The study was financially supported by National Science Centre, Poland (grant no. UMO-2017/25/N/NZ3/01886) and KNOW (Leading National Research Centre) Scientific Consortium &#34;Healthy Animal - Safe Food&#34;, decision of Ministry of Science and Higher Education No. 05-1/KNOW2/2015

1. Culture Maintenance
<ol>
	<li>Culture the P19 cell line in Maintenance Medium (Dulbecco&#39;s modified Eagle&#39;s medium with 4,500 mg/L of glucose supplemented with 10% FBS, 100 units/mL penicillin and 100 units/mL streptomycin). Incubate at 37 &#176;C and 5% CO2.</li>
</ol>
2. Sub-culturing Cells
<ol>
	<li>When cells reach approximately 80% confluence, remove the spent medium from the cell culture flasks (surface area 25 cm2).</li>
	<li>Wash the cells with 2 mL of phosphate buffered saline (PBS) free of calcium and magnesium.</li>
	<li>Add 1 mL of 0.25% trypsin-EDTA (ethylenediaminetetraacetic acid) onto the cell monolayer.</li>
	<li>Put the flask in the CO2 incubator (37 &#176;C and 5% CO2) for 2-3&#160;min.</li>
	<li>Assess the cell attachment to the flask surface. Ensure that all of the cells are detached and floating in the medium.</li>
	<li>Add 9 mL of Maintenance Medium to stop&#160;the enzymatic activity of trypsin.</li>
	<li>Resuspend the cells in Maintenance Medium.</li>
	<li>Transfer cells to a 15 mL tube and centrifuge for 5 min at 200 x g and room temperature (RT).</li>
	<li>Discard the supernatant and add 10 mL of fresh Maintenance Medium into the 15 mL tube.</li>
	<li>Use the cell suspension to determine the cell number using a cell counter according to manufacturer&#39;s instructions.</li>
	<li>Seed cells at 2 x 104 cells/cm2 in a new 25 cm2 flask.</li>
	<li>Add the Maintenance Medium up to 10 mL.</li>
	<li>Put the flask with cells in the CO2 incubator (37 &#176;C and 5% CO2) for 2-3 days.</li>
</ol>
3. Trypsin Digestion
<ol>
	<li>Aspirate Maintenance Medium from the cell flask. Wash the cells once with 2&#160;mL of calcium and magnesium-free PBS.</li>
	<li>Add 1 mL of 0.25% trypsin-EDTA.</li>
	<li>Put the flask with cells into the CO2 incubator at 37 &#176;C for 2-3 min.</li>
	<li>Use 1 mL pipette to dissociate the cells by pipetting cells ten times.</li>
	<li>Neutralize trypsin by adding 9&#160;mL of Differentiation Medium (Dulbecco&#39;s modified Eagle&#39;s medium with 4500 mg/L of glucose supplemented with 5% FBS, 100 units/mL penicillin and 100 units/mL streptomycin) without RA to the cells.</li>
	<li>Transfer cells to a 15 mL tube and centrifuge for 5 min at 200 x g and RT.</li>
	<li>Discard the supernatant and add 1 mL of Differentiation Medium without retinoic acid (RA). Resuspend the cell pellet.</li>
	<li>Use the cell suspension to determine the cell number using a cell counter according to manufacturer&#39;s instruction.</li>
</ol>
4. Aggregate Generation
<ol>
	<li>Add 5 &#181;L of RA (1 mM stock dissolved in 99.8% ethanol, stored at -20 &#176;C) to the 10 mL of Differentiation Medium and mix well (final concentration of 0.5 &#181;M RA). 
	NOTE: RA is light sensitive.&#160;Low concentration of EtOH does not affect cell differentiation19,20,21.</li>
	<li>Add 10 mL of Differentiation Medium (with RA) to the 100 mm non-treated culture dish (dedicated to suspension culture).</li>
	<li>Seed the 1 x 106 cells in the 100 mm dish (Dish surface area 56.5 cm2).</li>
	<li>Put the flask with cells into the incubator at 37 &#176;C and 5% CO2 for 2 days in order to promote aggregates formation.</li>
	<li>After 2 days, exchange the Differentiation Medium. Aspirate medium containing aggregates using a 10 mL pipette and transfer to a 15 mL tube at RT.</li>
	<li>Allow the aggregates to settle by gravity for 1.5 min at RT.</li>
	<li>Discard the supernatant.</li>
	<li>Add a fresh 10 mL of Differentiation Medium with 0.5 &#181;M RA using a 10 mL serological pipette. 
	CAUTION: Do not pipette the cell aggregates up and down.</li>
	<li>Seed the aggregates into new 100 mm non-treated culture dish (dedicated to suspension culture).</li>
	<li>Place the plate in the incubator (at 37 &#176;C and 5% CO2) for 2 days.</li>
</ol>
5. Aggregates Dissociation
<ol>
	<li>Aspirate the cell aggregates using a 10 mL pipette.</li>
	<li>Transfer the aggregates to a 15 mL tube. Allow the cell aggregates to settle by gravity for 1.5 min.</li>
	<li>Remove the supernatant.</li>
	<li>Wash the aggregates with DMEM alone (serum- and antibiotic- free).</li>
	<li>Allow the cell aggregates to settle by gravity sedimentation for 1.5 min at RT.</li>
	<li>Aspirate the supernatant and add 2 mL of trypsin-EDTA (0.25%).</li>
	<li>Place the cell aggregates into a water bath (37 &#176;C) for 10 min. Agitate the aggregates gently every 2 min by tapping with a hand.</li>
	<li>Stop the trypsinization process by adding 4 mL of Maintenance Medium.</li>
	<li>Pipette aggregates up and down 20 times using 1 mL pipette.</li>
	<li>Centrifuge cells for 5 min at 200 x g and RT.</li>
	<li>Remove the supernatant and resuspend the cell pellet in 5 mL of Maintenance Medium.</li>
	<li>Determine the cell number with a cell counter.</li>
</ol>
6. Plating Cells
<ol>
	<li>Add 3 mL per well of Maintenance Medium to a 6-well plate.</li>
	<li>Seed cells in the 6-well culture plate at a density of 0.5 x 106/well.</li>
	<li>Incubate at 37 &#176;C with 5% CO2 concentration.</li>
	<li>Seed the cells on cover glass in 6 well culture plate and perform immunostaining with anti-MAP2 antibody (20% confluence). Use 6-well plate to isolate RNA and perform RT-PCR for Map2, NeuN, Oct4, Nanog, and Gapdh (20% confluence).</li>
</ol>

