This work was partly supported by National Institutes of Health (NIH) Grants DA037779 (to J.P.), DA024558, DA30896, DA033892, DA021471, AI22960 and MD007586 (to C.D.). The work was also supported by the RCMI Grant G12MD007586, the Vanderbilt CTSA Grant UL1RR024975, the Meharry Translational Research Center (MeTRC) CTSA grant (U54 RR026140 from NCRR/NIH, the U54 Grant MD007593 from NIMHD/NIH, and the Tennessee Center for AIDS Research (P30 AI110527).

1. Transfection of 3&#39;-biotinylated miRNA
NOTE: Perform the following steps inside a sterile laminar flow hood.
<ol>
	<li>Seed 4 x 105&#8211;5 x 105 HEK-293T cells per well in 2 mL of complete Dulbecco&#39;s Modified Eagle Medium (DMEM) [DMEM supplemented with 10% Fetal Bovine serum (FBS) and 1x Pen-strep antibiotic]. Culture the cells in an incubator set at 37 &#176;C, 5% CO2 overnight.</li>
	<li>The next day, check the health and adherence of the plated cells under a light microscope. 
	NOTE: Make sure the cells have adhered and attained appropriate morphology before proceeding to the next step. The HEK-293T cells are typically ready for transfection 18&#8211;24 h post plating.</li>
	<li>In a sterile 1.7 mL microfuge tube, dilute 75 picomoles of biotinylated miRNA in 200 &#181;L of minimal essential media. Transfer this mix to another 1.7 mL microfuge tube containing Liposome based transfection reagent (8 &#181;L/well) diluted in 200 &#181;L of minimal essential media. Mix thoroughly, but gently, by pipetting and incubate for 20&#8211;25 min at room temperature to allow formation of the transfection complexes.</li>
	<li>Remove the old media from the 6 well culture plate by gentle pipetting and replenish each well with 1.6 mL of freshly prepared complete DMEM (without 1x Pen-strep antibiotics).</li>
	<li>Add the transfection complexes (from 1.3) drop-wise to the cells in the 6-well plate using a well-calibrated pipette. Swirl the plate gently while adding the complexes to ensure their uniform distribution across the plate. 
	NOTE: This step is very critical for achieving high-efficiency transfection and must be performed with care and patience.</li>
	<li>Culture the cells at 37 &#176;C and 5% CO2 for at least 36 h.</li>
</ol>
2. Preparation of Streptavidin Coated Magnetic Beads &#8212; I
<ol>
	<li>Resuspend the streptavidin magnetic beads thoroughly by vortexing. Transfer 30 &#181;L of bead suspension (per sample) to a 2 mL nuclease-free microfuge tube.</li>
	<li>Place the tube containing the bead suspension on the magnetic bead separator stand (&#34;magnet&#34; hereafter) for 2 min. After ensuring that the beads are drawn to the side of the tube in contact with the magnet, carefully remove the supernatant using a micropipette.</li>
	<li>Add 100 &#181;L of bead wash buffer (10 mM Tris-Cl pH 7.5, 0.5 mM EDTA, 1 M NaCl) to the beads. Remove the tube from the magnet. Vortex for 15 s at room temperature to wash the beads.</li>
	<li>Place the tube containing beads on the magnet for 2 min, and carefully remove and discard the supernatant.</li>
	<li>Repeat steps 2.3 and 2.4 for a total of three washes. After the final wash step, remove the tube from the magnet.</li>
	<li>Add 100 &#181;L of RNase freeing solution (0.1 M NaOH, 0.05 M NaCl) to the beads, mix well by vortexing for 15 s, and incubate at room temperature for 5 min. Place the tube containing beads on the magnet for 2 min, and carefully remove and discard the supernatant.</li>
	<li>Repeat step 2.6 for a total of three times.</li>
	<li>Add bead resuspension solution (0.5 M NaCl) to the beads, vortex 15 s, and incubate at room temperature for 5 min. Place the resuspended beads on the magnet for 2 min, and carefully remove the supernatant.</li>
	<li>Add 200 &#181;L of bead blocking solution (1 &#181;g/&#181;L BSA, 2 &#181;g/&#181;L Yeast tRNA) to the beads. Mix by gentle vortexing for 15 s at room temperature. Incubate at 4 &#176;C for 16 h (over-night) on a multi-tube rotator.</li>
</ol>
3. Preparation of Cell Lysates
<ol>
	<li>Harvest the transfected HEK-293T cells by gentle scraping using a sterile cell scraper inside the laminar hood, then transfer each sample into a sterile 2 mL microfuge tube.</li>
	<li>Pellet the scraped cells by centrifugation at 1,500 x g for 5 min. Resuspend the pellet in 1x sterile PBS (Phosphate Buffer Saline), pH 7.2. Centrifuge again at 1,500 x g for 5 min to obtain a pellet free of residual media. Immediately plunge the tube containing pellet into ice.</li>
	<li>Prepare fresh complete cell lysis buffer (150 mM NaCl, 25 mM Tris-Cl, pH-7.5, 5mM DTT, 0.5% IGEPAL, 60 U/mL Superase, 1x Protease Inhibitor). 
	NOTE: A stock of cell lysis buffer lacking IGEPAL, Superase, and Protease inhibitor cocktail may be prepared in advance and stored at room temperature. Prepare a fresh batch of complete cell lysis buffer by adding the above supplements at the recommended final concentrations to the stock cell lysis buffer and storing it on ice.</li>
	<li>Add 260 &#181;L of ice-cold complete cell lysis buffer to each sample in the microfuge tube (i.e., each microfuge tube contains cells harvested from one well of the 6-well plate) and resuspend the cell pellet into a homogenous suspension by pipetting.</li>
	<li>Lyse the cells using the freeze-thaw method: Incubate the tubes at -80 &#176;C for 10&#8211;15 min. Then, allow the cells to thaw out on ice.</li>
	<li>Centrifuge the resulting cell lysate at 16,000 x g for 5 min in a refrigerated benchtop centrifuge set at 4 &#176;C.</li>
	<li>Transfer the cleared cell lysate to a sterile 1.7 mL microfuge tube on ice. Discard the pellet. 
	NOTE: The final volume of cleared lysate should be ~240&#8211;250 &#181;L.</li>
	<li>Add 5M NaCl to the cleared lysate to a final concentration of 1M and maintain the samples on ice.</li>
</ol>
4. Preparation of Streptavidin Magnetic Beads &#8212; II
<ol>
	<li>Prepare fresh complete pull-down wash buffer (10 mM KCl, 1.5 mM MgCl2, 10 mM Tris-Cl pH 7.5, 5 mM DTT, 1 M NaCl, 0.5% IGEPAL, 60U/mL Superase, and 1x Protease Inhibitor cocktail) 
	NOTE: A stock of pull-down wash buffer lacking IGEPAL, Superase, and Protease inhibitor cocktail may be prepared in advance and stored at room temperature. Prepare a fresh batch of complete cell lysis buffer by adding the above supplements at the recommended final concentrations to the stock cell lysis buffer and storing it on ice.</li>
	<li>Place the tube containing the prepared beads (from step 2.9) on the magnet for 2 min. Carefully remove and discard the supernatant.</li>
	<li>Add 150 &#181;L of ice-cold complete pull-down wash buffer to the beads. Vortex for 15 s and incubate at room temperature for 30&#8211;60 s. Place the tubes on the magnet for 2 min. Carefully remove and discard the supernatant.</li>
	<li>Repeat step 4.3 for a total of 3 times.</li>
	<li>Resuspend the beads in 300 &#181;L of complete pull-down wash buffer.</li>
</ol>
5. Pull-down of Target mRNA-miRNA Complexes
<ol>
	<li>Transfer 300 &#181;L of the cell lysate (from step 3.8) to the microfuge tube containing 300 &#181;L of beads (from step 4.5).</li>
	<li>Incubate the mixture on a nutating mixer for 1 h at room temperature.</li>
	<li>Place the tube on the magnet for 5 min. Carefully remove and discard the supernatant.</li>
	<li>Add 300 &#181;L of ice-cold complete pull-down wash buffer to the beads. Vortex for 15 s at room temperature and place the tube on the magnet for 5 min. Carefully remove and discard the supernatant.</li>
	<li>Repeat step 5.4 two more times.</li>
	<li>Resuspend the beads in 100 &#181;L of nuclease-free water and incubate on ice.</li>
</ol>
6. Total RNA Extraction, cDNA Synthesis, and qPCR
<ol>
	<li>Extract total RNA from the resuspended beads (from step 5.6) using an appropriate method (see Table of Materials). Resuspend the extracted total RNA in 25 &#181;L of nuclease-free water. Determine the RNA concentration and quality using a spectrophotometer (absorbance at 260/280). Prepare a working stock of RNA at 50 ng/&#181;L.</li>
	<li>Perform cDNA synthesis, in triplicates, using 50 ng of total RNA (from step 6.1) using an appropriate cDNA synthesis kit (see Table of Materials) using oligo dT primers in a final volume of 20 &#181;L (Table 1). Then, load PCR tubes into the qPCR instrument to perform thermal cycling as per the conditions described in Table 2.</li>
	<li>Perform qPCR on the CDNA (from step 6.2) using SYBR Green chemistry (see Table of Materials):
	<ol>
		<li>Perform all qPCR reactions in triplicates in a 96 well clear bottom plate in sterile conditions.</li>
		<li>Aliquot 9 &#181;L of the reaction mixture from the qPCR master mix (see Table 3) into each well of the plate. Then, add 1 &#181;L of the cDNA to each well to achieve a final volume of 10 &#181;L. Seal the PCR plate using heat resistant PCR plate sealer and load into the qPCR instrument</li>
		<li>Perform thermal cycling as per the conditions described in Table 4.</li>
		<li>Normalize the expression levels (Ct values) of each sample to the expression levels of the scrambled control. Use these values to calculate fold changes in expression.</li>
	</ol>
	</li>
</ol>

