Name: evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts
Uploaded: 2018-05-11T14:30:00.000+00:00
Duration: 7 min 2 s
Description: Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

The authors thank Nicole McRorie for help with the experiments. This work was supported by the University of Alberta Faculty of Medicine and Dentistry, Slipchuk SMA Research Foundation Research Grant, the Canadian Institutes of Health Research (CIHR), the Friends of Garrett Cumming Research Funds, HM Toupin Neurological Science Research Funds, the Muscular Dystrophy Canada, the Canada Foundation for Innovation, Alberta Enterprise and Advanced Education, and the Women and Children's Health Research Institute (WCHRI).

1. Cell culture
<ol>
	<li>Culture SMA patient fibroblasts in the growth medium (Dulbecco&#39;s modified Eagle medium 1:1 F-12 (Ham) with 10% fetal bovine serum (FBS) and 0.5% penicillin/streptomycin) in a CO2 incubator at 37 &#176;C.</li>
	<li>Determine cell concentration using an automated cell counter and dilute cells to 1 x 105 cells/mL in the growth medium, then seed on the appropriate plate. Use 12-well plates (1&#160;mL per well) for RT-PCR or qPCR.</li>
	<li>Incubate the plates for 24 h in a CO2 incubator at 37 &#176;C.</li>
</ol>
2. LNA/DNA mixmer transfection
<ol>
	<li>Ensure cell confluency of around 65&#160;- 80% for optimal transfection efficiency.</li>
	<li>Thaw 10 &#956;M LNA/DNA mixmers slowly on ice.</li>
	<li>In a 1.5-mL tube, prepare a 20x mixmer solution by adding the mixmers to serum-deprived media so that the final volume reaches 50 &#956;L.</li>
	<li>Mix the mixmer solution with 50 &#956;L of serum-deprived media containing 3% transfection reagent (1:1 ratio).</li>
	<li>Incubate for 10 minutes at room temperature.</li>
	<li>Add 900 &#956;L serum-deprived medium with 5% FBS to each tube.</li>
	<li>Aspirate the old media from the plate and replace with 1 mL LNA/DNA mixmer solution containing the transfection reagent.</li>
	<li>Incubate the cells for 24 - 48 h at 37 &#176;C in a CO2 incubator.</li>
</ol>
3. RNA extraction
<ol>
	<li>Remove the medium and add 1 mL of guanidinium thiocyanate-phenol-chloroform reagent to the cells. Wash the bottom of the well several times with guanidinium thiocyanate-phenol-chloroform and collect it into 1.5-mL tubes.</li>
	<li>Vortex at high speed for 30 s and store at -80 &#176;C for 1 h or overnight.</li>
	<li>Thaw the samples at room temperature and vortex well.</li>
	<li>Add 200 &#181;L chloroform, shake vigorously for 15 s, and incubate at room temperature for 3 min.</li>
	<li>Centrifuge at 12,000 x&#160;g for 15 min at 4 &#176;C.</li>
	<li>Collect the top clear aqueous phase into a new tube. Make sure to avoid collecting any of the white interphase that forms between the upper and lower phases.</li>
	<li>Add 500 &#181;L isopropanol and 1 &#181;L 8 &#181;g/&#181;L glycogen (RNA grade). Vortex for 10 s and incubate at room temperature for 10 min or at -20 &#176;C overnight.</li>
	<li>Centrifuge at 12,000 x g for 10 min at 4 &#176;C and remove all of the supernatant. A white pellet will form at the bottom of the tube.</li>
	<li>Add 1 mL cold 75% ethanol and centrifuge at 7,500 x g for 5 min at 4 &#176;C.</li>
	<li>Remove all the ethanol and dry the pellet at room temperature until no ethanol is left in the tube.</li>
	<li>Dissolve the pellet in 30 &#181;L DNase/RNase free water, and incubate for 10 min at 60 &#176;C.</li>
	<li>Measure RNA concentration using a spectrophotometer (at 260 nm), and adjust RNA concentration to 50 ng/&#181;L.</li>
</ol>
4. One step RT-PCR to measure the exon inclusion rate of SMN2
<ol>
	<li>Mix 12.5 &#181;L of 2x RT-PCR reaction buffer, 1.0 &#181;L of one-step RT-PCR enzyme mix, 0.5 &#181;L of each primer (SMN2 forward: 5&#39;-CTGCCTCCATTTCCTTCTG-3&#39;, SMN2 reverse: 5&#39;-TGGTGTCATTTAGTGCTGCTC-3&#39;, GAPDH forward: 5&#39;-TCCCTGAGCTGAACGGGAAG-3&#39;, GAPDH reverse: 5&#39;-GGAGGAGTTTGGTCGCTGT-3&#39;, 2 &#181;L of total RNA (50 ng/&#181;L), and 8.5 &#181;L of RNase/DNase-free distilled water.</li>
	<li>After cDNA is synthesized at 50 &#176;C for 15 min, start the PCR reaction. Amplify the SMN2 exon 6-8 with 30 PCR cycles (94 &#176;C for 15 s, 60 &#176;C for 30 s, 68 &#176;C for 25 s). Amplify the GAPDH with 20 PCR cycles (94 &#176;C for 15 s, 60 &#176;C for 30 s, 68 &#176;C for 20 s).</li>
	<li>Add 5 &#956;L 6x loading dye to the PCR product, and load 5 &#181;L of the mixture into a 2% agarose gel and run for 40 min at 100 V.</li>
