH 4.0) at 3.33 mg/mL. Polymer can first be dissolved at 10x concentration in ethanol to ensure dissolution. 
		NOTE: Polymer can be dissolved at lower concentrations, but use at concentrations above 3.33 mg/mL can prevent homogenous NP formation.</li>
		<li>Add siRNA (50 &#956;M in diH2O) to result in N+:P- ratio of 10. Mix polymer and siRNA solutions thoroughly by pipetting and let incubate for 30 min. The N+:P- ratio represents the number of positively-charged amine groups on the polymer to the number of negatively-charged phosphate groups on the siRNA and is calculated by the formula below: 
		<img alt="Equation" src="/files/ftp_upload/59549/59549eq1.jpg" /> 
		where, mol Pol is the molar amount of polymer, RU amine is the number of repeating units of positively-charged amines per polymer, mol siRNA is the molar amount of siRNA, and bp siRNA is the number of base pairs per siRNA molecule.</li>
		<li>Add a 5-fold excess of 10 mM phosphate buffer (pH 8.0) and mix gently either by pipetting or inverting the tube. To confirm that the final pH is neutral (~7.2-7.5), pipette 10 &#956;L of si-NP solution onto pH test strips. 
		NOTE: Citric acid and phosphate buffers are prepared according to the Millipore Sigma Buffer Reference Center Charts.</li>
	</ol>
	</li>
	<li>Physicochemical characterization of si-NPs</li>
	<li>Record the size and surface charge of resulting si-NPs using dynamic light scattering (DLS). Prepare a DLS sample by filtering 1 mL of si-NPs (0.1 &#8211; 1.0 mg/mL) through 0.45 &#956;m pore-size syringe filters into a square quartz or polystyrene cuvette. Record size and surface charge measurements using a DLS instrument according to the manufacturer&#8217;s specifications.
	<ol>
		<li>Confirm the size and morphology of si-NPs by imaging analysis using transmission electron microscopy (TEM).
		<ol>
			<li>Add 5 &#956;L of si-NP solution at 1 mg/mL to TEM grids and incubate for 60 s. Blot dry for 3 s.</li>
			<li>Add 5 &#956;L of 3% uranyl acetate solution and incubate for 20 s. Blot dry for 3 s. Dry grids overnight under desiccation.</li>
			<li>Image grids according to the protocol established for the specific microscope to be used.</li>
		</ol>
		</li>
		<li>Characterize the loading of siRNA in si-NPs at various N+:P- ratios using agarose gel retardation.
		<ol>
			<li>To produce 2% agarose gel, add 2 g of electrophoresis grade agarose powder to 100 mL of 1x TAE (Tris-acetate-EDTA) buffer at pH 8.0. Stir to suspend agarose. Heat uncovered in microwave until all agarose is dissolved (1-3 min).</li>
			<li>Once cooled, add 5 &#956;L of ethidium bromide (10 mg/mL in H2O), and mix well. Pour agarose into a gel tray and place comb to produce wells, letting dry for 30 min. Carefully remove comb to leave behind loading wells, and fill the gel tray to the max fill line with 1x TAE buffer.</li>
			<li>Generate si-NPs (according to the procedure above) at 0, 1, 2, 5, 7, 10, 20, and 40 N+:P- ratios. Place 2 &#956;L aliquots of loading dye (no SDS and reducing agents) on paraffin film for each si-NP formulation. Mix 10 &#956;L of si-NP solution with loading dye on paraffin film by pipette.</li>
			<li>Add si-NP/loading dye solutions to agarose gel wells. Run voltage source at 100 V for 35 min (or until samples have traversed 80% of gel length).</li>
			<li>Visualize siRNA bands on a UV transilluminator according to the manufacturer&#8217;s specifications.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Determining in vitro bioactivity of si-NPs
<ol>
	<li>Knockdown of the model gene luciferase
	<ol>
		<li>Generate luciferase si-NPs (according to the procedure above) using luciferase siRNA and scrambled si-NPs using a scrambled siRNA sequence as a control. Formualte both si-NPs at the same final N+:P- ratio and at the optimum ratio identified by agarose gel retardation studies. Example siRNA sequences are included in the Table of Materials.</li>
		<li>Seed luciferase-expressing cells [MDA-MB-231/Luciferase (Bsd) stable cells] in 96-well black-walled plates at a density of 2,000 cells per well. Allow to adhere overnight in full media (DMEM, 10% FBS) in an incubator (37 &#176;C, 5% CO2, 95% humidity).</li>
		<li>Dilute si-NPs into full serum media for a final volume of 100 &#956;L per well and siRNA concentration of 100 nM. Treat cells for 24 h with si-NPs.</li>
		<li>After 24 h, remove treatments and replace media with full serum media containing 150 &#956;g/mL D-luciferin. Incubate cells for 5 min before measuring luminescence on a plate reader or in vivo optical imaging system according to the manufacturer&#8217;s specifications.</li>
		<li>Replace luciferin-containing media with fresh, full serum media, and incubate 24 h more. Repeat the step above, removing media and replacing with full serum media containing 150 &#956;g/mL D-luciferin, followed by a 5 min incubation prior to measuring luminescence at the 48 h timepoint.</li>
		<li>For longitudinal studies, maintain cells under sterile conditions while measuring luminescence. Continue to culture in fresh, full media between measurements after replacing luciferin-containing. 
		NOTE: The appropriate siRNA concentration will vary with different si-NPs and siRNA molecules. When using neutrally-charged polyplexes with an endosomolytic core (e.g., PEG-DB), 100 nM is typically well-tolerated by the cells and produces &#62;75% luciferase knockdown. The mass ratio of PEG-DB to siRNA at 10 N+:P- ratio and 100 nM siRNA treatments (assuming 26 bp siRNA) is 23.3, i.e., add 23.3 ng of PEG-DB for every 1.0 ng of siRNA. For example, add 1.16 &#956;L of 3.33 mg/mL polymer for 166.5 ng of siRNA to treat one well at 100 nM in a 96-well plate (100 mL media volume per well).</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Fire, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+specific+genetic+interference+by+double-stranded+RNA+in+Caenorhabditis+elegans.">Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans.</a> Nature. 391 (6669), 806-811 (1998).</li><li>Elbashir, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Duplexes+of+21-nucleotide+RNAs+mediate+RNA+interference+in+cultured+mammalian+cells.">Duplexes of 21-nucleotide RNAs mediate RNA interference in cultured mammalian cells.</a> Nature. 411 (6836), 494-498 (2001).</li><li>Soutschek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+an+endogenous+gene+by+systemic+administration+of+modified+siRNAs.">Therapeutic silencing of an endogenous gene by systemic administration of modified siRNAs.</a> Nature. 432 (7014), 173-178 (2004).</li><li>Hannon, G. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+interference.">RNA interference.</a> Nature. 418, 244 (2002).</li><li>Dykxhoorn, D. M., Palliser, D., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+silent+treatment:+siRNAs+as+small+molecule+drugs.">The silent treatment: siRNAs as small molecule drugs.</a> Gene Therapy. 13 (6), 541-552 (2006).</li><li>Wittrup, A., Lieberman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Knocking+down+disease:+a+progress+report+on+siRNA+therapeutics.">Knocking down disease: a progress report on siRNA therapeutics.</a> Nature Reviews Genetics. 16 (9), 543 (2015).</li><li>Li, H. E., Nelson, C. C., Evans, B., Duvall, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+Intracellular-Acting+Biologics+in+Pro-Apoptotic+Therapies.">Delivery of Intracellular-Acting Biologics in Pro-Apoptotic Therapies.</a> Current Pharmaceutical Design. 17 (3), 293-319 (2011).</li><li>Bartlett, D. W., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+siRNA+nuclease+stability+on+the+in+vitro+and+in+vivo+kinetics+of+siRNA-mediated+gene+silencing.">Effect of siRNA nuclease stability on the in vitro and in vivo kinetics of siRNA-mediated gene silencing.</a> Biotechnology and Bioengineering. 97 (4), 909-921 (2007).</li><li>Zuckerman, J. E., Choi, C. H., Han, H., Davis, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycation-siRNA+nanoparticles+can+disassemble+at+the+kidney+glomerular+basement+membrane.">Polycation-siRNA nanoparticles can disassemble at the kidney glomerular basement membrane.</a> Proceedings of the National Academy of Sciences USA. 109 (8), 3137-3142 (2012).</li><li>Dominska, M., Dykxhoorn, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Breaking+down+the+barriers:+siRNA+delivery+and+endosome+escape.">Breaking down the barriers: siRNA delivery and endosome escape.</a> Journal of Cell Science. 123 (Pt 8), 1183-1189 (2010).</li><li>Gilleron, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Image-based+analysis+of+lipid+nanoparticle&#8211;mediated+siRNA+delivery,+intracellular+trafficking+and+endosomal+escape.">Image-based analysis of lipid nanoparticle&#8211;mediated siRNA delivery, intracellular trafficking and endosomal escape.</a> Nature Biotechnology. 31 (7), 638 (2013).