The authors declare no competing financial and non-financial interests.

Identification of mRNA targets of cellular miRNAs is important for understanding their regulatory function. Several computational tools are employed to predict targets based on seed sequence complementarity and conservation of target sequences19,20. Although these tools are valuable, they can generate high levels of both false positives and false negatives. Therefore, these predictions are coupled with experimental methods such as immunoprecipitation of RISC complex and pull-down of miRNA:mRNA complex to confirm direct binding of miRNAs to their respective targets27,31. This report details an experimental strategy that utilizes biotinylated miRNA mimics to pulldown target mRNA. Biotin pulldown can be used for identification of miRNA targets with high sensitivity and low false positive rate35,43. Therefore, this method can also be exploited for identification of miRNA targets by coupling sequence-based screening of the captured RNA pool. However, there are several limitations to this method44. Over-expression of an exogenous miRNA could modify the transcriptional network of cells, causing consequent changes in mRNA that are not due to miRNA regulation. These could be overcome by using very low amounts of mimics so as not to perturb endogenous miRNA regulation. Also, proper controls are required when miRNAs are exogenously expressed to avoid non-specific binding. Careful washing and blocking steps can effectively minimize background noise and increase specificity of the targeted miRNA. Few studies have shown that modifications of miRNA 3&#39; or 5&#39; ends are not well tolerated45, nevertheless, several studies have efficiently used biotin tagged miR-mimics as an effective tool to explore mRNA targets.
The other advantage of this method is the utilization of LNA-based (locked nucleic acid) miRNA mimics. The LNA nucleic acid modification allows formation of stable oligonucleotides duplexes with high affinity46,47. Moreover, the custom made biotinylated LNA miRNA mimics consist of three RNA strands. A 3&#39;-biotinylated miRNA strand with sequence as per the miRBase annotation and a passenger strand complementary to the miRNA that is split in two LNA-modified RNA strands47. RISC incorporates only the miRNA strand while the two passenger strands are rapidly degraded thus enhancing target specificity. To increase the confidence of our findings, we have also included a validated target p53 of miR-125b as a positive control and &#946;-actin, which does not have a miR-125b binding site in its mRNA as a negative control. The results obtained using this method with these controls (Figure 3) show specificity of target mRNA identification. Although LNA miRNA mimics stabilize and greatly favor Watson-Crick base pairing, it should be pointed out that the use of LNA miRNA mimics with biotin label will eliminate neither false positives nor negatives. Moreover, it is likely that they may result in confirmation of computational predictions that may not be biologically relevant. On the other hand, if this method is coupled with sequencing to identify mRNA targets, false negatives may be generated, because LNA mimics favor canonical base pairing that may exclude the non-canonical base pairing interactions that occur with native miRNAs.
The protocol presented here is adapted from Wani et al, with several modifications35. To further reduce background noise, we have incorporated extensive washing steps, modified the parameters for transfection efficiency, buffer preparation and incubation, pulldown conditions and PCR data acquisition and analysis. In addition, we used two primer sets to amplify the target mRNA after the pull-down, one set designed to amplify a region of the ORF of target mRNA and the second set of primers to amplify a region within the 3&#39; UTR of the target mRNA. Utilization of two sets of primers enhances the specificity for the target mRNA enrichment.
It should be noted that a limitation of this method is a basal level of noise that arises from non-specific targets. Further modifications such as improvements in the blocking, washing and incubation conditions may provide higher target specificity and sensitivity. In summary, the assay described in this report is a fast and reliable method that can be adopted to validate mRNA targets of miRNAs using a PCR based strategy.

MicroRNAs (miRNAs) are small non-coding RNAs that negatively regulate protein expression1. Precursors of miRNA reside in clusters through many regions of the genome, most frequently within the intergenic regions and introns of protein-coding genes2,3. Biogenesis of miRNAs involve transcription of the pri-miRNAs from miRNA-encoding genes4. The pri-miRNAs undergo sequential processing, first in the nucleus and then in the cytoplasm to generate single stranded mature miRNAs4,5. Subsequently, the mature miRNAs are incorporated into the RNA-induced silencing complex (RISC): a multimeric protein-RNA complex that includes a member of the Argonaute family of proteins for target recognition4,5,6,7. Mature miRNAs in the RISC complex predominantly bind to the 3&#39; UTR of target mRNAs8,9,10 but can also bind occasionally in the coding and the 5&#39;UTR region of the mRNA10,11. The binding of miRNA to the mRNA sequences results in translational silencing12,13,14 and in some cases mRNA destabilization15. Since a single miRNA can target many mRNAs, these regulatory molecules are involved in almost every cellular process and have been implicated in various disease conditions16,17,18.
Detailed understanding of how miRNAs regulate cellular pathways requires identification of the target mRNAs. Multiple bioinformatics platforms are available to predict putative miRNA:mRNA interactions19,20. These predictions rely on perfect Watson-Crick base pairing between the 2&#8211;8 nucleotide seed sequence of the miRNA and a complementary sequence within the target mRNA4,21. Additionally, these tools generate secondary structure of the miRNA:mRNA duplex, calculate thermodynamic parameters of this molecular interaction and show conservation of the binding sites across species to enhance functional relevance of the target prediction. Unfortunately, these tools also have the limitation of predicting false positive targets at a very high rate (~27&#8211;70%)15,22. Most importantly, these in silico platforms fail to recognize the non-canonical interactions of miRNAs with their targets23. Therefore, such predictive analyses are often combined with experimental methods to validate functionally relevant targets.
Multiple approaches have been developed to experimentally validate miRNA:mRNA interaction. Genetic experiments using miRNA mimics, sponges and inhibitors that alter the levels of miRNAs in the cell provide clues for its regulatory effect on the target gene expression24,25,26. Additionally, reporter based assays via co-transfection of a clone containing the 3&#39; UTR region of the target mRNA and miRNA mimics or inhibitors into cells provide evidence of the regulatory function of miRNAs26. While these methods are crucial to study post-transcriptional regulation of gene expression by miRNAs, transfection efficiency and pleotropic effects of alterations in cellular miRNA levels are major limitations of these genetic approaches23,26. Therefore, complementary biochemical methods that probe direct interaction between miRNA and its target are employed to better understand the cellular function of miRNAs.
One widely-used method to study direct interaction between miRNA and its target is immunoprecipitation of the RISC complex followed by the detection of mRNA target within the complex27,28,29,30. Recently, an improved RISC trap method was also utilized to identify miRNA targets; it couples stabilization of targets within the RISC-miRNA-mRNA intermediates with the purification of mRNA targets. However, these methodsface the inherent challenges of non-specific interactions between RNA and RNA-binding proteins that are usually segregated by cellular compartments31,32. In addition, these assays are dependent on the presence of AGO2 protein for immunoprecipitation of RISC complex33. Given that AGO2 is not the only argonaute to mediate efficient miRNA:mRNA interactions, exclusion of other argonautes could lead to biased results34. Therefore, alternative strategies are needed to study direct binding of miRNA to mRNA.
In this report, we elaborate a one-step approach for probing direct interaction between a miRNA and its target mRNA. First, 3&#39; biotinylated locked nucleic acid (LNA) miRNA mimics are transfected into mammalian cells. Then, the miRNA:mRNA complex in the cellular lysate is captured using streptavidin coated magnetic beads. The mRNA target bound to its complementary miRNA is quantified using qPCR.