	<li>Image the gel and analyze it using ImageJ software.</li>
	<li>Measure the intensity of full-length bands and &#916;7 bands. Calculate the rate of exon 7 inclusion by the intensity value of (full-length)/ (full-length + &#916;7 SMN2).</li>
</ol>
5. Quantitative PCR (qPCR) to measure the exon inclusion rate of SMN2
<ol>
	<li>For cDNA synthesis, mix 1 &#181;L Oligo dT, 1 &#181;L 10 mM dNTPs, and 11 &#181;L total RNA (50 ng/&#181;L). Incubate at 65 &#176;C for 5 min.</li>
	<li>Place the samples on ice and add 4 &#181;L 5x buffer, 1 &#181;L 0.1 M DTT, 1 &#181;L RNase inhibitor, and 1 &#181;L reverse transcriptase to each sample.</li>
	<li>Incubate at 50 &#176;C for 60 min, and heat up to 80 &#176;C for 10 min to stop the reaction. The cDNA can be stored at -20 &#176;C.</li>
	<li>Dilute the cDNAs with RNase-free water (1:5 dilution). Mix 10 &#181;L 2x SYBR Green qPCR enzyme mix, 0.8 &#181;L 10 &#181;M each primer (full-length SMN2 forward: 5&#8242;-GCTATCATACTGGCTATTATATGGGTTTT-3&#8242;, full-length SMN2 reverse: 5&#8242;-CTCTATGCCAGCATTTCTCCTTAAT-3&#8242;, &#916;7 SMN2 forward: 5&#8242;-TCTGGACCACCAATAATTCCCC-3&#8242;, &#916;7 SMN2 reverse: 5&#8242;-ATGCCAGCATTTCCATATAATAGCC-3&#8242;, GAPDH&#160;forward: 5&#8242;-GCAAATTCCATGGCACCGT-3&#8242;, GAPDH&#160;reverse: 5&#8242;-AGGGATCTCGCTCCTGGAA-3&#8242;), 3 &#181;L diluted cDNA, and 5.4 &#181;L RNase-free water.</li>
	<li>Start the qPCR reaction. Use the conditions: 95 &#176;C for 30 s, then a 40 cycle repeat at 95 &#176;C for 5 s and 60 &#176;C for 20 s.</li>
	<li>Calculate the relative expression of full-length SMN2 to GAPDH or &#916;7 SMN2, and normalize to the non-treated cells with the &#916;&#916;Ct algorithm.</li>
</ol>
6. Western blotting
<ol>
	<li>Remove transfection medium from cells and wash with phosphate-buffered saline (PBS) once.</li>
	<li>Add 100 &#181;L lysis buffer with a protease inhibitor.</li>
	<li>Detach cells from the bottom of each well using a sterile cell scraper, and collect into 1.5-mL tubes. Incubate samples on ice for 30 min.</li>
	<li>Pass cell lysate through 21-G needle 10 times to crush the cells.</li>
	<li>Centrifuge at 20,800 x g for 15 min at 4 &#176;C and collect the supernatant into new 1.5-mL tubes. The sample can be stored in a -80 &#176;C deep freezer.</li>
	<li>Determine protein concentration using a BCA Protein Assay Kit, and adjust the concentration to 1.0 &#181;g/&#181;L.</li>
	<li>Mix 5 &#181;L samples and 5 &#181;L 2x sodium dodecyl sulfate (SDS) sample buffer (10% SDS; 14% 0.5M Tris-HCl solution, pH 6.7; 1% 0.5M EDTA-2Na stock solution, pH 8.0; 20% Glycerol; 0.004% bromophenol blue dye, 5% &#946;-mercaptoethanol) and heat at 70 &#176;C for 10 min.</li>
	<li>Load the samples into a 4-12% Bis-Tris Protein gels and run for 1 h at 150 V.</li>
	<li>Soak a thick filter paper in each buffer: (Concentrated anode buffer: 0.3 M Tris-HCl, 20% methanol; anode buffer: 0.03 M Tris-HCl, 20% methanol; cathode buffer: 25 mM Tris, 20% methanol, 40 mM 6- amino-n-hexanoic acid, 0.01% SDS).</li>
	<li>Soak a polyvinylidene difluoride (PVDF) membrane in methanol for 20 s, then transfer it into the anode buffer.</li>
	<li>Equilibrate the gel after SDS-PAGE with the cathode buffer for 5 - 10 min under agitation.</li>
	<li>Place the filter papers, PVDF membranes and the gel on a semi-dry blotting machine, as follows: concentrated anode buffer paper/anode buffer paper/PVDF membrane/protein gel/cathode buffer paper (Figure 2).</li>
	<li>Cover the stack and start the transfer at 20 V for 30 min.</li>
	<li>After the transfer, rinse the PVDF membrane with PBST (PBS with 0.05% Tween 20) once.</li>
	<li>Block the membrane at room temperature for 30 min in 5% skim milk powder dissolved in in PBST or at 4 &#176;C for overnight.</li>
	<li>Dilute a purified mouse anti-SMN antibody and a rabbit anti-Cofilin antibody to 1:10,000 in 5% skim milk powder in PBST. Incubate the membrane in it for 1 h at room temperature or at 4 &#176;C overnight.</li>
	<li>Wash 3 times with PBST for 10 min.</li>
	<li>Dilute secondary antibodies (HRP-conjugated goat anti-mouse and anti-rabbit IgG (H + L)) to 1:10,000 in 5% skim milk powder in PBST. Incubate for 1 h at room temperature in the dark.</li>
	<li>Wash the membrane 3 times with PBST for 10 min.</li>
	<li>Detect the band signal using the chemiluminescence Western blotting detection kit.</li>
</ol>