</li><li>Sahay, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficiency+of+siRNA+delivery+by+lipid+nanoparticles+is+limited+by+endocytic+recycling.">Efficiency of siRNA delivery by lipid nanoparticles is limited by endocytic recycling.</a> Nature Biotechnology. 31 (7), 653-658 (2013).</li><li>Wittrup, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualizing+lipid-formulated+siRNA+release+from+endosomes+and+target+gene+knockdown.">Visualizing lipid-formulated siRNA release from endosomes and target gene knockdown.</a> Nature Biotechnology. 33 (8), 870-876 (2015).</li><li>Kanasty, R., Dorkin, J. R., Vegas, A., Anderson, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+materials+for+siRNA+therapeutics.">Delivery materials for siRNA therapeutics.</a> Nature Materials. 12 (11), 967-977 (2013).</li><li>Adams, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patisiran,+an+RNAi+Therapeutic,+for+Hereditary+Transthyretin+Amyloidosis.">Patisiran, an RNAi Therapeutic, for Hereditary Transthyretin Amyloidosis.</a> New England Journal of Medicine. 379 (1), 11-21 (2018).</li><li>Dang, C. V., Reddy, E. P., Shokat, K. M., Soucek, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drugging+the+'undruggable'+cancer+targets.">Drugging the 'undruggable' cancer targets.</a> Nature Reviews Cancer. 17 (8), 502 (2017).</li><li>Alexis, F., Pridgen, E., Molnar, L. K., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Factors+affecting+the+clearance+and+biodistribution+of+polymeric+nanoparticles.">Factors affecting the clearance and biodistribution of polymeric nanoparticles.</a> Molecular Pharmaceutics. 5 (4), 505-515 (2008).</li><li>Verbaan, F. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+fate+of+poly(2-dimethyl+amino+ethyl)methacrylate-based+polyplexes+after+intravenous+administration.">The fate of poly(2-dimethyl amino ethyl)methacrylate-based polyplexes after intravenous administration.</a> International Journal of Pharmaceutics. 214 (1-2), 99-101 (2001).</li><li>Lv, H., Zhang, S., Wang, B., Cui, S., Yan, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toxicity+of+cationic+lipids+and+cationic+polymers+in+gene+delivery.">Toxicity of cationic lipids and cationic polymers in gene delivery.</a> Journal of Controlled Release. 114 (1), 100-109 (2006).</li><li>Shi, J., Kantoff, P. W., Wooster, R., Farokhzad, O. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+nanomedicine:+progress,+challenges+and+opportunities.">Cancer nanomedicine: progress, challenges and opportunities.</a> Nature Reviews Cancer. 17 (1), 20 (2016).</li><li>Torchilin, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tumor+delivery+of+macromolecular+drugs+based+on+the+EPR+effect.">Tumor delivery of macromolecular drugs based on the EPR effect.</a> Advanced Drug Delivery Reviews. 63 (3), 131-135 (2011).</li><li>Duncan, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+dawning+era+of+polymer+therapeutics.">The dawning era of polymer therapeutics.</a> Nature Reviews Drug Discovery. 2 (5), 347 (2003).</li><li>Tang, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+the+optimal+size+of+anticancer+nanomedicine.">Investigating the optimal size of anticancer nanomedicine.</a> Proceedings of the National Academy of Sciences USA. 111 (43), 15344-15349 (2014).</li><li>Nelson, C. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Balancing+Cationic+and+Hydrophobic+Content+of+PEGylated+siRNA+Polyplexes+Enhances+Endosome+Escape,+Stability,+Blood+Circulation+Time,+and+Bioactivity+in+vivo.">Balancing Cationic and Hydrophobic Content of PEGylated siRNA Polyplexes Enhances Endosome Escape, Stability, Blood Circulation Time, and Bioactivity in vivo.</a> ACS Nano. 7 (10), 8870-8880 (2013).</li><li>Jackson, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Zwitterionic+Nanocarrier+Surface+Chemistry+Improves+siRNA+Tumor+Delivery+and+Silencing+Activity+Relative+to+Polyethylene+Glycol.">Zwitterionic Nanocarrier Surface Chemistry Improves siRNA Tumor Delivery and Silencing Activity Relative to Polyethylene Glycol.</a> ACS Nano. , (2017).</li><li>Akinc, A., Thomas, M., Klibanov, A. M., Langer, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+polyethylenimine-mediated+DNA+transfection+and+the+proton+sponge+hypothesis.">Exploring polyethylenimine-mediated DNA transfection and the proton sponge hypothesis.</a> The Journal of Gene Medicine. 7 (5), 657-663 (2005).</li><li>de Wet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., Subramani, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Firefly+luciferase+gene:+structure+and+expression+in+mammalian+cells.">Firefly luciferase gene: structure and expression in mammalian cells.</a> Molecular and Cellular Biology. 7 (2), 725-737 (1987).</li><li>Aggarwal, P., Hall, J. B., McLeland, C. B., Dobrovolskaia, M. A., McNeil, S. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nanoparticle+interaction+with+plasma+proteins+as+it+relates+to+particle+biodistribution,+biocompatibility+and+therapeutic+efficacy.">Nanoparticle interaction with plasma proteins as it relates to particle biodistribution, biocompatibility and therapeutic efficacy.</a> Advanced Drug Delivery Reviews. 61 (6), 428-437 (2009).</li><li>Geng, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Shape+effects+of+filaments+versus+spherical+particles+in+flow+and+drug+delivery.">Shape effects of filaments versus spherical particles in flow and drug delivery.</a> Nature Nanotechnology. 2 (4), 249 (2007).</li><li>Chauhan, V. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescent+nanorods+and+nanospheres+for+real-time+in+vivo+probing+of+nanoparticle+shape-dependent+tumor+penetration.">Fluorescent nanorods and nanospheres for real-time in vivo probing of nanoparticle shape-dependent tumor penetration.</a> Angewandte Chemie International Edition. 50 (48), 11417-11420 (2011).</li><li>Chu, K. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma,+tumor+and+tissue+pharmacokinetics+of+Docetaxel+delivered+via+nanoparticles+of+different+sizes+and+shapes+in+mice+bearing+SKOV-3+human+ovarian+carcinoma+xenograft.">Plasma, tumor and tissue pharmacokinetics of Docetaxel delivered via nanoparticles of different sizes and shapes in mice bearing SKOV-3 human ovarian carcinoma xenograft.</a> Nanomedicine. 9 (5), 686-693 (2013).</li><li>Werfel, T. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+mTORC2+Inhibitor+Therapeutically+Blocks+Breast+Cancer+Cell+Growth+and+Survival.">Selective mTORC2 Inhibitor Therapeutically Blocks Breast Cancer Cell Growth and Survival.</a> Cancer Research. 78 (7), 1845-1858 (2018).</li><li>Sarett, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipophilic+siRNA+targets+albumin+in+situ+and+promotes+bioavailability,+tumor+penetration,+and+carrier-free+gene+silencing.">Lipophilic siRNA targets albumin in situ and promotes bioavailability, tumor penetration, and carrier-free gene silencing.</a> Proceedings of the National Academy of Sciences USA. 114 (32), E6490-E6497 (2017).</li><li>Williams, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrinsic+apoptotic+pathway+activation+increases+response+to+anti-estrogens+in+luminal+breast+cancers.">Intrinsic apoptotic pathway activation increases response to anti-estrogens in luminal breast cancers.</a> Cell Death and Disease. 9 (2), 21 (2018).</li><li>Evans, B. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+Vivo+Red+Blood+Cell+Hemolysis+Assay+for+the+Evaluation+of+pH-responsive+Endosomolytic+Agents+for+Cytosolic+Delivery+of+Biomacromolecular+Drugs.">Ex Vivo Red Blood Cell Hemolysis Assay for the Evaluation of pH-responsive Endosomolytic Agents for Cytosolic Delivery of Biomacromolecular Drugs.</a> Journal of Visualized Experiments. (73), e50166 (2013).</li><li>Werfel, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combinatorial+Optimization+of+PEG+Architecture+and+Hydrophobic+Content+Improves+siRNA+Polyplex+Stability,+Pharmacokinetics,+and+Potency+In+vivo.">Combinatorial Optimization of PEG Architecture and Hydrophobic Content Improves siRNA Polyplex Stability, Pharmacokinetics, and Potency In vivo.</a> Journal of Controlled Release. , (2017).</li><li>Kilchrist, K. V., Evans, B. C., Brophy, C. M., Duvall, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+Enhanced+Cellular+Uptake+and+Cytosolic+Retention+of+MK2+Inhibitory+Peptide+Nano-polyplexes.">Mechanism of Enhanced Cellular Uptake and Cytosolic Retention of MK2 Inhibitory Peptide Nano-polyplexes.</a> Cellular and Molecular Bioengineering. 9 (3), 368-381 (2016).</li><li>Kilchrist, K. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gal8+Visualization+of+Endosome+Disruption+Predicts+Carrier-Mediated+Biologic+Drug+Intracellular+Bioavailability.">Gal8 Visualization of Endosome Disruption Predicts Carrier-Mediated Biologic Drug Intracellular Bioavailability.</a> ACS Nano. , (2019).</li></ol>