<ol>
	<li>Ramkumar, N., Anderson, K. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SnapShot:+mouse+primitive+streak.">SnapShot: mouse primitive streak.</a> Cell. 146 (3), 488 (2011).</li><li>Solnica-Krezel, L., Sepich, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gastrulation:+making+and+shaping+germ+layers.">Gastrulation: making and shaping germ layers.</a> Annual Review of Cell and Developmental Biology. 28, 687-717 (2012).</li><li>Tam, P. P. L., Gad, J. M., Stern, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+16:+Gastrulation+in+the+Mouse+Embryo.">Chapter 16: Gastrulation in the Mouse Embryo.</a> Gastrulation: From Cells to Embryo. , 233-262 (2004).</li><li>Sajini, A. A., Greder, L. V., Dutton, J. R., Slack, J. M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+Oct4+expression+during+the+development+of+murine+embryoid+bodies.">Loss of Oct4 expression during the development of murine embryoid bodies.</a> Developmental Biology. 371 (2), 170-179 (2012).</li><li>ten Berge, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wnt+Signaling+Mediates+Self-Organization+and+Axis+Formation+in+Embryoid+Bodies.">Wnt Signaling Mediates Self-Organization and Axis Formation in Embryoid Bodies.</a> Cell Stem Cell. 3 (5), 508-518 (2008).</li><li>Bain, G., Ray, W. J., Yao, M., Gottlieb, D. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=From+embryonal+carcinoma+cells+to+neurons:+the+P19+pathway.">From embryonal carcinoma cells to neurons: the P19 pathway.</a> Bioessays. 16 (5), 343-348 (1994).</li><li>Lin, Y. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=YAP+regulates+neuronal+differentiation+through+Sonic+hedgehog+signaling+pathway.">YAP regulates neuronal differentiation through Sonic hedgehog signaling pathway.</a> Experimental Cell Research. 318 (15), 1877-1888 (2012).</li><li>Neo, W. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+miR-124+controls+the+choice+between+neuronal+and+astrocyte+differentiation+by+fine-tuning+Ezh2+expression.">MicroRNA miR-124 controls the choice between neuronal and astrocyte differentiation by fine-tuning Ezh2 expression.</a> Journal of Biological Chemistry. 289 (30), 20788-20801 (2014).</li><li>Jones-Villeneuve, E., McBurney, M. W., Rogers, K. A., Kalnins, V. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoic+acid+induces+embryonal+carcinoma+cells+to+differentiate+into+neurons+and+glial+cells.">Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells.</a> The Journal of Cell Biology. 94 (2), 253-262 (1982).</li><li>McBurney, M. W., Rogers, B. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+male+embryonal+carcinoma+cells+and+their+chromosome+replication+patterns.">Isolation of male embryonal carcinoma cells and their chromosome replication patterns.</a> Developmental Biology. 89 (2), 503-508 (1982).</li><li>Jones-Villeneuve, E., Rudnicki, M. A., Harris, J. F., McBurney, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoic+acid-induced+neural+differentiation+of+embryonal+carcinoma+cells.">Retinoic acid-induced neural differentiation of embryonal carcinoma cells.</a> Molecular and Cellular Biology. 3 (12), 2271-2279 (1983).</li><li>Jasmin, D. C., Spray, A. C., Campos de Carvalho, R., Mendez-Otero, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+induction+of+cardiac+differentiation+in+P19+embryonal+carcinoma+stem+cells.">Chemical induction of cardiac differentiation in P19 embryonal carcinoma stem cells.</a> Stem Cells and Development. 19 (3), 403-412 (2010).</li><li>Solari, M., Paquin, J., Ducharme, P., Boily, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=P19+neuronal+differentiation+and+retinoic+acid+metabolism+as+criteria+to+investigate+atrazine,+nitrite,+and+nitrate+developmental+toxicity.">P19 neuronal differentiation and retinoic acid metabolism as criteria to investigate atrazine, nitrite, and nitrate developmental toxicity.</a> Toxicological Sciences. 113 (1), 116-126 (2010).</li><li>Babuska, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+P19+cells+during+retinoic+acid+induced+differentiation.">Characterization of P19 cells during retinoic acid induced differentiation.</a> Prague Medical Report. 111 (4), 289-299 (2010).</li><li>Monzo, H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+method+for+generating+high-yield+enriched+neuronal+cultures+from+P19+embryonal+carcinoma+cells.">A method for generating high-yield enriched neuronal cultures from P19 embryonal carcinoma cells.</a> Journal of Neuroscience Methods. 204 (1), 87-103 (2012).</li><li>Popova, D., Karlsson, J., Jacobsson, S. O. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+neurons+derived+from+mouse+P19,+rat+PC12+and+human+SH-SY5Y+cells+in+the+assessment+of+chemical-+and+toxin-induced+neurotoxicity.">Comparison of neurons derived from mouse P19, rat PC12 and human SH-SY5Y cells in the assessment of chemical- and toxin-induced neurotoxicity.</a> BMC Pharmacology and Toxicology. 18 (1), 42 (2017).</li><li>Woodgate, A., MacGibbon, G., Walton, M., Dragunow, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+toxicity+of+6-hydroxydopamine+on+PC12+and+P19+cells.">The toxicity of 6-hydroxydopamine on PC12 and P19 cells.</a> Molecular Brain Research. 69 (1), 84-92 (1999).