<ol>
	<li>Iascone, D. M., Henderson, C. E., Lee, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+muscular+atrophy:+from+tissue+specificity+to+therapeutic+strategies.">Spinal muscular atrophy: from tissue specificity to therapeutic strategies.</a> F1000Prime Rep. 7, 4 (2015).</li><li>Touznik, A., Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+developments+in+exon+skipping+and+splice+modulation+therapies+for+neuromuscular+diseases.">New developments in exon skipping and splice modulation therapies for neuromuscular diseases.</a> Expert Opin Biol Ther. 14 (6), 809-819 (2014).</li><li>Lefebvre, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+Characterization+of+a+Spinal+Muscular+Atrophy-Determining+Gene.">Identification and Characterization of a Spinal Muscular Atrophy-Determining Gene.</a> Cell. 80 (1), 155-165 (1995).</li><li>Lorson, C. L., Hahnen, E., Androphy, E. J., Wirth, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+in+the+SMN+gene+regulates+splicing+and+is+responsible+for+spinal+muscular+atrophy.">A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 96 (11), 6307-6311 (1999).</li><li>Monani, U. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+nucleotide+difference+that+alters+splicing+patterns+distinguishes+the+SMA+gene+SMN1+from+the+copy+gene+SMN2.">A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2.</a> Hum Mol Genet. 8 (7), 1177-1183 (1999).</li><li>Lee, J. J., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+therapy+in+neurology.">Antisense therapy in neurology.</a> J Pers Med. 3 (3), 144-176 (2013).</li><li>Aartsma-Rus, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FDA+Approval+of+Nusinersen+for+Spinal+Muscular+Atrophy+Makes+2016+the+Year+of+Splice+Modulating+Oligonucleotides.">FDA Approval of Nusinersen for Spinal Muscular Atrophy Makes 2016 the Year of Splice Modulating Oligonucleotides.</a> Nucleic Acid Ther. 27 (2), 67-69 (2017).</li><li>Hua, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+SMN+restoration+is+essential+for+long-term+rescue+of+a+severe+spinal+muscular+atrophy+mouse+model.">Peripheral SMN restoration is essential for long-term rescue of a severe spinal muscular atrophy mouse model.</a> Nature. 478 (7367), 123-126 (2011).</li><li>Hua, Y., Vickers, T. A., Baker, B. F., Bennett, C. F., Krainer, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enhancement+of+SMN2+exon+7+inclusion+by+antisense+oligonucleotides+targeting+the+exon.">Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon.</a> PLoS Biol. 5 (4), 73 (2007).</li><li>Passini, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+oligonucleotides+delivered+to+the+mouse+CNS+ameliorate+symptoms+of+severe+spinal+muscular+atrophy.">Antisense oligonucleotides delivered to the mouse CNS ameliorate symptoms of severe spinal muscular atrophy.</a> Sci Transl Med. 3 (72), (2011).</li><li>Hammond, S. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+peptide-mediated+oligonucleotide+therapy+improves+long-term+survival+in+spinal+muscular+atrophy.">Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy.</a> Proc Natl Acad Sci U S A. 113 (39), 10962-10967 (2016).</li><li>Porensky, P. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+single+administration+of+morpholino+antisense+oligomer+rescues+spinal+muscular+atrophy+in+mouse.">A single administration of morpholino antisense oligomer rescues spinal muscular atrophy in mouse.</a> Hum Mol Genet. 21 (7), 1625-1638 (2012).</li><li>Touznik, A., Maruyama, R., Hosoki, K., Echigoya, Y., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA/DNA+mixmer-based+antisense+oligonucleotides+correct+alternative+splicing+of+the+SMN2+gene+and+restore+SMN+protein+expression+in+type+1+SMA+fibroblasts.">LNA/DNA mixmer-based antisense oligonucleotides correct alternative splicing of the SMN2 gene and restore SMN protein expression in type 1 SMA fibroblasts.</a> Sci Rep. 7 (1), 3672 (2017).</li><li>Obika, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+of+2'-O,4'-C-methyleneuridine+and+-cytidine.+Novel+bicyclic+nucleosides+having+a+fixed+C-3,-endo+sugar+puckering.">Synthesis of 2'-O,4'-C-methyleneuridine and -cytidine. Novel bicyclic nucleosides having a fixed C-3,-endo sugar puckering.</a> Tetrahedron Letters. 38 (50), 8735-8738 (1997).</li><li>Singh, S. K., Nielsen, P., Koshkin, A. A., Wengel, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LNA+(locked+nucleic+acids):+synthesis+and+high-affinity+nucleic+acid+recognition.">LNA (locked nucleic acids): synthesis and high-affinity nucleic acid recognition.</a> Chemical Communications. (4), 455-456 (1998).</li><li>Navarro, E., Serrano-Heras, G., Castano, M. J., Solera, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+detection+chemistry.">Real-time PCR detection chemistry.</a> Clin Chim Acta. 439, 231-250 (2015).</li><li>Urbanek, M. O., Nawrocka, A. U., Krzyzosiak, W. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Small+RNA+Detection+by+in+Situ+Hybridization+Methods.">Small RNA Detection by in Situ Hybridization Methods.</a> Int J Mol Sci. 16 (6), 13259-13286 (2015).</li><li>Wahlestedt, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+and+nontoxic+antisense+oligonucleotides+containing+locked+nucleic+acids.">Potent and nontoxic antisense oligonucleotides containing locked nucleic acids.</a> Proc Natl Acad Sci U S A. 97 (10), 5633-5638 (2000).</li><li>Rupaimoole, R., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+therapeutics:+towards+a+new+era+for+the+management+of+cancer+and+other+diseases.">MicroRNA therapeutics: towards a new era for the management of cancer and other diseases.</a> Nat Rev Drug Discov. 16 (3), 203-222 (2017).</li><li>Lanford, R. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Therapeutic+silencing+of+microRNA-122+in+primates+with+chronic+hepatitis+C+virus+infection.">Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.</a> Science. 327 (5962), 198-201 (2010).</li><li>Shimo, T., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Designing+Effective+Antisense+Oligonucleotides+for+Exon+Skipping.">Designing Effective Antisense Oligonucleotides for Exon Skipping.</a> Methods Mol Biol. 1687, 143-155 (2018).</li><li>Shimo, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Design+and+evaluation+of+locked+nucleic+acid-based+splice-switching+oligonucleotides+in+vitro.">Design and evaluation of locked nucleic acid-based splice-switching oligonucleotides in vitro.</a> Nucleic Acids Res. 42 (12), 8174-8187 (2014).</li><li>Nguyen, Q., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalized+Muscle+Cell+Model+to+Test+the+Exon+Skipping+Efficacy+for+Duchenne+Muscular+Dystrophy.">Immortalized Muscle Cell Model to Test the Exon Skipping Efficacy for Duchenne Muscular Dystrophy.</a> J. Pers. Med. 7 (4), 13 (2017).</li><li>Echigoya, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+Antisense+Screening+and+Optimization+for+Exon+51+Skipping+in+Duchenne+Muscular+Dystrophy.">Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.</a> Mol Ther. , (2017).</li><li>Saito, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+PMO+found+in+dystrophic+dog+model+was+effective+in+cells+from+exon+7-deleted+DMD+patient.">Antisense PMO found in dystrophic dog model was effective in cells from exon 7-deleted DMD patient.</a> PLoS One. 5 (8), 12239 (2010).</li><li>Donnelly, E. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+a+murine+model+of+SMA.">Characterization of a murine model of SMA.</a> Neurobiol Dis. 45 (3), 992-998 (2012).</li><li>Lim, K. R., Maruyama, R., Yokota, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Eteplirsen+in+the+treatment+of+Duchenne+muscular+dystrophy.">Eteplirsen in the treatment of Duchenne muscular dystrophy.</a> Drug Des Devel Ther. 11, 533-545 (2017).</li><li>Paton, D. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nusinersen:+antisense+oligonucleotide+to+increase+SMN+protein+production+in+spinal+muscular+atrophy.">Nusinersen: antisense oligonucleotide to increase SMN protein production in spinal muscular atrophy.</a> Drugs Today (Barc). 53 (6), 327-337 (2017).</li><li>Prakash, T. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparing+in+vitro+and+in+vivo+activity+of+2'-O-[2-(methylamino)-2-oxoethyl]-+and+2'-O-methoxyethyl-modified+antisense+oligonucleotides.">Comparing in vitro and in vivo activity of 2'-O-[2-(methylamino)-2-oxoethyl]- and 2'-O-methoxyethyl-modified antisense oligonucleotides.</a> J Med Chem. 51 (9), 2766-2776 (2008).</li><li>Aoki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bodywide+skipping+of+exons+45-55+in+dystrophic+mdx52+mice+by+systemic+antisense+delivery.">Bodywide skipping of exons 45-55 in dystrophic mdx52 mice by systemic antisense delivery.</a> Proc Natl Acad Sci U S A. 109 (34), 13763-13768 (2012).</li></ol>