<table><tbody><tr><td>Cell line- HEK293T cells</td><td>ATCC</td><td>CRL-3216</td><td></td></tr><tr><td>Heat-inactivated Fetal bovine serum (Hi-FBS)</td><td>GIBCO/Thermofisher</td><td>10438-026</td><td></td></tr><tr><td>Dulbecco&amp;rsquo;s modified Eagle&amp;rsquo;s medium (DMEM)</td><td>GIBCO/Thermofisher</td><td>11995-065</td><td></td></tr><tr><td>Phosphate buffered saline (PBS) (1x)</td><td>GIBCO/Thermofisher</td><td>20012-027</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)&amp;nbsp;</td><td>GIBCO/Thermofisher</td><td>25200-056</td><td></td></tr><tr><td>Penicillin-Streptomycin solution (100x)</td><td>Cellgro/Mediatech</td><td>30-002-CI</td><td></td></tr><tr><td>DNase&amp;nbsp;</td><td>Ambion</td><td>AM2238</td><td></td></tr><tr><td>Opti-MEM Reduced serum media</td><td>GIBCO/Thermofisher</td><td>3198-088</td><td></td></tr><tr><td>Liopfectamine 2000 Transfection reagent</td><td>Invitrogen/ Thermofisher</td><td>11668-019</td><td></td></tr><tr><td>Biotinylated hsa-miR-125b</td><td>Exiqon</td><td>339178/ID-27281622</td><td></td></tr><tr><td>Biotinylated scrambled control</td><td>Exiqon</td><td>479997-671/ID-714884</td><td></td></tr><tr><td>IGEPAL</td><td>Sigma-Aldrich</td><td>18896</td><td></td></tr><tr><td>Streptavidin Magnetic beads</td><td>Pierce</td><td>88816</td><td></td></tr><tr><td>Yeast tRNA</td><td>Invitrogen/Thermofisher</td><td>15401-011</td><td></td></tr><tr><td>Bovine Serum Albumin (BSA)</td><td>Sigma-Aldrich</td><td>A2153</td><td></td></tr><tr><td>Potassium chloride (KCl) solution</td><td>Sigma-Aldrich</td><td>60142</td><td></td></tr><tr><td>Magnesium chloride (MgCl&lt;sub&gt;2&lt;/sub&gt;) solution</td><td>Sigma-Aldrich</td><td>M1028</td><td></td></tr><tr><td>Sodium hydroxide (NaOH)</td><td>Sigma-Aldrich</td><td>795429</td><td></td></tr><tr><td>Ethylenediamine tetraacetic acid, disodium salt (EDTA) solution, 0.5 M, pH 8.0</td><td>Sigma-Aldrich</td><td>E7889</td><td></td></tr><tr><td>Dithiothreitol (DTT)</td><td>Sigma-Aldrich</td><td>43815</td><td></td></tr><tr><td>Superase</td><td>Ambion/Thermofisher</td><td>AM2694</td><td></td></tr><tr><td>Protease Inhibitor cocktail</td><td>Sigma-Aldrich</td><td>P8340</td><td></td></tr><tr><td>RNAse/DNAse free water</td><td>GIBCO/Thermofisher</td><td>10977-015</td><td></td></tr><tr><td>RNeasy extraction kit</td><td>Qiagen</td><td>74104</td><td></td></tr><tr><td>iScript-Select cDNA synthesis kit</td><td>Biorad</td><td>170-8897</td><td></td></tr><tr><td>qPCR Primers&amp;nbsp;</td><td>Invitrogen/Thermofisher</td><td></td><td></td></tr><tr><td>iTaq-Universal SYBR green supermix</td><td>Biorad</td><td>172-5120</td><td></td></tr><tr><td>DynaMag-Spin Magnet</td><td>Invitrogen/Thermofisher</td><td>12320D</td><td></td></tr></tbody></table>