The authors disclose no potential conflicts of interest.

The si-NPs described here are formed by electrostatic association of anionic siRNA and cationic polymers into polyion complexes (polyplexes). Electrostatic complexing of siRNA and the cationic DB block of PEG-DB polymers is facilitated by mixing at low pH (4.0). At pH 4.0, DMAEMA is highly protonated, and consequently the DB block is highly charged. This ensures that the polymers dissolve as unimers in solution as opposed to forming micelles and that DB complexes efficiently with siRNA. Subsequently, the pH of solution is adjusted to neutral (pH 7.4), causing &#8216;hydrophobization&#8217; of the DB block, micelle formation, and entrapment of the complexed siRNA within the core of the resulting polyplexes. These polyplexes are designed such that PEG forms a hydrophilic, inert shell around the DB/siRNA core, resulting in neutral surface charge that is necessary for systemic administration. The polymer chemistry and process of polyplex formation are outlined in Figure 1.
Rigorous physicochemical characterization of si-NPs is essential for determining whether formulations are appropriate for moving into biological testing. Size, surface charge, and particle shape/morphology are all important parameters that can impact biological performance. For systemic delivery to tumors, si-NP size should fall between 20 &#8211; 200 nm diameter22, and most recent studies suggest 20 &#8211; 50 nm diameter particles are ideal23. Surface charge should be neutral or slightly negative to minimize protein adsorption and opsonization28. Studies have investigated the connection between particle shape and pharmacokinetics/particle clearance, suggesting particles with high aspect ratio are desirable over spherical particles29,30,31. However, to date spherical particles are still most commonly employed, and to our knowledge, are the only particle shape to have been translated to human studies in oncology.
It is important to note that the uniform and consistent formation of polyplexes, such as the si-NPs presented here, is dependent upon a range of physicochemical parameters. We have found empirically that polyplex concentration, pH of the solution, and the ratio of polymer to siRNA (N+:P- ratio) all drastically impact polyplex formation. In our hands, siRNA concentration does not have a large impact on polyplex formation, but using polymer concentrations in excess of 3.33 mg/mL results in formation of large aggregates and inconsistent polyplex size. As these si-NPs are pH-responsive, a variety of problems can arise when the final pH of si-NP solutions is too acidic (&#60; pH 7.2). Two ways to prevent these complications are to lyophilize polymers in pure diH2O so that there are no salts to change buffer composition upon dissolution and to re-make buffers frequently to prevent the &#8220;drifting&#8221; of buffer pH over time. To be cautious, the pH of buffers should be confirmed each time before making si-NPs, and the final pH of si-NP solutions should always be verified. Finally, the N+:P- ratio of si-NPs impacts siRNA loading efficiency and polyplex physicochemical parameters. There typically exists an ideal N+:P- ratio at which all siRNA is loaded but there is not an overabundance of un-complexed polymer which forms separate populations of micelles and increases cytotoxicity. For the si-NPs presented here, N+:P- 10-20 is the range in which optimum consistency and performance have been observed.
Luciferase reporter cell lines are used here for the rapid and high-throughput analysis of si-NP bioactivity. Luciferase reporter cell lines must be generated or purchased before starting bioactivity analysis, thus requiring an initial investment in time and expense. However, use of the luciferase reporter cells to assess gene silencing is faster, more amenable to high-throughput analysis, and cheaper over time than performing RT-PCR (to measure mRNA expression) or western blots (to measure protein expression). For instance, measuring luminescence in this assay typically takes just a few minutes as opposed to all-day or multi-day processes necessary to perform RT-PCR or western blots. Moreover, luminescence measurements can be conducted on well-plates, allowing for the simultaneous quantification of many samples (up to 96-well plates have been used by the authors). Lastly, D-luciferin is the only reagent needed above and beyond typical cell culture reagents, making the method much more affordable than RT-PCR or western blot. It should be noted however, that the luciferase reporter cell assay is limited to only assessing gene silencing of the model gene luciferase and cannot be used to measure gene silencing of other &#8220;therapeutic genes&#8221; of interest. Thus, the authors refer readers to several studies where RT-PCR and/or western blot has been used to assess gene silencing of therapeutic genes of interest24,32,33,34.
In addition to bioactivity, researchers should ideally consider a comprehensive gamut of in vitro biological tests to characterize si-NP performance. The luciferase assay described above can also be used to assess cell viability by comparing the luminescence signal of scrambled si-NP treated cells to untreated cells. Since the siRNA is a non-targeting sequence, any change in luminescence can be attributed to non-specific impact of the si-NPs on cell viability, and this effect is typically dependent on the polymer chemistry and molar amount. Techniques in flow cytometry and fluorescent microscopy can be used to assess cell uptake of si-NPs using fluorescently-labeled siRNAs, polymers, or both. Additionally, molecular techniques such as stem-loop PCR and Argonaut 2 immunoprecipitation can be used to precisely measure intracellular siRNA levels. Since siRNA is only bioactive if delivered to the cytosol, where it is loaded into RISC, si-NPs must trigger endosomal escape of siRNA once internalized by the cell. Assays used to experimentally measure endosomal escape include the red blood cell hemolysis assay (described in detail by Evans et al.35), fluorescent imaging of the colocalization of fluorescently labeled si-NP cargo and LysoTracker36, and most recently, fluorescent imaging of the recruitment of Galectin 8 to punctured endosomal vesicles37,38. Gathering data and synthesizing the results from in vitro experiments for cell viability, cell uptake, endosomal escape, and bioactivity provide the researcher complementary pieces of information from which to draw interpretations and garner mechanistic insight about si-NP (in)effectiveness.
In sum, nanoparticles capable of efficiently delivering siRNA have tremendous potential to treat disease. For example, in oncology, many genes that cause cancer progression, resistance to therapy, and metastasis are &#8216;undruggable&#8217; by conventional pharmacology but could be treated using siRNA. However, prerequisite to their use in animal models of disease, siRNA nanomedicines (referred to here as si-NPs) require extensive physicochemical and biological characterization to ensure both their safety and effectiveness. To this end, methods have been described herein to produce and characterize si-NPs in vitro, by which the si-NPs can be assessed for suitability to carry forward into animal studies.