The authors have nothing to disclose.

The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various AONs. This protocol is widely applicable to exon skipping and inclusion of other genes and various cell types. In addition, most AON chemistries (except PMOs) can be transfected using this method. AONs can regulate splicing of pre-mRNA from both endogenous and artificially introduced genes, and can be co-transfected with plasmid vectors carrying targeted genes.
A critical step of this method is that the cell confluency should be around 65 - 80% when AONs are transfected into fibroblasts. This condition might be different for other cell types. The best concentration of AONs for transfection can be also different (0.5 - 100 nM), depending on targeted sequences and cell types.
This method is not without potential pitfalls. For example, the efficacy of mixmers is determined by the sequences of mixmers and LNA/DNA composition. For ISS-N1, a mixmer, which is composed of LNAs with DNA being substituted for LNA at every third nucleotide position, was more effective than a mixmer with an equivalent sequence with DNA substitution at every other nucleotide or all-LNA oligonucleotide13. However, this may be different for other target sequences. Therefore, it is necessary to optimize sequences of LNA/DNA mixmers and evaluate the efficacy of mixmers at RNA level before going further. The entire backbones of mixmers should be phosphorothioated to prevent degradation. In addition, although this lipotransfection-mediated transfection method can be used for most AON chemistries, it cannot be used for charge-neutral phosphorodiamidate morpholino oligomers (PMOs), since lipotransfection requires negatively charged oligonucleotides. For PMO transfection methods, see elsewhere23,24,25.
Although this method is useful for testing novel AONs, the SMA fibroblast cell model does not recapitulate in vivo conditions in its entirety. Animal models can serve as an important source to test the in vivo efficacy and safety26.
For exon skipping/inclusion, PMO and 2&#8242;-O-methoxyethyl modification (2&#39;MOE) can be used instead of LNA/DNA mixmers27,28. However, the optimal concentration of these chemistries for transfection are typically much higher29,30. Because of the better efficacy compared to other antisense chemistries, the use of LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases in the future.