biotin-based pulldown assay to validate mrna targets of cellular mirnas

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

MiRNAs regulate cellular processes by binding to target mRNAs. Therefore, identifying mRNA targets are a key to understand miRNA function. Here we elaborate a method for identifying mRNA target of cellular miRNA. This protocol is adapted from Wani et al.35 with the modification of utilizing biotinylated LNA-based miRNA mimics to pulldown target mRNA. The use of LNA-based oligonucleotide mimics enhances specificity of target binding owing to the higher stability of the modified ribose ring without toxic effects36,37,38. We employed this method to pull down PARP-1 mRNA as the target of cellular miRNA miR-125b. The highest level of miR-125b expression is detected in brain tissue that regulates neuronal function39,40. In an attempt to identify the targets of miR-125b in neuronal cells, recently we reported that miR-125b negatively regulates PARP-1 expression by binding to the 3&#39; UTR of PARP-1 mRNA41.
Pulldown of miRNA:mRNA Complex
We used HEK-293T cells to study the interaction between miR-125b and PARP-1 mRNA, since these cells are widely used in cellular, biochemical, and molecular biology studies. A schematic of the protocol used for the mRNA target is depicted in Figure 1. First, HEK-293T cells (4 x 105&#8211;5 x 105 cells per well) were seeded overnight in a 6-well tissue culture plate and incubated at 37 &#176;C with 5% CO2 for 18&#8211;24 h. Thereafter, 75 picomoles of 3&#39;-biotinylated miR-125b mimics and 3&#39;-biotinylated scrambled controls were transfected into the cells using liposome based transfection method. Transfected cells were incubated at 37 &#176;C and 5% CO2 for an additional 36 h and harvested. Thereafter cellular lysates of transfected cells were prepared by the freeze-thaw lysis method. The freshly prepared cellular lysates were incubated with the blocked streptavidin coated magnetic beads on a bench top nutating mixer for 1 h at room temperature. Following this, the beads were processed and washed using freshly prepared ice cold pull-down wash buffer on the magnetic separator. Finally, the beads were resuspended in 100 &#181;L of nuclease free water for further analysis.
Detection of Target mRNA in the pull-down miRNA:mRNA Complex
To detect the target mRNA of miR-125b from the pull-down mixture, we employed a qPCR assay (Figure 1). We designed forward and reverse primers (FP and RP) within the ORF to amplify PARP-1 mRNA (Figure 2, Table 5b). We also designed primers sets for detecting p53 mRNA, a known target of miR-125b42, as a positive control and included primers to amplify actin mRNA as a non-specific negative control. In addition, to further confirm the specificity of amplification, we designed primers for detecting the 3&#39; UTR regions of PARP-1, p53 and actin. We performed qPCR using the methods described in the protocol (section 6).
Figure 3 shows the qPCR based amplification of target mRNA&#39;s relative to scrambled controls from the purified beads. The level of PARP-1 mRNA was markedly higher in samples pulled-down with biotinylated miR-125b mimics when compared to the scrambled controls. As expected, higher mRNA levels of the positive control p53 mRNA and minimal amplification of the negative control actin mRNA was observed in these samples. Similar levels of amplification were obtained using the primers targeting the 3&#39; UTR of PARP-1 and p53 compared to the negative control actin (Figure 3B). The qPCR results of the ORF regions (Figure 3A) and the 3&#39;UTR regions (Figure 3B) of PARP-1 mRNA and p53 mRNA showed some levels of variability. Several factors including binding affinity, number of miRNA binding sites, and differences in primer sequence dependent amplification may contribute to the variable levels of amplification in Figure 3. Nevertheless, these data strongly support the feasibility and specificity of the method for validating mRNA targets of cellular miRNAs.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57786/57786fig1.jpg" /> 
Figure 1: Schematic representation of the protocol for the target capture assay using biotinylated-miRNA mimics. <a href="/files/ftp_upload/57786/57786fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57786/57786fig2.jpg" /> 
Figure 2: Primer design for amplification of mRNA targets. Schematic representation of the primers used to detect the target mRNA of miR-125b. One set of primers (Set I) was designed within the ORF region of the transcripts and the other set of primers (Set II) was designed in the 3&#39; UTR region of the target genes. FP and RP represent forward and reverse primers for each set. <a href="/files/ftp_upload/57786/57786fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57786/57786fig3.jpg" /> 