Because siRNAs inhibit the translation of proteins from mRNA sequences, they can theoretically be used to drug all known pathologies1,2,3,4,5. However, the use of siRNA in medicine is limited by the comprehensively poor pharmacokinetic profile of siRNA molecules6,7. When injected intravenously, siRNAs are rapidly cleared through the kidneys and/or degraded by nucleases8,9. Due to its large size and negative charge, siRNA cannot enter cells or escape the endolysosomal pathway to access the RNA-Induced Silencing Complex (RISC) that resides in the cytosol10,11,12,13. Thus, extensive effort has focused on the design and implementation of siRNA delivery strategies14. This effort has largely focused on the development of lipid- and polymer-based nanoparticles which package siRNA, protect it from clearance and degradation in vivo, and initiate cellular uptake and endosomal escape through ionizable, cationic amine groups. Many pre-clinical successes have been reported and most recently, the first clinical success has been reported for nanoparticle-based hepatic siRNA delivery to treat hereditary transthyretin-mediated (hATTR) amyloidosis15.
There are many cancer-causing genes that are currently &#8220;undruggable&#8221; by conventional pharmacology (i.e., small molecule drugs), motivating the design of polymeric siRNA nanoparticles (si-NPs) to treat cancer16. However, there are a separate set of design parameters that must be considered for non-hepatic siRNA delivery. The delivery system must shield the cationic charge of the polyplex which causes agglutination within the systemic circulation17,18,19. For tumor delivery, specifically, si-NP stability is essential to endow long circulation and thus increased accumulation within tumors via the enhanced permeability and retention (EPR) effect20,21. Moreover, control over si-NP size is essential since only nanoparticles approximately 20 &#8211; 200 nm diameter in size leverage EPR22, and smaller si-NPs (~20 &#8211; 50 nm diameter) exhibit improved tumor penetration over larger sized nanoparticles and microparticles23.
To address these additional design constraints for systemic tumor delivery of siRNA following intravenous administration, neutrally-charged, pH-responsive si-NPs have been developed (Figure 1)24. These si-NPs are PEGylated, or most recently, Zwitterionated25, for neutral surface charge and resistance to protein adsorption and opsonization in circulation. Since they cannot rely solely on cationic character to drive intracellular delivery, extremely efficient endosomal escape is imperative for achieving potent gene silencing. Accordingly, the core of these si-NPs is composed of a highly endosomolytic core which is inert at extracellular pH (7.4), but which is triggered in a switch-like manner in the acidified conditions of the endolysosomal pathway [pH 6.8 (early endosomes) &#8211; 5.0 (lysosomes)]. Lastly, a mixture of cationic and hydrophobic content within the core of si-NPs provide both electrostatic and van der Waals stabilization forces, improving stability of the si-NPs in blood compared to merely cationic systems.
The integration of many functions into a relatively simple design is possible using Reversible Addition-Fragmentation chain Transfer (RAFT) controlled polymerization to produce polymers with complex architecture and precise composition. To produce si-NPs with neutral surface charge, pH-responsiveness, and NP stability, RAFT is used to synthesize poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB; Figure 1A). PEG-DB is electrostatically complexed with siRNA, forming si-NPs with a PEG corona and DB/siRNA core (Figure 1B). PEG forms an inert, neutrally-charged hydrophilic layer on the si-NP corona. The DB block consists of a 50:50 molar ratio of 2-(dimethylamino)ethyl methacrylate (DMAEMA) and butyl methacrylate (BMA). Cationic DMAEMA electrostatically complexes negatively-charged siRNA. BMA self-associates within the NP core by van der Waals interactions, increasing NP stability. Together, DMAEMA and BMA impart pH-dependent lipid bilayer-lytic behavior to the DB polymer block. At extracellular pH, the DB block is sequestered to the si-NP core and is inert to lipid bilayers. Under acidic conditions, such as those within the endolysosomal pathway, ionizable DMAEMA within the DB block facilitates the proton sponge effect, where endosomal buffering leads to osmotic swelling and rupture26. Additionally, hydrophobic BMA moieties within the DB block actively integrate into and lyse lipid bilayers, resulting in potent endosomolysis. Thus, siRNA is complexed with PEG-DB to form si-NPs that are neutrally-charged and highly stable at extracellular pH but which disrupt lipid bilayers at acidic pH, ensuring cytosolic delivery of the siRNA payload.
Herein are described the experimental procedures to produce si-NPs from PEG-DB. Methods to characterize the physicochemical parameters and bioactivity of si-NPs are presented and discussed. In order to rapidly assess si-NP bioactivity, luciferase is used as a model gene for knockdown studies. Firefly Luciferase is the protein responsible for the &#8216;glow&#8217; of fireflies27. Accordingly, mammalian cells transfected with the firefly luciferase gene produce a bioluminescent &#8216;glow&#8217; that can be captured using a luminometer to quantify levels of Luciferase expression. Here, we use Luciferase to assess bioactivity of si-NPs by delivering siRNA against Luciferase and quantifying the corresponding reduction in bioluminescence in Luciferase-expressing cells compared to cells that receive a scrambled siRNA.