Spinal muscular atrophy (SMA) is a fatal neuromuscular disorder inherited in an autosomal recessive pattern. It is characterized by the degradation of motor neurons and progressive trunk and limb muscle paralysis1,2. The majority of SMA occurrences are due to a homozygous mutation in the survival of motor neuron 1 (SMN1) gene3. The survival of motor neuron 2 (SMN2) gene is an inverse duplicate of SMN1, and has a nearly identical sequence differing by only five bases4,5. A C-to-T transition in SMN2 located in exon 7 makes the gene nearly nonfunctional because the mutation leads to the essential exon 7 being excluded in nearly 90% of SMN2 transcripts (Figure 1a). SMN2 mRNAs missing exon 7 cannot compensate for the SMN1 function because its protein product is unstable and is rapidly degraded.
Antisense therapy recently emerged as a very promising strategy for treating SMA6. The recent approval of nusinersen by the U.S. Food and Drug Administration (FDA) made it the first drug available for treating SMA7. Nusinersen is an 18-mer antisense oligonucleotide (AON) with a 2&#8242;-O-methoxyethyl modification (MOE) and a phosphorothioate backbone. The drug targets the intronic splicing silencer N1 (ISS-N1) located in intron 7 of the SMN2 gene. Binding of nusinersen to ISS-N1 promotes the recovery of functional full-length SMN protein expression from the endogenous SMN2 gene by inducing exon 7 inclusion (Figure 1a)8,9,10. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries that may be more effective and less toxic than nusinersen. It has been demonstrated that AONs with other chemistries also efficiently induce exon inclusion in SMN2 exon 7 both in vitro and in vivo11,12,13.
Locked nucleic acids (LNAs) are chemically modified RNA analogs containing a methylene bridge connecting the 4&#8242;-Carbon with the 2&#8242;-Oxygen within the furanose structure (Figure 1b)14,15. Compared to DNAs or RNAs, LNAs have an increased affinity for binding to complementary RNA sequences and have the added benefit of being highly resistant to endogenous nucleases. The LNA chemistry has been applied for use as probes for fluorescence in situ hybridization (FISH) and in qPCR16,17. Also, it is utilized to regulate gene expression both in vitro and in vivo. GapmeR AONs are a combination of single-stranded DNA molecules flanked by several LNAs at the 5&#8242; and 3&#8242; ends. They knock down gene expression by binding complementary to targeted mRNAs, causing them to be degraded by the activated RNase H18. LNA/DNA mixmers are AONs which are composed of DNA nucleotides integrated in between LNAs. Presented in this orientation they can bind miRNA to inhibit its function (LNA-antimiR)19. Some LNA-antimiRs have reached clinical development. For examples, miravirsen (AntimiR-122) is an LNA-antimiR that inhibits miR-122 to treat hepatitis C infection and several Phase II clinical trials are currently ongoing19,20. Recently, it has been demonstrated that LNA/DNA mixmers can also modulate RNA splicing21. It can bind a specific sequence of mRNA and induce exon skipping in dystrophin mRNA and exon inclusion in SMN2 mRNA in vitro13,22.
In this article, we outline a methodology for the induction of exon inclusion using AONs and the evaluation of efficacy at the RNA and protein levels. To exemplify this method, we used the LNA/DNA mixmers targeting ISS-N1 in intron 7 of SMN2. AONs transfected into SMA patient cells by lipotransfection induced exon 7 inclusion in the final SMN2 transcript and upregulation of SMN protein production. One of the advantages of using LNA/DNA mixmers to induce the exon inclusion is that the effective concentration for the transfection is significantly lower than other chemistries13. This method can be used for many other AONs except for phosphorodiamidate morpholino oligomers (PMOs), which, due to their neutral charge, need to enter cells through endocytosis induced by the Endo-Porter co-transfection reagent.