Figure 3: miR-125b target identification by qPCR. (A) mRNA levels using primer set I, which amplifies the ORF region of target mRNA. Higher expression levels of PARP-1 and p53 mRNA (positive control) were observed when compared to actin mRNA (negative control). (B) Amplification of the 3&#39; UTR region of target mRNA using primer set II. No amplification was observed in the no template controls (NTC). All reactions were performed in triplicates and the data was analyzed using the appropriate data analysis software based on the 2-&#916;Ct method. Error bars represent standard error of the mean. <a href="/files/ftp_upload/57786/57786fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Stock</td>
			<td>Final volume for 20 &#956;L reaction</td>
		</tr>
		<tr>
			<td>Template (RNA)</td>
			<td>50 ng/&#181;L</td>
			<td>1.0 &#956;L</td>
		</tr>
		<tr>
			<td>Reaction buffer</td>
			<td>5x</td>
			<td>4.0 &#956;L</td>
		</tr>
		<tr>
			<td>Oligo dT primer</td>
			<td>Master stock</td>
			<td>2 &#956;L</td>
		</tr>
		<tr>
			<td>Reverse Transcriptase</td>
			<td>Master stock</td>
			<td>1 &#956;L</td>
		</tr>
		<tr>
			<td>Nuclease-free distilled water</td>
			<td>-</td>
			<td>12 &#956;L</td>
		</tr>
		<tr>
			<td>Total Reaction Volume</td>
			<td></td>
			<td>20 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 1: cDNA synthesis reaction mixture.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>105 &#176;C = 30 s</td>
		</tr>
		<tr>
			<td>42 &#176;C = 60 min</td>
		</tr>
		<tr>
			<td>95 &#176;C = 5 min</td>
		</tr>
		<tr>
			<td>10 &#176;C = Hold</td>
		</tr>
	</tbody>
</table>
Table 2: cDNA synthesis thermal cycling conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Stock</td>
			<td>Final volume for 10 &#956;L reaction</td>
		</tr>
		<tr>
			<td>cDNA product&#160;</td>
			<td>-</td>
			<td>1.0 &#956;L</td>
		</tr>
		<tr>
			<td>&#160;iTaq Universal SYBR mix</td>
			<td>2x</td>
			<td>5.0 &#956;L</td>
		</tr>
		<tr>
			<td>Target (ORF/3&#8217; UTR) F.P.</td>
			<td>10 &#956;M</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>Target (ORF/3&#8217; UTR) R.P.</td>
			<td>10 &#956;M</td>
			<td>0.5 &#956;L</td>
		</tr>
		<tr>
			<td>Nuclease-free distilled water</td>
			<td>-</td>
			<td>3 &#956;L</td>
		</tr>
		<tr>
			<td>Total Reaction Volume</td>
			<td></td>
			<td>10 &#956;L</td>
		</tr>
	</tbody>
</table>
Table 3: qPCR reaction mixture.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>95 &#176;C = 10 min</td>
		</tr>
		<tr>
			<td>30 cycles of:</td>
		</tr>
		<tr>
			<td>95 &#176;C = 10 s</td>
		</tr>
		<tr>
			<td>56 &#176;C = 30 s</td>
		</tr>
		<tr>
			<td>72 &#176;C = 30 s</td>
		</tr>
		<tr>
			<td>Melt Curve Analysis</td>
		</tr>
		<tr>
			<td>65 &#176;C= 31 s</td>
		</tr>
		<tr>
			<td>Linear Ramp rate = 0.5 &#176;C/s</td>
		</tr>
		<tr>
			<td>Acquisition = 0.5 &#176;C intervals</td>
		</tr>
	</tbody>
</table>
Table 4: qPCR thermal cycling conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="3">(A): Biotinylated Oligos</td>
		</tr>
		<tr>
			<td>Biotinlyated Oligos</td>
			<td>Stock</td>
			<td>Sequence (5&#39; to 3&#8217;)</td>
		</tr>
		<tr>
			<td>hsa-miR-125b</td>
			<td>25 &#956;M</td>
			<td>UCCCUGAGACCCUAACUUGUGA-Biotin</td>
		</tr>
		<tr>
			<td>Scrambled Control</td>
			<td>25 &#956;M</td>
			<td>GAUGGCAUUCGAUCAGUUCUA-Biotin</td>
		</tr>
		<tr>
			<td>(B) Primers</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Target Primer (ORF)</td>
			<td>Stock</td>
			<td>Sequence (5&#8217; to 3&#8217;)</td>
		</tr>
		<tr>
			<td>PARP-1 (FP)</td>
			<td>100 &#956;M</td>
			<td>GAGGTGGATGGGTTCTCTGA</td>
		</tr>
		<tr>
			<td>PARP-1 (RP)</td>
			<td>100 &#956;M</td>
			<td>ACACCCCTTGCACGTACTTC</td>
		</tr>
		<tr>
			<td>p53 (FP)</td>
			<td>100 &#956;M</td>
			<td>TGTGACTTGCACGTACTCCC</td>
		</tr>
		<tr>
			<td>p53 (RP)</td>
			<td>100 &#956;M</td>
			<td>ACCATCGCTATCTGAGCAGC</td>
		</tr>
		<tr>
			<td>ACTIN (FP)</td>
			<td>100 &#956;M</td>
			<td>GCTCGTCGTCGACAACGGCTC</td>
		</tr>
		<tr>
			<td>ACTIN (RP)</td>
			<td>100 &#956;M</td>
			<td>CAAACATGATCTGGGTCATCTT</td>
		</tr>
		<tr>
			<td>(C) Primers</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Target Primer (3&#8217; UTR)</td>
			<td>Stock</td>
			<td>Sequence (5&#8217; to 3&#8217;)</td>
		</tr>
		<tr>
			<td>PARP-1 (FP)</td>
			<td>100 &#956;M</td>
			<td>ATTGGGAGAGGTAGCCGAGT</td>
		</tr>
		<tr>
			<td>PARP-1 (RP)</td>
			<td>100 &#956;M</td>
			<td>CTACCCATCAGCAACTTAGCG</td>
		</tr>
		<tr>
			<td>p53 (FP)</td>
			<td>100 &#956;M</td>
			<td>GGCCCATATCTGTGAAATGC</td>
		</tr>
		<tr>
			<td>p53 (RP)</td>
			<td>100 &#956;M</td>
			<td>CTGCAGGAAGGCAGGTTTT</td>
		</tr>
	</tbody>
</table>
Table 5: Oligonucleotide Names and Sequences.