<table><tbody><tr><td>0.45 &amp;#956;m pore-size syringe filters</td><td>Thermo Fisher Scientific</td><td>F25133</td><td>17 mm diameter, PTFE membrane</td></tr><tr><td>0-14 pH test strips</td><td>Millipore Sigma</td><td>P4786</td><td></td></tr><tr><td>10x TAE buffer</td><td>Thermo Fisher Scientific/Invitrogen</td><td>AM9869</td><td></td></tr><tr><td>6-7.7 pH test strips</td><td>Millipore Sigma</td><td>P3536</td><td></td></tr><tr><td>96-well black walled plates</td><td>Corning</td><td>3603</td><td>Tissue-culture treated</td></tr><tr><td>Agarose Powder</td><td>Thermo Fisher Scientific/Invitrogen</td><td>16500</td><td></td></tr><tr><td>Citric acid monohydrate</td><td>Millipore Sigma</td><td>C1909</td><td></td></tr><tr><td>dibasic sodium phosphate dihydrate</td><td>Millipore Sigma</td><td>71643</td><td></td></tr><tr><td>D-luciferin</td><td>Thermo Fisher Scientific</td><td>88294</td><td>Monopotassium Salt</td></tr><tr><td>DMEM</td><td>Gibco</td><td>11995065</td><td>High glucose and pyruvate</td></tr><tr><td>Ethanol</td><td>Millipore Sigma</td><td>459836</td><td></td></tr><tr><td>ethidium bromide</td><td>Thermo Fisher Scientific/Invitrogen</td><td>15585011</td><td></td></tr><tr><td>FBS</td><td>Gibco</td><td>26140079</td><td></td></tr><tr><td>loading dye</td><td>Thermo Fisher Scientific/Invitrogen</td><td>R0611</td><td></td></tr><tr><td>Luciferase siRNA</td><td>IDT</td><td>N/A</td><td>Antisense Strand Sequense: GAGGAGUUCAUUAUCAGUGC&lt;br /&gt;AAUUGUU&lt;br /&gt;Sense Strand Sequense: CAAUUGCACU&lt;br /&gt;GAUAAUGAACUCCT*C* *DNA bases</td></tr><tr><td>MDA-MB-231 / Luciferase (Bsd) stable cells</td><td>GenTarget Inc</td><td>SC059-Bsd</td><td>Luciferase-expressing cells sued to assess si-NP bioactivity</td></tr><tr><td>monobasic sodium phosphate monohydrate</td><td>Millipore Sigma</td><td>S9638</td><td></td></tr><tr><td>Scarmbled siRNA</td><td>IDT</td><td>N/A</td><td>Antisense Strand Sequense: AUACGCGUAUU&lt;br /&gt;AUACGCGAUUAACGAC &lt;br /&gt;Sense Strand Sequense: CGUUAAUCGCGUAUAAUAC&lt;br /&gt;GCGUA*T* *DNA bases</td></tr><tr><td>square polystyrene cuvettes</td><td>Fisher Scientific</td><td>14-955-129</td><td>4.5 mL capacity</td></tr><tr><td>TEM grids</td><td>Ted Pella, Inc.</td><td>1GC50</td><td>PELCO Center-Marked Grids, 50 mesh, 3.0mm O.D., Copper</td></tr><tr><td>Trisodium citrate dihydrate</td><td>Millipore Sigma</td><td>S1804</td><td></td></tr><tr><td>uranyl acetate</td><td>Polysciences, Inc.</td><td>21447-25</td><td></td></tr></tbody></table>

preparation of neutrally-charged, ph-responsive polymeric nanoparticles for cytosolic sirna delivery

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical success for treating previously &#8216;undruggable&#8217; hepatic disease targets with siRNA has been achieved. However, efficient tumor siRNA delivery necessitates additional pharmacokinetic design considerations, including long circulation time, evasion of clearance organs (e.g., liver and kidneys), and tumor penetration and retention. Here, we describe the preparation and in vitro physicochemical/biological characterization of polymeric nanoparticles designed for efficient siRNA delivery, particularly to non-hepatic tissues such as tumors. The siRNA nanoparticles are prepared by electrostatic complexation of siRNA and the diblock copolymer poly(ethylene glycol-b-[2-(dimethylamino)ethyl methacrylate-co-butyl methacrylate]) (PEG-DB) to form polyion complexes (polyplexes) where siRNA is sequestered within the polyplex core and PEG forms a hydrophilic, neutrally-charged corona. Moreover, the DB block becomes membrane-lytic as vesicles of the endolysosomal pathway acidify (&#60; pH 6.8), triggering endosomal escape and cytosolic delivery of siRNA. Methods to characterize the physicochemical characteristics of siRNA nanoparticles such as size, surface charge, particle morphology, and siRNA loading are described. Bioactivity of siRNA nanoparticles is measured using luciferase as a model gene in a rapid and high-throughput gene silencing assay. Designs which pass these initial tests (such as PEG-DB-based polyplexes) are considered appropriate for translation to preclinical animal studies assessing the delivery of siRNA to tumors or other sites of pathology.