<table><tbody><tr><td>SMA Fibroblasts</td><td>Coriell NIGMS human genetic cell repository</td><td>GM03813</td><td></td></tr><tr><td>Dulbecco&#039;s Modified Eagle Medium (DMEM)</td><td>Thermo Fisher</td><td>11320033</td><td></td></tr><tr><td>Fetal Bovine Serum</td><td>Sigma-Aldrich</td><td>F1051</td><td></td></tr><tr><td>Penicillin-Streptomycin (10,000 U/mL)</td><td>Thermo Fisher</td><td>15140122</td><td></td></tr><tr><td>Trypsin-EDTA (0.05%), phenol red</td><td>Thermo Fisher</td><td>25300062</td><td></td></tr><tr><td>Serum-deprived media</td><td>Thermo Fisher</td><td>31985070</td><td></td></tr><tr><td>Transfection reagent</td><td>Thermo Fisher</td><td>15338100</td><td></td></tr><tr><td>guanidinium thiocyanate-phenol-chloroform (TRIzol)</td><td>Thermo Fisher</td><td>15596-018</td><td></td></tr><tr><td>RT-PCR Primers</td><td></td><td></td><td>Sequence 5&#039; to 3&#039;</td></tr><tr><td>SMN2 forward:&amp;nbsp;</td><td></td><td></td><td>CTGCCTCCATTTCCTTCTG</td></tr><tr><td>SMN2 reverse:&amp;nbsp;</td><td></td><td></td><td>TGGTGTCATTTAGTGCTGCTC</td></tr><tr><td>GAPDH forward:&amp;nbsp;</td><td></td><td></td><td>TCCCTGAGCTGAACGGGAAG</td></tr><tr><td>GAPDH reverse:&amp;nbsp;</td><td></td><td></td><td>GGAGGAGTTTGGTCGCTGT</td></tr><tr><td>qPCR Primers</td><td></td><td></td><td></td></tr><tr><td>full-length SMN2 forward:</td><td></td><td></td><td>GCTATCATACTGGCTATTATATGGGTTTT</td></tr><tr><td>full-length SMN2 reverse:&amp;nbsp;</td><td></td><td></td><td>CTCTATGCCAGCATTTCTCCTTAAT</td></tr><tr><td>GAPDH forward:&amp;nbsp;</td><td></td><td></td><td>GCAAATTCCATGGCACCGT</td></tr><tr><td>GAPDH reverse:</td><td></td><td></td><td>AGGGATCTCGCTCCTGGAA</td></tr><tr><td>Chloroform</td><td>Sigma-Aldrich</td><td>P3803</td><td></td></tr><tr><td>Glycogen, RNA grade</td><td>Thermo Fisher</td><td>R0551</td><td></td></tr><tr><td>ImageJ Software</td><td></td><td></td><td></td></tr><tr><td>Protease cocktail inhibitor&amp;nbsp;</td><td>Roche</td><td>11836153001</td><td></td></tr><tr><td>Cathode Buffer</td><td></td><td></td><td>0.025 M Tris base + 40&amp;nbsp;mM 6-aminocaproic acid + 20% Methanol</td></tr><tr><td>Anode Buffer</td><td></td><td></td><td>0.03 M Tris Base + 20% Methanol</td></tr><tr><td>Concentred Anode Buffer</td><td></td><td></td><td>0.3 M Tris base + 20% Methanol</td></tr><tr><td>Beta Mercaptoethanol&amp;nbsp;</td><td>Millipore</td><td>ES-007-E</td><td></td></tr><tr><td>PVDF membrane&amp;nbsp;</td><td>GE</td><td>10600021</td><td></td></tr><tr><td>Loading/sample buffer for Western blotting</td><td>NuPage Invitrogen</td><td>NP007</td><td></td></tr><tr><td>One-Step RT-PCR kit&amp;nbsp;</td><td>Qiagen&amp;nbsp;</td><td>210210</td><td></td></tr><tr><td>dNTPs</td><td>Clontech</td><td>3040</td><td></td></tr></tbody></table>

evaluation of exon inclusion induced by splice switching antisense oligonucleotides in sma patient fibroblasts

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide (AON)-mediated therapy. While SMN1 mutations are responsible for the disease, AONs targeting intronic splice silencer (ISS) sites in SMN2, including FDA-approved nusinersen, have been shown to restore SMN expression and ameliorate the symptoms. Currently, many studies involving AON therapy for SMA focus on investigating novel AON chemistries targeting SMN2 that may be more effective and less toxic than nusinersen. Here, we describe a protocol for in vitro evaluation of exon inclusion using lipotransfection of AONs followed by reverse transcription polymerase chain reaction (RT-PCR), quantitative polymerase chain reaction (qPCR), and Western blotting. This method can be employed for various types of AON chemistries. Using this method, we demonstrate that AONs composed of alternating locked nucleic acids (LNAs) and DNA nucleotides (LNA/DNA mixmers) lead to efficient SMN2 exon inclusion and restoration of SMN protein at a very low concentration, and therefore, LNA/DNA mixmer-based antisense oligonucleotides may be an attractive therapeutic strategy to treat splicing defects caused by genetic diseases. The in vitro evaluation method described here is fast, easy, and sensitive enough for the testing of various novel AONs.