Watch this Scientific Journal Video about Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs at JoVE.com

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

biotin-based-pulldown-assay-to-validate-mrna-targets-cellular

Nanyang Technological University

Research

JoVE Journal

Genetics

13.7K Views.  Kalinga Institute of Industrial Technology University. Dit verslag wordt een snelle en betrouwbare methode voor het valideren van mRNA doelstellingen van cellulaire miRNAs beschreven. Het gebruik van de methode synthetische biotinyleerd vergrendeld nucleïnezuur LNA gebaseerde miRNA bootst te vangen target mRNA. Vervolgens daar beklede magnetische kralen pulldown worden gebruikt de doelstelling mRNA voor kwantificering van qPCR polymerase-kettingreactie.

Video: Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

Perturbations of Circulating miRNAs in Irritable Bowel Syndrome Detected Using a Multiplexed High-throughput Gene Expression Platform

The gene expression platform assay allows for robust and highly reproducible quantification of the expression of up to 800 transcripts (mRNA or miRNAs) in a single reaction. The miRNA assay counts transcripts by directly imaging and digitally counting miRNA molecules that are labeled with color-coded fluorescent barcoded probe sets (a reporter probe and a capture probe). Barcodes are hybridized directly to mature miRNAs that have been elongated by ligating a unique oligonucleotide tag (miRtag) to the 3&#39; end. Reverse transcription and amplification of the transcripts are not required. Reporter probes contain a sequence of six color positions populated using a combination of four fluorescent colors. The four colors over six positions are used to construct a gene-specific color barcode sequence. Post-hybridization processing is automated on a robotic prep station. After hybridization, the excess probes are washed away, and the tripartite structures (capture probe-miRNA-reporter probe) are fixed to a streptavidin-coated slide via the biotin-labeled capture probe. Imaging and barcode counting is done using a digital analyzer. The immobilized barcoded miRNAs are visualized and imaged using a microscope and camera, and the unique barcodes are decoded and counted. Data quality control (QC), normalization, and analysis are facilitated by a custom-designed data processing and analysis software that accompanies the assay software. The assay demonstrates high linearity over a broad range of expression, as well as high sensitivity. Sample and assay preparation does not involve enzymatic reactions, reverse transcription, or amplification; has few steps; and is largely automated, reducing investigator effects and resulting in high consistency and technical reproducibility. Here, we describe the application of this technology to identifying circulating miRNA perturbations in irritable bowel syndrome.

We describe the use of a multiplexed high-throughput gene expression platform that quantitates gene expression by barcoding and counting molecules in biological substrates without the need for amplification. We used the platform to quantitate microRNA (miRNA) expression in whole blood in subjects with and without irritable bowel syndrome.

The gene expression platform assay allows for robust and highly reproducible quantification of the expression of up to 800 transcripts (mRNA or miRNAs) in ...