</li><li>Tsukane, M., Yamauchi, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ca2+/calmodulin-dependent+protein+kinase+II+mediates+apoptosis+of+P19+cells+expressing+human+tau+during+neural+differentiation+with+retinoic+acid+treatment.">Ca2+/calmodulin-dependent protein kinase II mediates apoptosis of P19 cells expressing human tau during neural differentiation with retinoic acid treatment.</a> Journal of Enzyme Inhibition and Medicinal Chemistry. 24 (2), 365-371 (2009).</li><li>Adler, S., Pellizzer, C., Paparella, M., Hartung, T., Bremer, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+effects+of+solvents+on+embryonic+stem+cell+differentiation.">The effects of solvents on embryonic stem cell differentiation.</a> Toxicology in Vitro. 20 (3), 265-271 (2006).</li><li>Jones-Villeneuve, E. M., McBurney, M. W., Rogers, K. A., Kalnins, V. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retinoic+acid+induces+embryonal+carcinoma+cells+to+differentiate+into+neurons+and+glial+cells.">Retinoic acid induces embryonal carcinoma cells to differentiate into neurons and glial cells.</a> The Journal of Cell Biology. 94 (2), 253-262 (1982).</li><li>Roy, B., Taneja, R., Chambon, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synergistic+activation+of+retinoic+acid+(RA)-responsive+genes+and+induction+of+embryonal+carcinoma+cell+differentiation+by+an+RA+receptor+alpha+(RAR+alpha)-,+RAR+beta-,+or+RAR+gamma-selective+ligand+in+combination+with+a+retinoid+X+receptor-specific+ligand.">Synergistic activation of retinoic acid (RA)-responsive genes and induction of embryonal carcinoma cell differentiation by an RA receptor alpha (RAR alpha)-, RAR beta-, or RAR gamma-selective ligand in combination with a retinoid X receptor-specific ligand.</a> Molecular and Cellular Biology. 15 (12), 6481-6487 (1995).</li><li>Hamada-Kanazawa, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sox6+overexpression+causes+cellular+aggregation+and+the+neuronal+differentiation+of+P19+embryonic+carcinoma+cells+in+the+absence+of+retinoic+acid.">Sox6 overexpression causes cellular aggregation and the neuronal differentiation of P19 embryonic carcinoma cells in the absence of retinoic acid.</a> FEBS Letters. 560 (1-3), 192-198 (2004).</li><li>Tangsaengvit, N., Kitphati, W., Tadtong, S., Bunyapraphatsara, N., Nukoolkarn, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurite+Outgrowth+and+Neuroprotective+Effects+of+Quercetin+from+Caesalpinia+mimosoides+Lamk+on+Cultured+P19-Derived+Neurons.">Neurite Outgrowth and Neuroprotective Effects of Quercetin from Caesalpinia mimosoides Lamk on Cultured P19-Derived Neurons.</a> Evidence-Based Complementary and Alternative. , 838051 (2013).</li><li>Magnuson, D. S., Morassutti, D. J., McBurney, M. W., Marshall, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neurons+derived+from+P19+embryonal+carcinoma+cells+develop+responses+to+excitatory+and+inhibitory+neurotransmitters.">Neurons derived from P19 embryonal carcinoma cells develop responses to excitatory and inhibitory neurotransmitters.</a> Developmental Brain Research. 90 (1-2), 141-150 (1995).</li><li>MacPherson, P., Jones, S., Pawson, P., Marshall, K., McBurney, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=P19+cells+differentiate+into+glutamatergic+and+glutamate-responsive+neurons+in+vitro.">P19 cells differentiate into glutamatergic and glutamate-responsive neurons in vitro.</a> Neuroscience. 80 (2), 487-499 (1997).</li><li>Hong, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methyltransferase-inhibition+interferes+with+neuronal+differentiation+of+P19+embryonal+carcinoma+cells.">Methyltransferase-inhibition interferes with neuronal differentiation of P19 embryonal carcinoma cells.</a> Biochemical and Biophysical Research Communications. 377 (3), 935-940 (2008).</li><li>Wenzel, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+classic+nuclear+localization+signal+at+the+N+terminus+that+regulates+the+subcellular+localization+of+Rbfox2+isoforms+during+differentiation+of+NMuMG+and+P19+cells.">Identification of a classic nuclear localization signal at the N terminus that regulates the subcellular localization of Rbfox2 isoforms during differentiation of NMuMG and P19 cells.</a> FEBS Letters. 590 (24), 4453-4460 (2016).</li><li>Harada, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overexpression+of+Cathepsin+E+Interferes+with+Neuronal+Differentiation+of+P19+Embryonal+Teratocarcinoma+Cells+by+Degradation+of+N-cadherin.">Overexpression of Cathepsin E Interferes with Neuronal Differentiation of P19 Embryonal Teratocarcinoma Cells by Degradation of N-cadherin.</a> Cellular and Molecular Neurobiology. 37 (3), 437-443 (2017).</li><li>Morassutti, D. J., Staines, W. A., Magnuson, D. S., Marshall, K. C., McBurney, M. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+embryonal+carcinoma-derived+neurons+survive+and+mature+following+transplantation+into+adult+rat+striatum.">Murine embryonal carcinoma-derived neurons survive and mature following transplantation into adult rat striatum.</a> Neuroscience. 58 (4), 753-763 (1994).</li><li>Magnuson, D. S., Morassutti, D. J., Staines, W. A., McBurney, M. W., Marshall, K. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+electrophysiological+maturation+of+neurons+derived+from+a+multipotent+precursor+(embryonal+carcinoma)+cell+line.">In vivo electrophysiological maturation of neurons derived from a multipotent precursor (embryonal carcinoma) cell line.</a> Developmental Brain Research. 84 (1), 130-141 (1995).</li></ol>