Some essential characteristics of effective si-NPs for in vivo siRNA delivery are the proper size (~20 &#8211; 200 nm diameter), siRNA packaging, and gene silencing bioactivity. While this is not an exhaustive list (as addressed in the Discussion), these basic characteristics should be confirmed before considering further testing of a formulation.
Figure 2 illustrates the characterization of si-NP size and surface charge upon formulation. DLS and TEM are used as complementary methods to observe si-NP size (both), polydispersity (DLS), and morphology (TEM). DLS measurements show that si-NP 1 has an average diameter of 35 nm, unimodal distribution indicated by the presence of a single peak, and low polydispersity indicated by a relatively narrow peak width (Figure 2A). TEM measurements confirm the size measurement from DLS, suggest the presence of a uniform population of si-NPs, and reveal the spherical morphology of the si-NPs (Figure 2C). DLS and TEM measurements of si-NP 2 reveal that it has undesirable size (&#62;200 nm diameter) of average diameter 1,500 nm, a multimodal and polydisperse population, and aggregates in solution, forming no distinct particle morphology (Figure 2B,D). Both si-NPs 1 and 2 display neutral surface charge, indicated by near-zero mean zeta potential values (Figure 2E).
Loading efficiency of siRNA into si-NPs is characterized using an agarose gel retardation assay. Un-complexed siRNA migrates through the agarose gel and is visualized (due to binding of ethidium bromide) at the gel bottom. When siRNA is complexed with the polymer to form si-NPs, migration through the agarose gel is obstructed and siRNA is visualized at the gel top (or where it was loaded into wells). For PEG-DB-based si-NPs, complexation increases with increasing N+:P- ratios until full complexation is achieved at ~10-20 N+:P- ratio (Figure 3).
Luciferase is used as a model gene for the rapid assessment of si-NP gene silencing bioactivity. Bioluminescence measurements via a plate reader or in vivo optical imaging system allow for the rapid, high-throughput quantification of luciferase protein expression in well-plate format. This technique is considerably faster, cheaper, and less burdensome than analyzing gene silencing through traditional molecular analyses such as PCR (gene expression) and western blot (protein expression). By this method, luciferase-expressing cells are treated with luciferase si-NPs and scrambled si-NPs (as a control), and %Luciferase Activity is calculated by comparing luminescence signal to untreated cells. Bioactive luciferase si-NPs will exhibit significantly diminished %Luciferase Activity when compared directly to scrambled si-NP control, as can be seen for si-NP 1 in Figure 4. In contrast, luciferase si-NPs that do not reduce %Luciferase Activity compared to scrambled si-NP control (such as si-NP 2) are not considered bioactive (Figure 4). Often 48 h is the time of maximum gene silencing (Figure 4), but we have observed significant gene silencing at time points ranging from 24 h to 240 h post-treatment.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59549/59549fig1.jpg" /> 
Figure 1. Polymer chemistry and si-NP schematic. (A) Chemical composition of PEG-DB diblock copolymer that composes si-NPs and endows neutral surface charge (PEG block) and pH-responsive behavior (DB block). (B) Self-assembly of si-NPs. At pH 4.0, DB block is water-soluble because DMAEMA tertiary amines are highly protonated. The positively-charged DB block electrostatically complexes negatively-charged siRNA molecules. The pH is then adjusted to ~7.4 by the addition of 5x pH 8.0 phosphate buffer, resulting in the &#8220;hydrophobization&#8221; of DB block and sequestration of siRNA and DB within the core of si-NPs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59549/59549fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59549/59549fig2.jpg" /> 
Figure 2. DLS and TEM characterization of si-NP size, surface charge, and morphology. (A, C) si-NP 1 represents a uniform sample with appropriate size (~50-100 nm diameter), whereas (B, D) si-NP 2 has formed undesirable, large and polydisperse aggregates. (E) Both si-NPs display near-neutral surface charge (zeta potential). Error bars represent standard error. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59549/59549fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59549/59549fig3.jpg" /> 
Figure 3. Agarose gel retardation assay to assess si-NP siRNA loading efficiency. The disappearance of siRNA bands at the gel bottom indicate complexation of siRNA to polymer. Polymer-complexed siRNA is unable to migrate through the gel and is thus visualized at the top of the gel nearby the loading wells. As the N+:P- ratio is increased, siRNA complexation increases, as indicated by decreased intensity of the siRNA band at the gel bottom. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59549/59549fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59549/59549fig4.jpg" /> 
Figure 4. Si-NP-mediated knockdown of the model gene Luciferase in Luciferase MDA-MB-231 cells. Luciferase activity at (A) 24 h and (B) 48 h post-treatment with either scrambled si-NPs or luciferase si-NPs at 10 N+:P- ratio and 100 nM siRNA dose. %Luciferase Activity is calculated by dividing the luminescence signal of treatment samples (scrambled and luciferase) by the luminescence signal of untreated cells. NOTE: si-NP 1 represents an effective formulation with gene silencing bioactivity, whereas si-NP 2 represents a formulation without gene silencing bioactivity. (*) indicates a statistically significant difference (p &#60; 0.05) compared to the Scrambled group for a formulation at a given timepoint. Error bars represent standard error. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/59549/59549fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery at JoVE.com

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Methods to prepare and characterize the physicochemical properties and bioactivity of neutrally-charged, pH-responsive siRNA nanoparticles are presented. Criteria for successful siRNA nanomedicines such as size, morphology, surface charge, siRNA loading, and gene silencing are discussed.

The success of siRNA as a targeted molecular medicine is dependent upon its efficient cytosolic delivery to cells within the tissue of pathology. Clinical ...

preparation-neutrally-charged-ph-responsive-polymeric-nanoparticles

Nanyang Technological University

Research

JoVE Journal

Bioengineering

7.4K Views.  University of Mississippi. Het huidige protocol is belangrijk omdat het onderzoekers in staat stelt om siRNA geladen nanodeeltjes te produceren en deze nanodeeltjes adequaat te karakteriseren om hun geschiktheid voor toediening aan dieren voorafgaand aan latere studies te waarborgen. Het voordeel van deze aanpak is het produceren van nanodeeltjes die de biologische beschikbaarheid van siRNA verhogen en nanodeeltjes produceren die neutraal geladen zijn en dus geschikt zijn voor systemische toediening. Deze techniek is i...

Video: Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Evaluation of Polymeric Gene Delivery Nanoparticles by Nanoparticle Tracking Analysis and High-throughput Flow Cytometry

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a technology for regenerative medicine2. Unlike viruses, which have significant safety issues, polymeric nanoparticles can be designed to be non-toxic, non-immunogenic, non-mutagenic, easier to synthesize, chemically versatile, capable of carrying larger nucleic acid cargo and biodegradable and/or environmentally responsive. Cationic polymers self-assemble with negatively charged DNA via electrostatic interaction to form complexes on the order of 100 nm that are commonly termed polymeric nanoparticles. Examples of biomaterials used to form nanoscale polycationic gene delivery nanoparticles include polylysine, polyphosphoesters, poly(amidoamines)s and polyethylenimine (PEI), which is a non-degradable off-the-shelf cationic polymer commonly used for nucleic acid delivery1,3 . Poly(beta-amino ester)s (PBAEs) are a newer class of cationic polymers4 that are hydrolytically degradable5,6 and have been shown to be effective at gene delivery to hard-to-transfect cell types such as human retinal endothelial cells (HRECs)7, mouse mammary epithelial cells8, human brain cancer cells9 and macrovascular (human umbilical vein, HUVECs) endothelial cells10.
A new protocol to characterize polymeric nanoparticles utilizing nanoparticle tracking analysis (NTA) is described. In this approach, both the particle size distribution and the distribution of the number of plasmids per particle are obtained11. In addition, a high-throughput 96-well plate transfection assay for rapid screening of the transfection efficacy of polymeric nanoparticles is presented. In this protocol, poly(beta-amino ester)s (PBAEs) are used as model polymers and human retinal endothelial cells (HRECs) are used as model human cells. This protocol can be easily adapted to evaluate any polymeric nanoparticle and any cell type of interest in a multi-well plate format.

A protocol for nanoparticle tracking analysis (NTA) and high-throughput flow cytometry to evaluate polymeric gene delivery nanoparticles is described. NTA is utilized to characterize the nanoparticle particle size distribution and the plasmid per particle distribution. High-throughput flow cytometry enables quantitative transfection efficacy evaluation for a library of gene delivery biomaterials.

Non-viral gene delivery using polymeric nanoparticles has emerged as an attractive approach for gene therapy to treat genetic diseases1 and as a ...

Porous Silicon Microparticles for Delivery of siRNA Therapeutics

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the successful implementation of siRNA therapy requires the use of delivery platforms that can overcome the major challenges of siRNA delivery, such as enzymatic degradation, low intracellular uptake and lysosomal entrapment. Here, a protocol for the preparation and use of a biocompatible and effective siRNA delivery system is presented. This platform consists of polyethylenimine (PEI) and arginine (Arg)-grafted porous silicon microparticles, which can be loaded with siRNA by performing a simple mixing step. The silicon particles are gradually degraded over time, thereby triggering the formation of Arg-PEI/siRNA nanoparticles. This delivery vehicle provides a means for protecting and internalizing siRNA, without causing cytotoxicity. The major steps of polycation functionalization, particle characterization, and siRNA loading are outlined in detail. In addition, the procedures for determining particle uptake, cytotoxicity, and transfection efficacy are also described.

Delivery remains the main challenge for the therapeutic implementation of small interfering RNA (siRNA). This protocol involves the use of a multifunctional and biocompatible siRNA delivery platform, consisting of arginine and polyethylenimine grafted porous silicon microparticles.

Small interfering RNA (siRNA) can be used to suppress gene expression, thereby providing a new avenue for the treatment of various diseases. However, the ...