Detection of a Circulating MicroRNA Custom Panel in Patients with Metastatic Colorectal Cancer

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful biomarkers for clinical practice. Here, we present a protocol to extract, reverse transcribe and evaluate the expression levels of circulating miRNAs from plasma samples of patients with colorectal cancer (CRC). microRNAs (miRNAs) are a class of non-coding RNAs of 18-25 nucleotides in length that regulate the expression of target genes at the translational level and play an important role, including that of pro- and anti-angiogenic function, in the physiopathology of various organs. miRNAs are stable in biological fluids such as serum and plasma, which renders them ideal circulating biomarkers for cancer diagnosis, prognosis and treatment decision-making and monitoring. Circulating miRNA extraction was performed using a rapid and effective method that involves both organic and column-based methodologies. For miRNA retrotranscription, we used a multi-step procedure that considers polyadenylation at 3&#39; and the ligation of an adapter at 5&#39; of the mature miRNAs, followed by random miRNA pre-amplification. We selected a 24-miRNA custom panel to be tested by quantitative real-time polymerase chain reaction (qRT-PCR) and spotted the miRNA probes on array custom plates. We performed qRT-PCR plate runs on a real-time PCR System. Housekeeping miRNAs for normalization were selected using GeNorm software (v. 3.2). Data were analyzed using Expression suite software (v 1.1) and statistical analyses were performed. The method proved to be reliable and technically robust and could be useful to evaluate biomarker levels in liquid samples such as plasma and/or serum.

We present a protocol to evaluate the expression levels of circulating microRNA (miRNAs) in plasma samples from cancer patients. In particular, we used a commercially available kit for circulating miRNA extraction and reverse transcription. Finally, we analyzed a panel of 24 selected miRNAs using real-time pre-spotted probe custom plates.

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful ...

Cancer Research

Analysis of Combinatorial miRNA Treatments to Regulate Cell Cycle and Angiogenesis

Lung cancer (LC) is the leading cause of cancer-related deaths worldwide. Similar to other cancer cells, a fundamental characteristic of LC cells is unregulated proliferation and cell division. Inhibition of proliferation by halting cell cycle progression has been shown to be a promising approach for cancer treatment, including LC. 
miRNA therapeutics have emerged as important post-transcriptional gene regulators and are increasingly being studied for use in cancer treatment. In recent work, we utilized two miRNAs, miR-143 and miR-506, to regulate cell cycle progression. A549 non-small cell lung cancer (NSCLC) cells were transfected, gene expression alterations were analyzed, and apoptotic activity due to the treatment was finally analyzed. Downregulation of cyclin-dependent kinases (CDKs) were detected (i.e., CDK1, CDK4 and CDK6), and cell cycle halted at the G1/S and G2/M phase transitions. Pathway analysis indicated potential antiangiogenic activity of the treatment, which endows the approach with multifaceted activity. Here, described are the methodologies used to identify miRNA activity regarding cell cycle inhibition, induction of apoptosis, and effects of treatment on endothelial cells by inhibition of angiogenesis. It is hoped that the methods presented here will support future research on miRNA therapeutics and corresponding activity and that the representative data will guide other researchers during experimental analyses.

miRNA therapeutics have significant potential in regulating cancer progression. Demonstrated here are analytical approaches used for identification of the activity of a combinatorial miRNA treatment in halting cell cycle and angiogenesis.

Lung cancer (LC) is the leading cause of cancer-related deaths worldwide. Similar to other cancer cells, a fundamental characteristic of LC cells is ...

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including cancers. These small regulatory RNAs mainly interact with the 3&#8217; untranslated regions (3&#8217; UTR) of their target messenger RNAs (mRNAs) ultimately resulting in the inhibition of decoding processes of mRNAs and the augmentation of target mRNA degradations. Based on the expression levels and intracellular functions, miRNAs are able to serve as regulatory factors of oncogenic and tumor-suppressive mRNAs. Identification of bona fide target genes of a miRNA among hundreds or even thousands of computationally predicted targets is a crucial step to discern the roles and basic molecular mechanisms of a miRNA of interest. Various miRNA target prediction programs are available to search possible miRNA-mRNA interactions. However, the most challenging question is how to validate direct target genes of a miRNA of interest. This protocol describes a reproducible strategy of key methods on how to identify miRNA targets related to the function of a miRNA. This protocol presents a practical guide on step-by-step procedures to uncover miRNA levels, functions, and related target mRNAs using the probe-based real-time polymerase chain reaction (PCR), sulforhodamine B (SRB) assay following a miRNA mimic transfection, dose-response curve generation, and luciferase assay along with the cloning of 3&#8217; UTR of a gene, which is necessary for proper understanding of the roles of individual miRNAs.

This protocol uses a probe-based real-time polymerase chain reaction (PCR), a sulforhodamine B (SRB) assay, 3&#8217; untranslated regions (3&#8217; UTR) cloning, and a luciferase assay to verify the target genes of a miRNA of interest and to understand the functions of miRNAs.

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including ...

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Profiling of Estrogen-regulated MicroRNAs in Breast Cancer Cells

Estrogen plays vital roles in mammary gland development and breast cancer progression. It mediates its function by binding to and activating the estrogen receptors (ERs), ER&#945;, and ER&#946;. ER&#945; is frequently upregulated in breast cancer and drives the proliferation of breast cancer cells. The ERs function as transcription factors and regulate gene expression. Whereas ER&#945;&#39;s regulation of protein-coding genes is well established, its regulation of noncoding microRNA (miRNA) is less explored. miRNAs play a major role in the post-transcriptional regulation of genes, inhibiting their translation or degrading their mRNA. miRNAs can function as oncogenes or tumor suppressors&#160;and are also promising biomarkers. Among the miRNA assays available, microarray and quantitative real-time polymerase chain reaction (qPCR) have been extensively used to detect and quantify miRNA levels. To identify miRNAs regulated by estrogen signaling in breast cancer, their expression in ER&#945;-positive breast cancer cell lines were compared before and after estrogen-activation using both the &#181;Paraflo-microfluidic microarrays and Dual Labeled Probes-low density arrays. Results were validated using specific qPCR assays, applying both Cyanine dye-based and Dual Labeled Probes-based chemistry. Furthermore, a time-point assay was used to identify regulations over time. Advantages of the miRNA assay approach used in this study is that it enables a fast screening of mature miRNA regulations in numerous samples, even with limited sample amounts. The layout, including the specific conditions for cell culture and estrogen treatment, biological and technical replicates, and large-scale screening followed by in-depth confirmations using separate techniques, ensures a robust detection of miRNA regulations,&#160;and eliminates false positives and other artifacts. However, mutated or unknown miRNAs, or regulations at the primary and precursor transcript level, will not be detected. The method presented here represents a thorough investigation of estrogen-mediated miRNA regulation.