The authors have nothing to disclose.

Here, we describe a simple protocol for neurogenesis using the P19 cell line. Although many reports have been published in this regard, a detailed methodology for neurogenesis induction using P19 cell line remains unclear. Moreover, we utilized a simple high glucose (4,500 mg/L) DMEM medium with 10% FBS for the entire experiment. This allowed us to perform the neurogenic experiment in a user-friendly manner and expand the usage of this method for the future.
The most critical points within this protocol are the RA concentration as well as the generation of cell aggregates in the suspension culture. The stimulation of neurogenesis in the P19 cell line can be carried out without the formation of aggregates, but the number of neuronal cells produced will be reduced by two-thirds in the cell culture22. Monzo et al. have shown neurogenesis induction in P19 cell line by culturing them in monolayer15. Although their method is quite convenient as we can eliminate suspension culture process, further studies are required to compare their method with other well-described methods.The RA concentration of 0.5 &#181;M in the medium produced a high number of cell aggregates as well as neurons after plating as compared to 1 &#181;M of RA. It is also important to note that we could not observe an efficient neurogenesis when most of the aggregates are attached to the bottom of the suspension culture dish during RA treatment. The optimal number of the P19 cell line to be used at the beginning of the procedure is 1 x 106 for every 10 mL of Differentiation Medium. During the induction of neurogenesis, the P19 cell line forms varying sized aggregates and even single cells are found in the culture. To overcome this problem, we collected the cell aggregates after 1.5 min of free fall in a 15 mL tube. We found that this approach allows the exclusion of contamination of single cells. It is also recommended to perform neuronal enrichment with the cell culture using anti-mitotic drugs (e.g., cytosine arabinoside) for long term culture to inhibit extensive proliferation of glial cells23.
Neurons derived from the P19 cell line express ionotropic glutamate receptors of both N-methyl-D-aspartate (NMDA) and alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA)/kainite (KA) types24,25, as well as functional &#947;-aminobutyric acid (GABA) receptors25. Therefore, the P19 cell line is widely used in the studies on molecular mechanisms governing neuronal differentiation26,27,28. More importantly, the tumor development was not observed after cell transplantation29,30.
To this end, research on neurodegenerative diseases such as Alzheimer&#39;s disease17,18 is also conducted using P19 cell line, and we believe that the method developed in this study will thus play a part in elucidating the molecular mechanisms in neurodevelopmental abnormalities and neurodegenerative diseases.

During embryonal development, a single cell layer is transformed into three separate germ layers1,2,3. To increase the research possibilities of phenomena occurring in vivo, generation of three-dimensional aggregates (embryonic bodies) have been developed as a convenient model. Cellular aggregates formed in this way can be exposed to various conditions causing cell differentiation, which reflect development of the embryo4,5. The P19 murine embryonic carcinoma cell line (P19 cell line) is commonly used as a cellular model for neurogenesis studies in vitro6,7,8. The P19 cell line exhibits typical pluripotent stem cell features and can differentiate into neurons in the presence of retinoic acid (RA) during cell aggregation followed by neurite outgrowth under adherent conditions. Moreover, the undifferentiated P19 cell line is also capable of forming muscle- and cardiomyocyte-like cells under the influence of dimethyl sulfoxide (DMSO)9,10,11,12.
Many methods13,14,15,16 have been reported for neuronal differentiation, but the methodology is sometimes complicated and not easy to grasp by only reading the descriptions. For example, protocols sometimes require a combination of Dulbecco&#39;s Modified Eagle Medium (DMEM) medium supplemented with a mixture of calf serum (CS) and fetal bovine serum (FBS)13. Moreover, media used for neuronal development are often composed of Neurobasal and B27 supplements13,14,15,16. As such, existing methods contain complexity in their preparation and our goal here is to simplify the protocols. In this study, we demonstrated that DMEM with FBS can be utilized for maintaining the P19 cell line (DMEM + 10% FBS) as well as for neuronal development (DMEM + 5% FBS + RA). This simplified method for neurogenesis using the P19 cell line allows us to study the molecular mechanism of how neurons are developed. Moreover, research on neurodegenerative diseases such as Alzheimer&#39;s disease is also conducted using P19 cell line17,18, and we believe that the method developed in this study will play a part in elucidating the molecular mechanisms in neurodevelopmental abnormalities and neurodegenerative diseases.

<table><tbody><tr><td>6x DNA Loading Dye</td><td>EURx</td><td>E0260-01</td><td></td></tr><tr><td>Agarose</td><td>Sigma- Aldrich</td><td>A9539</td><td></td></tr><tr><td>cDNA synthesis kit</td><td>EURx</td><td>E0801-02</td><td></td></tr><tr><td>DAPI (4&amp;prime;,6-Diamidine-2&amp;prime;-phenylindole dihydrochloride)</td><td>Sigma- Aldrich</td><td>10236276001</td><td>Working concentration: 1 &amp;mu;g/mL</td></tr><tr><td>DMEM high glucose (4.5 g/L) with L-glutamine</td><td>Lonza</td><td>BE12-604Q</td><td></td></tr><tr><td>Ethanol 99.8%</td><td>Chempur</td><td>CHEM*613964202</td><td></td></tr><tr><td>Fetal Bovine Serum (FBS)</td><td>EURx</td><td>E5050-03</td><td></td></tr><tr><td>MAP2 antibody</td><td>Thermo Fisher Scientific</td><td>PA517646</td><td>Dilution 1:100</td></tr><tr><td>PCR reaction kit</td><td>EURx</td><td>E0411-03</td><td></td></tr><tr><td>Penicillin/Streptomycin 10K/10K</td><td>Lonza</td><td>DE17-602E</td><td></td></tr><tr><td>Phosphate Buffered Saline (PBS), 1x concentrated without Ca&lt;sup&gt;2+&lt;/sup&gt;, Mg&lt;sup&gt;2+&lt;/sup&gt;</td><td>Lonza</td><td>BE17- 517Q</td><td></td></tr><tr><td>Retinoic acid</td><td>Sigma- Aldrich</td><td>R2625-50MG</td><td>&amp;nbsp;dissolved in 99.8% ethanol; store in -20 &amp;deg;C up to 6 months</td></tr><tr><td>Secondary Antibody (Alexa Fluor 488)</td><td>Thermo Fisher Scientific</td><td>A11034</td><td>Dilution 1:500</td></tr><tr><td>Skim milk</td><td>Sigma- Aldrich</td><td>1153630500</td><td></td></tr><tr><td>TBE Buffer</td><td>Thermo Fisher Scientific</td><td>B52</td><td></td></tr><tr><td>Triton-X 100</td><td>Sigma- Aldrich</td><td>T8787-100ML</td><td></td></tr><tr><td>Trypsin 0.25% - EDTA in HBSS, without&amp;nbsp; Ca&lt;sup&gt;2+&lt;/sup&gt;, Mg&lt;sup&gt;2+&lt;/sup&gt;,with Phenol Red</td><td>biosera</td><td>LM-T1720/500</td><td></td></tr><tr><td>Cell Culture Plastics</td><td></td><td></td><td></td></tr><tr><td>1 mL Serological Pipettes</td><td>Profilab</td><td>515.01</td><td></td></tr><tr><td>10 mL Serological Pipettes</td><td>Profilab</td><td>515.10</td><td></td></tr><tr><td>100 mm dish dedicated for suspension culture</td><td>Corning</td><td>C351029</td><td></td></tr><tr><td>15 mL centrifuge tubes</td><td>Sigma- Aldrich</td><td>CLS430791-500EA</td><td></td></tr><tr><td>5 mL Serological Pipettes</td><td>Profilab</td><td>515.05</td><td></td></tr><tr><td>6-well plate</td><td>Corning</td><td>CLS3516</td><td></td></tr><tr><td>Cell culture flasks, surface area 25 cm&lt;sup&gt;2&lt;/sup&gt;</td><td>Sigma- Aldrich</td><td>CLS430639-200EA</td><td></td></tr></tbody></table>