Using SMA patient fibroblasts, we targeted the ISS-N1 silencer region in intron 7 of the SMN2 gene with eight different antisense LNA/DNA mixmers that were transfected at a 5 nM concentration (Figure 3). Each of the mixmers contained a modified phosphorothioated backbone which enabled them to resist nuclease degradation. To evaluate the efficacy of the mixmers, the rate of SMN2 exon 7 inclusion was quantified by RT-PCR and qPCR using primers specific to SMN2. The inclusion efficiency of exon 7 ranged from 78 - 98% when transfected with mixmers #1 - 5 in the patient cells (Figure 4a, b), while&#160;transfection&#160;utilizing mixmers #6-8 at the same dose did not result in any significant difference when compared to the control. The results obtained from qPCR analysis also displayed that the quantity of full-length SMN2 mRNA transcript was significantly increased by the mixmers #1 - 3 and #5 treatments when compared to the control (Figure 4c).
In addition, the result of the Western blotting showed that transfection&#160;using mixmers #1 - 5 enabled higher levels of SMN protein expression in the patient fibroblasts (a 1.5 - 1.9-fold increase from the control, Figure 5). The treatments using mixmers #6 - 8 did not result in a change in the SMN protein expression level in the cells. These data demonstrate that transfection of LNA/DNA mixmers #1-5 induces the SMN2 exon 7 inclusion efficiently in SMA patient fibroblasts.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57530/57530fig1.jpg" /> 
Figure 1: Antisense-mediated exon inclusion strategy to treat SMA. (a) A C-to-T transition in exon 7 of SMN2 leads to the skipping of exon 7 in approximately 90% of SMN2 transcripts. These transcripts are out-of-frame and are rapidly degraded in the cells. Antisense oligonucleotides (AONs) bind the intronic splicing silencer N1 (ISS-N1), which induces exon inclusion in SMN2. The exon 7-included SMN2 mRNAs can produce functional SMN protein. (b) Chemical structures of RNA and phosphorothioated LNA. The entire backbones of the mixmers we used in this article are phosphorothioated to prevent degradation. This figure has been modified from Touznik et.al.13. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57530/57530fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57530/57530fig2.jpg" /> 
Figure 2: Semi-dry transfer method for Western blotting. A thick filter paper soaked in concentrated (Con.) Anode buffer, a thick filter paper soaked in Anode buffer, a PVDF membrane, a gel and a thick filter paper soaked in Cathode buffer are stacked between the two plates of a semi-dry blotting machine. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57530/57530fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57530/57530fig3.jpg" /> 
Figure 3: LNA/DNA mixmer sequence for SMN2 exon 7 inclusion. DNA base: G, A, T, C. LNA base (red): +G, +A, +T, +C. Phosphorothioated DNA base: G*, A*, T*, C*. Phosphorothioated LNA base (red): +G*, +A*, +T*, +C*.&#160;This figure is reproduced from Touznik et.al.13. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57530/57530fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57530/57530fig4.jpg" /> 
Figure 4: Representative results of RT-PCR and qPCR to evaluate the efficacy of the LNA/DNA mixmers. Transfection of mixmers #1 - 5 leads to SMN2 exon 7 inclusion at a significantly higher rate than the mock transfection. (a) RT-PCR of SMN2 and GAPDH in SMA patient fibroblasts following transfection at 5 nM concentration. Top band: exon 7-included full-length SMN2 mRNA. Bottom band: exon 7-excluded SMN2 mRNA. (b) Quantitative analysis of SMN2 exon 7 inclusion in the mixmer-treated SMA fibroblasts using RT-PCR. (c) Relative expression analysis of full-length SMN2 to GAPDH measured using qPCR. The data were normalized to non-treated control cells. Error bars represent mean &#177; standard deviation (three independent experiments). One-way ANOVA with Dunnett&#39;s multiple comparison test was performed. M: mock control, NT: non-treated, H: healthy control fibroblast cells, B: blank. This figure is reproduced from Touznik et.al.13. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57530/57530fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57530/57530fig5.jpg" /> 
Figure 5: Representative results of Western blotting to measure SMN protein expression. Transfection of the LNA/DNA mixmers increases SMN protein production. (a) Western blotting of SMN and Cofilin (loading control) of healthy and mixmer-treated SMA patient fibroblasts. (b) Fold increase in SMN protein levels of mixmer-treated SMA fibroblasts. Transfection of mixmers #1 - 5 at 5 nM concentration significantly increases the production of SMN proteins. The data were normalized to the ratio of SMN/Cofilin in non-treated SMA fibroblasts. Bars represent mean &#177; standard deviation (four independent experiments). One-way ANOVA with Dunnett&#39;s multiple comparison test was performed. M: mock control, NT: non-treated. This figure is reproduced from Touznik et.al.13. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57530/57530fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts at JoVE.com

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Various antisense oligonucleotides (AONs) have been shown to induce exon inclusion (splice modulation) and rescue SMN expression for spinal muscular atrophy (SMA). Here, we describe a protocol for AON lipotransfection to induce exon inclusion in the SMN2 gene and the evaluation methods to determine the efficacy in SMA patient fibroblasts.

Spinal muscular atrophy (SMA), a lethal neurological disease caused by the loss of SMN1, presents a unique case in the field of antisense oligonucleotide ...

evaluation-exon-inclusion-induced-splice-switching-antisense

Nanyang Technological University

Research

JoVE Journal

Medicine

13.3K Views.  University of Alberta Faculty of Medicine and Dentistry. Verschillende antisense oligonucleotides (AONs) hebben aangetoond dat induceren exon integratie (splice modulatie) en SMN expressie voor spinale musculaire atrofie (SMA) te redden. Hier beschrijven we een protocol voor AON lipotransfection ertoe exon opneming in het SMN2 -gen en de evaluatiemethoden te bepalen van de werkzaamheid bij SMA patiënt fibroblasten.

Video: Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Merging Absolute and Relative Quantitative PCR Data to Quantify STAT3 Splice Variant Transcripts

Human signal transducer and activator of transcription 3 (STAT3) is one of many genes containing a tandem splicing site. Alternative donor splice sites 3 nucleotides apart result in either the inclusion (S) or exclusion (&#916;S) of a single residue, Serine-701. Further downstream, splicing at a pair of alternative acceptor splice sites result in transcripts encoding either the 55 terminal residues of the transactivation domain (&#945;) or a truncated transactivation domain with 7 unique residues (&#946;). As outlined in this manuscript, measuring the proportions of STAT3's four spliced transcripts (S&#945;, S&#946;, &#916;S&#945; and &#916;S&#946;) was possible using absolute qPCR (quantitative polymerase chain reaction). The protocol therefore distinguishes and measures highly similar splice variants. Absolute qPCR makes use of calibrator plasmids and thus specificity of detection is not compromised for the sake of efficiency. The protocol necessitates primer validation and optimization of cycling parameters. A combination of absolute qPCR and efficiency-dependent relative qPCR of total STAT3 transcripts allowed a description of the fluctuations of STAT3 splice variants' levels in eosinophils treated with cytokines. The protocol also provided evidence of a co-splicing interdependence between the two STAT3 splicing events. The strategy based on a combination of the two qPCR techniques should be readily adaptable to investigation of co-splicing at other tandem splicing sites.

Tandem splicing events occur at sites less than 12 nucleotides apart. Quantifying ratios of such splice variants is feasible using an absolute quantitative PCR approach. This manuscript describes how splice variants of the gene STAT3, in which two splicing events results in Serine-701 inclusion/exclusion and &#945;/&#946; C-termini, can be quantified.