Molecular signaling through both estrogen and microRNAs are critical in breast cancer development and growth. Estrogen activates the estrogen receptors, which are transcription factors. Many transcription factors can regulate the expression of microRNAs, and estrogen-regulated microRNAs can be profiled using different large-scale techniques.

Estrogen plays vital roles in mammary gland development and breast cancer progression. It mediates its function by binding to and activating the estrogen ...

Medicine

An Optimized Quantitative Pull-Down Analysis of RNA-Binding Proteins Using Short Biotinylated RNA

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying the binding partners of an RNA of interest remains of high importance to unveil the mechanisms behind many cellular processes. However, RNA molecules might interact transiently and dynamically with some RNA-binding proteins (RBPs), especially with non-canonical ones. Hence, improved methods to isolate and identify such RBPs are greatly needed.
To identify the protein partners of a known RNA sequence efficiently and quantitatively, we developed a method based on the pull-down and characterization of all interacting proteins, starting from cellular total protein extract. We optimized the protein pull-down using biotinylated RNA pre-loaded on streptavidin-coated beads. As a proof of concept, we employed a short RNA sequence known to bind the neurodegeneration-associated protein TDP-43 and a negative control of a different nucleotide composition but the same length. After blocking the beads with yeast tRNA, we loaded the biotinylated RNA sequences on the streptavidin beads and incubated them with the total protein extract from HEK 293T cells. After incubation and several washing steps to remove nonspecific binders, we eluted the interacting proteins with a high-salt solution, compatible with the most commonly used protein quantification reagents and with sample preparation for mass spectrometry. We quantified the enrichment of TDP-43 in the pull-down performed with the known RNA binder compared to the negative control by mass spectrometry. We used the same technique to verify the selective interactions of other proteins computationally predicted to be unique binders of our RNA of interest or of the control. Finally, we validated the protocol by western blot via the detection of TDP-43 with an appropriate antibody. 
This protocol will allow the study of the protein partners of an RNA of interest in near-to-physiological conditions, helping uncover unique and unpredicted protein-RNA interactions.

Here, we present an optimized in vitro method to uncover, quantify, and validate protein interactors of specific RNA sequences, using total protein extract from human cells, streptavidin beads coated with biotinylated RNA, and mass spectrometry analysis.

Protein-RNA interactions regulate gene expression and cellular functions at transcriptional and post-transcriptional levels. For this reason, identifying ...

Biochemistry

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Biology

Identifying Targets of Human microRNAs with the LightSwitch Luciferase Assay System using 3'UTR-reporter Constructs and a microRNA Mimic in Adherent Cells

MicroRNAs (miRNAs) are important regulators of gene expression and play a role in many biological processes. More than 700 human miRNAs have been identified so far with each having up to hundreds of unique target mRNAs. Computational tools, expression and proteomics assays, and chromatin-immunoprecipitation-based techniques provide important clues for identifying mRNAs that are direct targets of a particular miRNA. In addition, 3'UTR-reporter assays have become an important component of thorough miRNA target studies because they provide functional evidence for and quantitate the effects of specific miRNA-3'UTR interactions in a cell-based system. To enable more researchers to leverage 3'UTR-reporter assays and to support the scale-up of such assays to high-throughput levels, we have created a genome-wide collection of human 3'UTR luciferase reporters in the highly-optimized LightSwitch Luciferase Assay System. The system also includes synthetic miRNA target reporter constructs for use as positive controls, various endogenous 3'UTR reporter constructs, and a series of standardized experimental protocols.
Here we describe a method for co-transfection of individual 3'UTR-reporter constructs along with a miRNA mimic that is efficient, reproducible, and amenable to high-throughput analysis.

MicroRNAs (miRNAs) are important regulators of gene expression and have been shown to play a role in numerous biological processes. To better understand miRNA-UTR interactions, we have created a genome-wide collection of 3 UTR luciferase reporters paired with a novel luciferase gene and assay reagent, the LightSwitch system.

MicroRNAs (miRNAs) are important regulators of gene expression and play a role in many biological processes.  More than 700 human miRNAs have been ...

Probe-based Real-time PCR Approaches for Quantitative Measurement of microRNAs

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that provides an accurate and reproducible analysis. Probe-based chemistry offers the least background fluorescence as compared to other (dye-based) chemistries. Presently, there are several platforms available that use probe-based chemistry to quantitate transcript abundance. qPCR in a 96 well plate is the most routinely used method, however only a maximum of 96 samples or miRNAs can be tested in a single run. This is time-consuming and tedious if a large number of samples/miRNAs are to be analyzed. High-throughput probe-based platforms such as microfluidics (e.g. TaqMan Array Card) and nanofluidics arrays (e.g. OpenArray) offer ease to reproducibly and efficiently detect the abundance of multiple microRNAs in a large number of samples in a short time. Here, we demonstrate the experimental setup and protocol for miRNA quantitation from serum or plasma-EDTA samples, using probe-based chemistry and three different platforms (96 well plate, microfluidics and nanofluidics arrays) offering increasing levels of throughput.

Circulating microRNAs have recently emerged as promising and novel biomarkers for various cancers and other diseases. The goal of this article is to discuss three different probe-based real-time PCR platforms and methods that are available to quantify and determine the abundance of circulating microRNAs.

Probe-based quantitative PCR (qPCR) is a favoured method for measuring transcript abundance, since it is one of the most sensitive detection methods that ...

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

Samenvatting

Meer video's verkennen