neurogenesis using p19 embryonal carcinoma cells

The P19 cell line derived from a mouse embryo-derived teratocarcinoma has the ability to differentiate into the three germ layers. In the presence of retinoic acid (RA), the suspension cultured P19 cell line is induced to differentiate into neurons. This phenomenon is extensively investigated as a neurogenesis model in vitro. Therefore, the P19 cell line is very useful for molecular and cellular studies associated with neurogenesis. However, protocols for neuronal differentiation of P19 cell line described in the literature are very complex. The method developed in this study are simple and will play a part in elucidating the molecular mechanisms in neurodevelopmental abnormalities and neurodegenerative diseases.

The simplified scheme of protocol for neurogenesis induction in P19 cell line is presented in Figure 1. In order to define the character of the P19 cell line in an undifferentiated state and during neurogenesis, the RT-PCR (reverse transcription-polymerase chain reaction) method was used. The undifferentiated P19 cell line expressed the pluripotency genes such as organic cation/carnitine transporter4 (Oct4) and Nanog homeobox (Nanog). Neurogenesis induced by cells aggregation in suspension culture in the presence of RA led to a rapid decrease of Oct4 and Nanog expression. In contrary, expression of neuron markers: microtubule-associated protein 2 (Map2), NeuN (also known as RNA binding protein, fox-1 homolog 3 (Rbfox3)) increased after triggered neurogenesis (Figure 2)6,14,15,22. The primers used for each gene are indicated along with nucleotide sequencesand the size of the product in Table 1. A microscopic image of the undifferentiated P19 cell line presented a round-shaped morphology (Figure 3A). After induction of neurogenesis, the neuronal structure of the cells was clearly visible 4 days after plating (Figure 3B). Additionally, Figure 4 represents the fluorescence image of MAP2 expression in the differentiated P19 cell line (4 days after plating cells)14.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58225/58225fig1v2.jpg" /> 
Figure 1: Protocol schematic for induction of neurogenesis in P19 embryonal carcinoma cells. Neurogenesis is induced by culturing the P19 cell line in a 100 mm non-treated culture dish with 5% of FBS and 0.5 &#181;M RA. After 4 days, the cell aggregates are dissociated with trypsin and seeded on adherent cell culture plate for following next 4 days. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58225/58225fig1v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58225/58225fig2.jpg" /> 
Figure 2: Changes of gene expression in P19 cell line. The band graph represents gene expression for undifferentiated P19 cell line (Oct4, Nanog) and during neurogenesis (Map2, NeuN). Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) was used as the reference gene. Samples are loaded in the agarose gel (1.5%) in double replications. Abbreviations: Undifferentiated represents the undifferentiated P19 cell line without RA treatment; Day 1-4 represents subsequent days after cell plating- following 4 days after RA treatment and cell aggregation stage. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58225/58225fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58225/58225fig3.jpg" /> 
Figure 3: Representative images of analysis of P19 cell line. (A) Light microscopic images of undifferentiated P19 cell line. (B) Light microscopic images of P19 cell line after 4 days of neurogenesis- following 4 days after RA treatment and cell aggregation stage. Scale bar = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58225/58225fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58225/58225fig4.jpg" /> 
Figure 4: Representative immunofluorescence image of differentiated P19 cell line. Merged immunofluorescence image of P19 cell line stained with anti-MAP2 and DAPI at 4 days after plating. Scale bar = 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/58225/58225fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Primer sequence</td>
			<td>Product 
			size (bp)</td>
		</tr>
		<tr>
			<td>Gapdh</td>
			<td>F: TGACCTCAACTACATGGTCTACA 
			R: CTTCCCATTCTCGGCCTTG</td>
			<td>85</td>
		</tr>
		<tr>
			<td>Map2</td>
			<td>F: GCTGAGATCATCACACAGTC 
			R: TCCTGCCAAGAGCTCATGCC</td>
			<td>211</td>
		</tr>
		<tr>
			<td>Oct4</td>
			<td>F: GGCGTTCTCTTTGGAAAGGTGTTC 
			R: CTCGAACCACATCCTTCTCT</td>
			<td>313</td>
		</tr>
		<tr>
			<td>NeuN</td>
			<td>F: GGCAAATGTTCGGGCAATTCG 
			R: TCAATTTTCCGTCCCTCTACGAT</td>
			<td>160</td>
		</tr>
		<tr>
			<td>Nanog</td>
			<td>F: AAAGGATGAAGTGCAAGCGGTGG 
			R: CTGGCTTTGCCCTGACTTTAAGC</td>
			<td>520</td>
		</tr>
	</tbody>
</table>
Table 1: Primers used for RT-PCR.

Watch this Scientific Journal Video about Neurogenesis Using P19 Embryonal Carcinoma Cells at JoVE.com

Neurogenesis Using P19 Embryonal Carcinoma Cells

The P19 mouse embryonic carcinoma cell line (P19 cell line) is widely used for studying the molecular mechanism of neurogenesis with great simplification compared to in vivo analysis. Here, we present a protocol for retinoic acid-induced neurogenesis in the P19 cell line.