Synthesis, Functionalization, and Characterization of Fusogenic Porous Silicon Nanoparticles for Oligonucleotide Delivery

With the advent of gene therapy, the development of an effective in vivo nucleotide-payload delivery system has become of parallel import. Fusogenic porous silicon nanoparticles (F-pSiNPs) have recently demonstrated high in vivo gene silencing efficacy due to its high oligonucleotide loading capacity and unique cellular uptake pathway that avoids endocytosis. The synthesis of F-pSiNPs is a multi-step process that includes: (1) loading and sealing of oligonucleotide payloads in the silicon pores; (2) simultaneous coating and sizing of fusogenic lipids around the porous silicon cores; and (3) conjugation of targeting peptides and washing to remove excess oligonucleotide, silicon debris, and peptide. The particle&#8217;s size uniformity is characterized by dynamic light scattering, and its core-shell structure may be verified by transmission electron microscopy. The fusogenic uptake is validated by loading a lipophilic dye, 1,1&#39;-dioctadecyl-3,3,3&#39;,3&#39;-tetramethylindocarbocyanine perchlorate (DiI), into the fusogenic lipid bilayer and treating it to cells in vitro to observe for plasma membrane staining versus endocytic localizations. The targeting and in vivo gene silencing efficacies were previously quantified in a mouse model of Staphylococcus aureus pneumonia, in which the targeting peptide is expected to help the F-pSiNPs to home to the site of infection. Beyond its application in S. aureus infection, the F-pSiNP system may be used to deliver any oligonucleotide for gene therapy of a wide range of diseases, including viral infections, cancer, and autoimmune diseases.

We demonstrate the synthesis of fusogenic porous silicon nanoparticles for effective in vitro and in vivo oligonucleotide delivery. Porous silicon nanoparticles are loaded with siRNA to form the core, which is coated by fusogenic lipids through extrusion to form the shell. Targeting moiety functionalization and particle characterization are included.

With the advent of gene therapy, the development of an effective in vivo nucleotide-payload delivery system has become of parallel import. Fusogenic ...

Engineering

Delivery of Therapeutic siRNA to the CNS Using Cationic and Anionic Liposomes

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes. The emergence of prion diseases in wildlife populations and their increasing threat to human health has led to increased efforts to find a treatment for these diseases. Recent studies have found numerous anti-prion compounds that can either inhibit the infectious PrPRes isomer or down regulate the normal cellular prion protein. However, most of these compounds do not cross the blood brain barrier to effectively inhibit PrPRes formation in brain tissue, do not specifically target neuronal PrPC, and are often too toxic to use in animal or human subjects. 
We investigated whether siRNA delivered intravascularly and targeted towards neuronal PrPC is a safer and more effective anti-prion compound. This report outlines a protocol to produce two siRNA liposomal delivery vehicles, and to package and deliver PrP siRNA to neuronal cells. The two liposomal delivery vehicles are 1) complexed-siRNA liposome formulation using cationic liposomes (LSPCs), and 2) encapsulated-siRNA liposome formulation using cationic or anionic liposomes (PALETS). For the LSPCs, negatively charged siRNA is electrostatically bound to the cationic liposome. A positively charged peptide (RVG-9r [rabies virus glycoprotein]) is added to the complex, which specifically targets the liposome-siRNA-peptide complexes (LSPCs) across the blood brain barrier (BBB) to acetylcholine expressing neurons in the central nervous system (CNS). For the PALETS (peptide addressed liposome encapsulated therapeutic siRNA), the cationic and anionic lipids were rehydrated by the PrP siRNA. This procedure results in encapsulation of the siRNA within the cationic or anionic liposomes. Again, the RVG-9r neuropeptide was bound to the liposomes to target the siRNA/liposome complexes to the CNS. Using these formulations, we have successfully delivered PrP siRNA to AchR-expressing neurons, and decreased the PrPC expression of neurons in the CNS.

The goal of this protocol is to use cationic/anionic liposomes with a neuro-targeting peptide as a CNS delivery system to enable siRNA to cross the BBB. The optimization of a delivery system for treatments, like siRNA, would allow for more treatment options for prion and other neurodegenerative diseases.

Prion diseases result from the misfolding of the normal, cellular prion protein (PrPC) to an abnormal protease resistant isomer called PrPRes.  The ...

Assembly and Characterization of Polyelectrolyte Complex Micelles

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful platform for exploring the physics of polyelectrolyte interactions and also offer a promising solution to the pressing problem of delivering therapeutic oligonucleotides in vivo. Developing predictive structure-property relationships for PCMs has proven difficult, in part due to the presence of strong kinetic traps during nanoparticle self-assembly. This article discusses criteria for choosing polymers for PCM construction and provides protocols based on salt annealing that enable assembly of repeatable, low-polydispersity nanoparticles. We also discuss PCM characterization using light scattering, small-angle X-ray scattering, and electron microscopy.

We provide protocols and representative data for designing, assembling, and characterizing polyelectrolyte complex micelles, core-shell nanoparticles formed by polyelectrolytes and hydrophilic charged-uncharged block copolymers.

Polyelectrolyte complex micelles (PCMs), core-shell nanoparticles formed by self-assembly of charged polymers in aqueous solution, provide a powerful ...

Chemistry

Predicting Gene Silencing Through the Spatiotemporal Control of siRNA Release from Photo-responsive Polymeric Nanocarriers

New materials and methods are needed to better control the binding vs. release of nucleic acids for a wide range of applications that require the precise regulation of gene activity. In particular, novel stimuli-responsive materials with improved spatiotemporal control over gene expression would unlock translatable platforms in drug discovery and regenerative medicine technologies. Furthermore, an enhanced ability to control nucleic acid release from materials would enable the development of streamlined methods to predict nanocarrier efficacy a priori, leading to expedited screening of delivery vehicles. Herein, we present a protocol for predicting gene silencing efficiencies and achieving spatiotemporal control over gene expression through a modular photo-responsive nanocarrier system. Small interfering RNA (siRNA) is complexed with mPEG-b-poly(5-(3-(amino)propoxy)-2-nitrobenzyl methacrylate) (mPEG-b-P(APNBMA)) polymers to form stable nanocarriers that can be controlled with light to facilitate tunable, on/off siRNA release. We outline two complementary assays employing fluorescence correlation spectroscopy and gel electrophoresis for the accurate quantification of siRNA release from solutions mimicking intracellular environments. Information gained from these assays was incorporated into a simple RNA interference (RNAi) kinetic model to predict the dynamic silencing responses to various photo-stimulus conditions. In turn, these optimized irradiation conditions allowed refinement of a new protocol for spatiotemporally controlling gene silencing. This method can generate cellular patterns in gene expression with cell-to-cell resolution and no detectable off-target effects. Taken together, our approach offers an easy-to-use method for predicting dynamic changes in gene expression and precisely controlling siRNA activity in space and time. This set of assays can be readily adapted to test a wide variety of other stimuli-responsive systems in order to address key challenges pertinent to a multitude of applications in biomedical research and medicine.

We present a novel method that uses photo-responsive block copolymers for more efficient spatiotemporal control of gene silencing with no detectable off-target effects. Additionally, changes in gene expression can be predicted using straightforward siRNA release assays and simple kinetic modeling.

New materials and methods are needed to better control the binding vs. release of nucleic acids for a wide range of applications that require the precise ...