The P19 cell line derived from a mouse embryo-derived teratocarcinoma has the ability to differentiate into the three germ layers. In the presence of ...

neurogenesis-using-p19-embryonal-carcinoma-cells

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

10.8K Views.  Polish Academy of Sciences. P19 cellijn is bekend te onderscheiden in neuronen. Echter, protocol voor neuron differentiatie van P19 cellijn zijn soms ingewikkeld. Deze methode stelt ons in staat om het neurogene experiment op een gebruiksvriendelijke manier uit te voeren en de mogelijkheid van het gebruik van P19-cellijn voor de toekomst uit te breiden.Om te beginnen, handhaven P19 cellen in onderhoud medium, bestaande uit DMEM, met 4,5 gram per liter glucose, aangevuld met 10% foetale runder serum, 100 eenheden ...

Video: Neurogenesis Using P19 Embryonal Carcinoma Cells

An Enzyme- and Serum-free Neural Stem Cell Culture Model for EMT Investigation Suited for Drug Discovery

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during embryonic development that also commonly occurs in glioblastoma, the most frequent malignant brain tumor. EMT has also been observed in multiple carcinomas outside the brain including breast cancer, lung cancer, colon cancer, gastric cancer. EMT is centrally linked to malignancy by promoting migration, invasion and metastasis formation. The mechanisms of EMT induction are not fully understood. Here we describe an in vitro system for standardized isolation of cortical neural stem cells (NSCs) and subsequent EMT-induction. This system provides the flexibility to use either single cells or explant culture. In this system, rat or mouse embryonic forebrain NSCs are cultured in a defined medium, devoid of serum and enzymes. The NSCs expressed Olig2 and Sox10, two transcription factors observed in oligodendrocyte precursor cells (OPCs). Using this system, interactions between FGF-, BMP- and TGF&#946;-signaling involving Zeb1, Zeb2, and Twist2 were observed where TGF&#946;-activation significantly enhanced cell migration, suggesting a synergistic BMP-/TGF&#946;-interaction. The results point to a network of FGF-, BMP- and TGF&#946;-signaling to be involved in EMT induction and maintenance. This model system is relevant to investigate EMT in vitro. It is cost-efficient and shows high reproducibility. It also allows for the comparison of different compounds with respect to their migration responses (quantitative distance measurement), and high-throughput screening of compounds to inhibit or enhance EMT (qualitative measurement). The model is therefore well suited to test drug libraries for substances affecting EMT.

Epithelial to mesenchymal transition (EMT) allows cancers to become invasive. To investigate EMT, a neural stem cell (NSC)-based in vitro model devoid of serum and enzymes is described. This standardized system allows quantitative and qualitative assessment of cell migration, gene and protein expression. The model is suited for drug discovery.

Epithelial to mesenchymal transition (EMT) describes the process of epithelium transdifferentiating into mesenchyme. EMT is a fundamental process during ...

Generation of Neural Stem Cells from Discarded Human Fetal Cortical Tissue

Neural stem cells (NSCs) reside along the ventricular zone neuroepithelium during the development of the cortical plate. These early progenitors ultimately give rise to intermediate progenitors and later, the various neuronal and glial cell subtypes that form the cerebral cortex. The capacity to generate and expand human NSCs (so called neurospheres) from discarded normal fetal tissue provides a means with which to directly study the functional aspects of normal human NSC development 1-5. This approach can also be directed toward the generation of NSCs from known neurological disorders, thereby affording the opportunity to identify disease processes that alter progenitor proliferation, migration and differentiation 6-9. We have focused on identifying pathological mechanisms in human Down syndrome NSCs that might contribute to the accelerated Alzheimer's disease phenotype 10,11. Neither in vivo nor in vitro mouse models can replicate the identical repertoire of genes located on human chromosome 21. 
Here we use a simple and reliable method to isolate Down syndrome NSCs from aborted human fetal cortices and grow them in culture. The methodology provides specific aspects of harvesting the tissue, dissection with limited anatomical landmarks, cell sorting, plating and passaging of human NSCs. We also provide some basic protocols for inducing differentiation of human NSCs into more selective cell subtypes.

A simple and reliable method on isolation and culture of neural stem cells from discarded human fetal cortical tissue is described. Cultures derived from known human neurological disorders can be used for characterization of pathological cellular and molecular processes, as well as provide a platform to assess pharmacological efficacy.

Neural stem cells (NSCs) reside along the ventricular zone neuroepithelium during the development of the cortical plate. These early progenitors ...

Neuroscience

Intraventricular Transplantation of Engineered Neuronal Precursors for In Vivo Neuroarchitecture Studies

Gene control of neuronal cytoarchitecture is currently the subject of intensive investigation. Described here is a simple method developed to study in vivo gene control of neocortical projection neuron morphology. This method is based on (1) in vitro lentiviral engineering of neuronal precursors as "test" and "control" cells, (2) their co-transplantation into wild-type brains, and (3) paired morphometric evaluation of their neuronal derivatives. Specifically, E12.5 pallial precursors from panneuronal, genetically labeled donors, are employed for this purpose. They are engineered to take advantage of selected promoters and tetON/OFF technology, and they are free-hand transplanted into neonatal lateral ventricles. Later, upon immunofluorescence profiling of recipient brains, silhouettes of transplanted neurons are fed into NeurphologyJ open source software, their morphometric parameters are extracted, and average length and branching index are calculated. Compared to other methods, this one offers three main advantages: it permits achieving of fine control of transgene expression at affordable costs, it only requires basic surgical skills, and it provides statistically reliable results upon analysis of a limited number of animals. Because of its design, however, it is not adequate to address non cell-autonomous control of neuroarchitecture. Moreover, it should be preferably used to investigate neurite morphology control after completion of neuronal migration. In its present formulation, this method is exquisitely tuned to investigate gene control of glutamatergic neocortical neuron architecture. Taking advantage of transgenic lines expressing EGFP in other specific neural cell types, it can be re-purposed to address gene control of their architecture.

Based on in vitro lentiviral engineering of neuronal precursors, their co-transplantation into wild-type brains and paired morphometric evaluation of "test" and "control" derivatives, this method allows accurate modeling of in vivo gene control of neocortical neuron morphology in a simple and affordable way.

Gene control of neuronal cytoarchitecture is currently the subject of intensive investigation. Described here is a simple method developed to study in ...

Genetics

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for tissue formation during embryonic development and tissue homeostasis during adulthood 1. Currently, great efforts are invested towards controlling the switch of somatic stem cells from expansion to differentiation because this is thought to be fundamental for developing novel strategies for regenerative medicine 1,2. However, a major challenge in the study and use of somatic stem cell is that their expansion has been proven very difficult to control.
Here we describe a system that allows the control of neural stem/progenitor cell (altogether referred to as NSC) expansion in the mouse embryonic cortex or the adult hippocampus by manipulating the expression of the cdk4/cyclinD1 complex, a major regulator of the G1 phase of the cell cycle and somatic stem cell differentiation 3,4. Specifically, two different approaches are described by which the cdk4/cyclinD1 complex is overexpressed in NSC in vivo. By the first approach, overexpression of the cell cycle regulators is obtained by injecting plasmids encoding for cdk4/cyclinD1 in the lumen of the mouse telencephalon followed by in utero electroporation to deliver them to NSC of the lateral cortex, thus, triggering episomal expression of the transgenes 5-8. By the second approach, highly concentrated HIV-derived viruses are stereotaxically injected in the dentate gyrus of the adult mouse hippocampus, thus, triggering constitutive expression of the cell cycle regulators after integration of the viral construct in the genome of infected cells 9. Both approaches, whose basic principles were already described by other video protocols 10-14, were here optimized to i) reduce tissue damage, ii) target wide portions of very specific brain regions, iii) obtain high numbers of manipulated cells within each region, and iv) trigger high expression levels of the transgenes within each cell. Transient overexpression of the transgenes using the two approaches is obtained by different means i.e. by natural dilution of the electroporated plasmids due to cell division or tamoxifen administration in Cre-expressing NSC infected with viruses carrying cdk4/cyclinD1 flanked by loxP sites, respectively 9,15.
These methods provide a very powerful platform to acutely and tissue-specifically manipulate the expression of any gene in the mouse brain. In particular, by manipulating the expression of the cdk4/cyclinD1 complex, our system allows the temporal control of NSC expansion and their switch to differentiation, thus, ultimately increasing the number of neurons generated in the mammalian brain. Our approach may be critically important for basic research and using somatic stem cells for therapy of the mammalian central nervous system while providing a better understanding of i) stem cell contribution to tissue formation during development, ii) tissue homeostasis during adulthood, iii) the role of adult neurogenesis in cognitive functions, and perhaps, iv) better using somatic stem cells in models of neurodegenerative diseases.

Expansion of Embryonic and Adult Neural Stem Cells by In Utero Electroporation or Viral Stereotaxic Injection

Controlling the expansion of somatic stem cells is a major factor hampering their study and use in therapy. Here we describe a system to temporally control neural stem cells expansion during development and adulthood, which can be used to increase the number of neurons generated in the mouse brain.

Somatic stem cells can divide to generate additional stem cells (expansion) or more differentiated cell types (differentiation), which is fundamental for ...

Neonatal Subventricular Zone Electroporation

Neural stem cells (NSCs) line the postnatal lateral ventricles and give rise to multiple cell types which include neurons, astrocytes, and ependymal cells1. Understanding the molecular pathways responsible for NSC self-renewal, commitment, and differentiation is critical for harnessing their unique potential to repair the brain and better understand central nervous system disorders. Previous methods for the manipulation of mammalian systems required the time consuming and expensive endeavor of genetic engineering at the whole animal level2. Thus, the vast majority of studies have explored the functions of NSC molecules in vitro or in invertebrates.
Here, we demonstrate the simple and rapid technique to manipulate neonatal NPCs that is referred to as neonatal subventricular zone (SVZ) electroporation. Similar techniques were developed a decade ago to study embryonic NSCs and have aided studies on cortical development3,4 . More recently this was applied to study the postnatal rodent forebrain5-7. This technique results in robust labeling of SVZ NSCs and their progeny. Thus, postnatal SVZ electroporation provides a cost and time effective alternative for mammalian NSC genetic engineering.

We demonstrate a minimally invasive technique referred to as neonatal subventricular zone electroporation. The technique consists of injecting plasmid DNA into the lateral ventricles of neonatal pups and applying electrical current to deliver and genetically manipulate neural stem cells

Neural stem cells (NSCs) line the postnatal lateral ventricles and give rise to multiple cell types which include neurons, astrocytes, and ependymal ...

A cGMP-applicable Expansion Method for Aggregates of Human Neural Stem and Progenitor Cells Derived From Pluripotent Stem Cells or Fetal Brain Tissue

A cell expansion technique to amass large numbers of cells from a single specimen for research experiments and clinical trials would greatly benefit the stem cell community. Many current expansion methods are laborious and costly, and those involving complete dissociation may cause several stem and progenitor cell types to undergo differentiation or early senescence. To overcome these problems, we have developed an automated mechanical passaging method referred to as &#8220;chopping&#8221; that is simple and inexpensive. This technique avoids chemical or enzymatic dissociation into single cells and instead allows for the large-scale expansion of suspended, spheroid cultures that maintain constant cell/cell contact. The chopping method has primarily been used for fetal brain-derived neural progenitor cells or neurospheres, and has recently been published for use with neural stem cells derived from embryonic and induced pluripotent stem cells. The procedure involves seeding neurospheres onto a tissue culture Petri dish and subsequently passing a sharp, sterile blade through the cells effectively automating the tedious process of manually mechanically dissociating each sphere. Suspending cells in culture provides a favorable surface area-to-volume ratio; as over 500,000 cells can be grown within a single neurosphere of less than 0.5 mm in diameter. In one T175 flask, over 50 million cells can grow in suspension cultures compared to only 15 million in adherent cultures. Importantly, the chopping procedure has been used under current good manufacturing practice (cGMP), permitting mass quantity production of clinical-grade cell products.

This protocol describes a novel mechanical chopping method that allows the expansion of spherical neural stem and progenitor cell aggregates without dissociation to a single cell suspension.&#160; Maintaining cell/cell contact allows rapid and stable growth for over 40 passages.

A cell expansion technique to amass large numbers of cells from a single specimen for research experiments and clinical trials would greatly benefit the ...