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive properties of in vitro transcribed (IVT) mRNA. With the help of IVT mRNA, the de novo synthesis of a desired protein can be induced without changing the physiological state of the target cell. Moreover, protein biosynthesis can be precisely controlled due to the transient effect of IVT mRNA.
For the efficient transfection of cells, nanoliposomes (NLps) may represent a safe and efficient delivery vehicle for therapeutic mRNA. This study describes a protocol to generate safe and efficient cationic NLps consisting of DC-cholesterol and 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) as a delivery vector for IVT mRNA. NLps having a defined size, a homogeneous distribution, and a high complexation capacity, and can be produced using the dry-film method. Moreover, we present different test systems to analyze their complexation and transfection efficacies using synthetic enhanced green fluorescent protein (eGFP) mRNA, as well as their effect on cell viability. Overall, the presented protocol provides an effective and safe approach for mRNA complexation, which may advance and improve the administration of therapeutic mRNA.

Generation of Cationic Nanoliposomes for the Efficient Delivery of In Vitro Transcribed Messenger RNA

Here we describe a protocol for the generation of cationic nanoliposomes, which is based on the dry-film method and can be used for the safe and efficient delivery of in vitro transcribed messenger RNA.

The development of messenger RNA (mRNA)-based therapeutics for the treatment of various diseases becomes more and more important because of the positive ...

Formulating and Characterizing Lipid Nanoparticles for Gene Delivery using a Microfluidic Mixing Platform

Lipid-based drug carriers have been used for clinically and commercially available delivery systems due to their small size, biocompatibility, and high encapsulation efficiency. Use of lipid nanoparticles (LNPs) to encapsulate nucleic acids is advantageous to protect the RNA or DNA from degradation, while also promoting cellular uptake. LNPs often contain multiple lipid components including an ionizable lipid, helper lipid, cholesterol, and polyethylene glycol (PEG) conjugated lipid. LNPs can readily encapsulate nucleic acids due to the ionizable lipid presence, which at low pH is cationic and allows for complexation with negatively charged RNA or DNA. Here LNPs are formed by encapsulating messenger RNA (mRNA) or plasmid DNA (pDNA) using rapid mixing of the lipid components in an organic phase and the nucleic acid component in an aqueous phase. This mixing is performed using a precise microfluidic mixing platform, allowing for nanoparticle self-assembly while maintaining laminar flow. The hydrodynamic size and polydispersity are measured using dynamic light scattering (DLS). The effective surface charge on the LNP is determined by measuring the zeta potential. The encapsulation efficiency is characterized using a fluorescent dye to quantify entrapped nucleic acid. Representative results demonstrate the reproducibility of this method and the influence that different formulation and process parameters have on the developed LNPs.

Lipid nanoparticles are developed using a microfluidic mixing platform approach for mRNA and DNA encapsulation.

Lipid-based drug carriers have been used for clinically and commercially available delivery systems due to their small size, biocompatibility, and high ...

Synthesis and Characterization of mRNA-Loaded Poly(Beta Aminoesters) Nanoparticles for Vaccination Purposes

Vaccination has been one of the major successes of modern society and is indispensable in controlling and preventing disease. Traditional vaccines were composed of entire or fractions of the infectious agent. However, challenges remain, and new vaccine technologies are mandatory. In this context, the use of mRNA for immunizing purposes has shown an enhanced performance, as demonstrated by the speedy approval of two mRNA vaccines preventing SARS-CoV-2 infection. Beyond success in preventing viral infections, mRNA vaccines can also be used for therapeutic cancer applications.
Nevertheless, the instability of mRNA and its fast clearance from the body due to the presence of nucleases makes its naked delivery not possible. In this context, nanomedicines, and specifically polymeric nanoparticles, are critical mRNA delivery systems. Thus, the aim of this article is to describe the protocol for the formulation and test of an mRNA vaccine candidate based on the proprietary polymeric nanoparticles. The synthesis and chemical characterization of the poly(beta aminoesters) polymers used, their complexation with mRNA to form nanoparticles, and their lyophilization methodology will be discussed here. This is a crucial step for decreasing storage and distribution costs. Finally, the required tests to demonstrate their capacity to in vitro transfect and mature model dendritic cells will be indicated. This protocol will benefit the scientific community working on vaccination because of its high versatility that enables these vaccines to prevent or cure a wide variety of diseases.

Synthesis and Characterization of mRNA-Loaded PolyBeta Aminoesters Nanoparticles for Vaccination Purposes

Here, a simple protocol is presented for producing mRNA nanoparticles based on poly(beta aminoester) polymers, easy to be tailored by changing the encapsulated mRNA. The workflow for synthesizing the polymers, the nanoparticles, and their in vitro essential characterization are also described. A proof-of-concept regarding immunization is also added.

Vaccination has been one of the major successes of modern society and is indispensable in controlling and preventing disease. Traditional vaccines were ...

Long-term Silencing of Intersectin-1s in Mouse Lungs by Repeated Delivery of a Specific siRNA via Cationic Liposomes. Evaluation of Knockdown Effects by Electron Microscopy

Previous studies showed that knockdown of ITSN-1s (KDITSN), an endocytic protein involved in regulating lung vascular permeability and endothelial cells (ECs) survival, induced apoptotic cell death, a major obstacle in developing a cell culture system with prolonged ITSN-1s inhibition1. Using cationic liposomes as carriers, we explored the silencing of ITSN-1s gene in mouse lungs by systemic administration of siRNA targeting ITSN-1 gene (siRNAITSN). Cationic liposomes offer several advantages for siRNA delivery: safe with repeated dosing, nonimmunogenic, nontoxic, and easy to produce2. Liposomes performance and biological activity depend on their size, charge, lipid composition, stability, dose and route of administration3Here, efficient and specific KDITSN in mouse lungs has been obtained using a cholesterol and dimethyl dioctadecyl ammonium bromide combination. Intravenous delivery of siRNAITSN/cationic liposome complexes transiently knocked down ITSN-1s protein and mRNA in mouse lungs at day 3, which recovered after additional 3 days. Taking advantage of the cationic liposomes as a repeatable safe carrier, the study extended for 24 days. Thus, retro-orbital treatment with freshly generated complexes was administered every 3rd day, inducing sustained KDITSN throughout the study4. Mouse tissues collected at several time points post-siRNAITSN were subjected to electron microscopy (EM) analyses to evaluate the effects of chronic KDITSN, in lung endothelium. High-resolution EM imaging allowed us to evaluate the morphological changes caused by KDITSN in the lung vascular bed (i.e. disruption of the endothelial barrier, decreased number of caveolae and upregulation of alternative transport pathways), characteristics non-detectable by light microscopy. Overall these findings established an important role of ITSN-1s in the ECs function and lung homeostasis, while illustrating the effectiveness of siRNA-liposomes delivery in vivo.

Repeated retro-orbital injections of cationic liposomes/siRNA/ITSN-1s complexes in mice, every 72 hours for 24 days, efficiently deliver the siRNA duplex to the mouse lung microvasculature reducing ITSN-1s mRNA and protein expression by 75%. This technique is highly reproducible in an animal model, has no adverse effects and avoids fatalities.

Previous  studies showed that knockdown of ITSN-1s (KDITSN), an endocytic  protein involved in regulating lung vascular permeability and endothelial cells ...

Preparation of Neutrally-charged, pH-responsive Polymeric Nanoparticles for Cytosolic siRNA Delivery

Samenvatting

Meer video's verkennen