Neonatal Pial Surface Electroporation

Over the past several years the pial surface has been identified as a germinal niche of importance during embryonic, perinatal and adult neuro- and gliogenesis, including after injury. However, methods for genetically interrogating these progenitor populations and tracking their lineages had been limited owing to a lack of specificity or time consuming production of viruses. Thus, progress in this region has been relatively slow with only a handful of investigations of this location. Electroporation has been used for over a decade to study neural stem cell properties in the embryo, and more recently in the postnatal brain. Here we describe an efficient, rapid, and simple technique for the genetic manipulation of pial surface progenitors based on an adapted electroporation approach. Pial surface electroporation allows for facile genetic labeling and manipulation of these progenitors, thus representing a time-saving and economical approach for studying these cells.

The pial surface is a unique progenitor zone in the CNS that is receiving increasing attention. Herein, we detail a method for rapid genetic manipulation of this progenitor zone using a modified electroporation method. This procedure can be used for cellular and molecular investigations of cell lineages and signaling pathways involved in cell differentiation and to elucidate the fate and properties of daughter cells.

Over the past several years the pial surface has been identified as a germinal niche of importance during embryonic, perinatal and adult neuro- and ...

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease pathogenesis and their utility for preclinical drug development. In order to design a better model system for these applications, phenotypically wild-type cortical astrocytes and neural stem cells (NSC) from conditional, genetically engineered mice (GEM) that harbor various combinations of floxed oncogenic alleles were harvested and grown in culture. Genetic recombination was induced in vitro using adenoviral Cre-mediated recombination, resulting in expression of mutated oncogenes and deletion of tumor suppressor genes. The phenotypic consequences of these mutations were defined by measuring proliferation, transformation, and drug response in vitro. Orthotopic allograft models, whereby transformed cells are stereotactically injected into the brains of immune-competent, syngeneic littermates, were developed to define the role of oncogenic mutations and cell type on tumorigenesis in vivo. Unlike most established human glioblastoma cell line xenografts, injection of transformed GEM-derived cortical astrocytes into the brains of immune-competent littermates produced astrocytomas, including the most aggressive subtype, glioblastoma, that recapitulated the histopathological hallmarks of human astrocytomas, including diffuse invasion of normal brain parenchyma. Bioluminescence imaging of orthotopic allografts from transformed astrocytes engineered to express luciferase was utilized to monitor in vivo tumor growth over time. Thus, astrocytoma models using astrocytes and NSC harvested from GEM with conditional oncogenic alleles provide an integrated system to study the genetics and cell biology of astrocytoma pathogenesis in vitro and in vivo and may be useful in preclinical drug development for these devastating diseases.

Modeling Astrocytoma Pathogenesis In Vitro and In Vivo Using Cortical Astrocytes or Neural Stem Cells from Conditional, Genetically Engineered Mice

Phenotypically wild-type astrocytes and neural stem cells harvested from mice engineered with floxed, conditional oncogenic alleles and transformed via viral Cre-mediated recombination can be used to model astrocytoma pathogenesis in vitro and in vivo by orthotopic injection of transformed cells into brains of syngeneic, immune-competent littermates.

Current astrocytoma models are limited in their ability to define the roles of oncogenic mutations in specific brain cell types during disease ...

In Vivo Targeting of Neural Progenitor Cells in Ferret Neocortex by In Utero Electroporation

Manipulation of gene expression in vivo during embryonic development is the method of choice when analyzing the role of individual genes during mammalian development. In utero electroporation is a key technique for the manipulation of gene expression in the embryonic mammalian brain in vivo. A protocol for in utero electroporation of the embryonic neocortex of ferrets, a small carnivore, is presented here. The ferret is increasingly being used as a model for neocortex development, because its neocortex exhibits a series of anatomical, histological, cellular, and molecular features that are also present in human and nonhuman primates, but absent in rodent models, such as mouse or rat. In utero electroporation was performed at embryonic day (E) 33, a midneurogenesis stage in ferret. In utero electroporation targets neural progenitor cells lining the lateral ventricles of the brain. During neurogenesis, these progenitor cells give rise to all other neural cell types. This work shows representative results and analyses at E37, postnatal day (P) 1, and P16, corresponding to 4, 9, and 24 days after in utero electroporation, respectively. At earlier stages, the progeny of targeted cells consists mainly of various neural progenitor subtypes, whereas at later stages most labeled cells are postmitotic neurons. Thus, in utero electroporation enables the study of the effect of genetic manipulation on the cellular and molecular features of various types of neural cells. Through its effect on various cell populations, in utero electroporation can also be used for the manipulation of histological and anatomical features of the ferret neocortex. Importantly, all these effects are acute and are performed with a spatiotemporal specificity determined by the user.

Presented here is a protocol to perform genetic manipulation in the embryonic ferret brain using in utero electroporation. This method allows for targeting of neural progenitor cells in the neocortex in vivo.

Manipulation of gene expression in vivo during embryonic development is the method of choice when analyzing the role of individual genes during mammalian ...

Neuronal Differentiation from Mouse Embryonic Stem Cells In vitro

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and potentially aid in regenerative medicine. Here, we established an efficient and low cost method for neuronal differentiation from mESCs in vitro, using the strategy of combinatorial screening. Under the conditions defined here, the 2-day embryoid body formation + 6-day retinoic acid induction protocol permits fast and efficient differentiation from mESCs into neural precursor cells (NPCs), as seen by the formation of well-stacked and neurite-like A2lox and 129 derivatives that are Nestin positive. The healthy state of embryoid bodies and the timepoint at which retinoic acid (RA) is applied, as well as the RA concentrations, are critical in the process. In the subsequent differentiation from NPCs into neurons, N2B27 medium II (supplemented by Neurobasal medium) could better support the long term maintenance and maturation of neuronal cells. The presented method is highly efficiency, low cost and easy to operate, and can be a powerful tool for neurobiology and developmental biology research.

Here, we established a low cost and easy to operate method that directs fast and efficient differentiation from embryonic stem cells into neurons. This method is suitable for popularization among laboratories and can be a useful tool for neurological research.

The neural differentiation of mouse embryonic stem cells (mESCs) is a potential tool for elucidating the key mechanisms involved in neurogenesis and ...

Neurogenesis Using P19 Embryonal Carcinoma Cells

Samenvatting

Meer video's verkennen