Human signal transducer and activator of transcription 3 (STAT3) is one of many genes containing a tandem splicing site. Alternative donor splice sites 3 ...

Genetics

Engineering Artificial Factors to Specifically Manipulate Alternative Splicing in Human Cells

The processing of most eukaryotic RNAs is mediated by RNA Binding Proteins (RBPs) with modular configurations, including an RNA recognition module, which specifically binds the pre-mRNA target and an effector domain. Previously, we have taken advantage of the unique RNA binding mode of the PUF domain in human Pumilio 1 to generate a programmable RNA binding scaffold, which was used to engineer various artificial RBPs to manipulate RNA metabolism. Here, a detailed protocol is described to construct Engineered Splicing Factors (ESFs) that are specifically designed to modulate the alternative splicing of target genes. The protocol includes how to design and construct a customized PUF scaffold for a specific RNA target, how to construct an ESF expression plasmid by fusing a designer PUF domain and an effector domain, and how to use ESFs to manipulate the splicing of target genes. In the representative results of this method, we have also described the common assays of ESF activities using splicing reporters, the application of ESF in cultured human cells, and the subsequent effect of splicing changes. By following the detailed protocols in this report, it is possible to design and generate ESFs for the regulation of different types of Alternative Splicing (AS), providing a new strategy to study splicing regulation and the function of different splicing isoforms. Moreover, by fusing different functional domains with a designed PUF domain, researchers can engineer artificial factors that target specific RNAs to manipulate various steps of RNA processing.

This report describes a bioengineering method to design and construct novel Artificial Splicing Factors (ASFs) that specifically modulate the splicing of target genes in mammalian cells. This method can be further expanded to engineer various artificial factors to manipulate other aspects of RNA metabolism.

The processing of most eukaryotic RNAs is mediated by RNA Binding Proteins (RBPs) with modular configurations, including an RNA recognition module, which ...

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell type-specific fashion. AS expression patterns are typically analyzed by RT-PCR and RNA-seq using RNA samples isolated from a population of cells. In situ examination of AS expression patterns for a particular biological structure can be carried out by RNA in situ hybridization (ISH) using exon-specific probes. However, this particular use of ISH has been limited because alternative exons are generally too short to design exon-specific probes. In this report, the use of BaseScope, a recently developed technology that employs short antisense oligonucleotides in RNA ISH, is described to analyze AS expression patterns in mouse brain sections. Exon 23a of neurofibromatosis type 1 (Nf1) is used as an example to illustrate that short exon-exon junction probes exhibit robust hybridization signals with high specificity in RNA ISH analysis on mouse brain sections. More importantly, signals detected with exon inclusion- and skipping-specific probes can be used to reliably calculate the percent spliced in values of Nf1 exon 23a expression in different anatomical areas of a mouse brain. The experimental protocol and calculation method for AS analysis are presented. The results indicate that BaseScope provides a powerful new tool to assess AS expression patterns in situ.

Quantitative Analysis of Alternative Pre-mRNA Splicing in Mouse Brain Sections Using RNA In Situ Hybridization Assay

An in situ hybridization (ISH) protocol that uses short antisense oligonucleotides to detect alternative pre-mRNA splicing patterns in mouse brain sections is described.

Alternative splicing (AS) occurs in more than 90% of human genes. The expression pattern of an alternatively spliced exon is often regulated in a cell ...

Using In Vitro and In-cell SHAPE to Investigate Small Molecule Induced Pre-mRNA Structural Changes

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences is desired. We herein provide a detailed in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) protocol to study the RNA structural change in the presence of an experimental drug for spinal muscular atrophy (SMA), survival of motor neuron (SMN)-C2, and in exon 7 of the pre-mRNA of the SMN2 gene. In in vitro SHAPE, an RNA sequence of 140 nucleotides containing SMN2 exon 7 is transcribed by T7 RNA polymerase, folded in the presence of SMN-C2, and subsequently modified by a mild 2&#39;-OH acylation reagent, 2-methylnicotinic acid imidazolide (NAI). This 2&#39;-OH-NAI adduct is further probed by a 32P-labeled primer extension and resolved by polyacrylamide gel electrophoresis (PAGE). Conversely, 2&#39;-OH acylation in in-cell SHAPE takes place in situ with SMN-C2 bound cellular RNA in living cells. The pre-mRNA sequence of exon 7 in the SMN2 gene, along with SHAPE-induced mutations in the primer extension, was then amplified by PCR and subject to next-generation sequencing. Comparing the two methodologies, in vitro SHAPE is a more cost-effective method and does not require computational power to visualize results. However, the in vitro SHAPE-derived RNA model sometimes deviates from the secondary structure in a cellular context, likely due to the loss of all interactions with RNA-binding proteins. In-cell SHAPE does not need a radioactive material workplace and yields a more accurate RNA secondary structure in the cellular context. Furthermore, in-cell SHAPE is usually applicable for a larger range of RNA sequences (~1,000 nucleotides) by utilizing next-generation sequencing, compared to in vitro SHAPE (~200 nucleotides) that usually relies on PAGE analysis. In case of exon 7 in SMN2 pre-mRNA, the in vitro and in-cell SHAPE derived RNA models are similar to each other.

Detailed protocols for both in vitro and in-cell selective 2&#39;-hydroxyl acylation analyzed by primer extension (SHAPE) experiments to determine the secondary structure of pre-mRNA sequences of interest in the presence of an RNA-targeting small molecule are presented in this article.

In the process of drug development of RNA-targeting small molecules, elucidating the structural changes upon their interactions with target RNA sequences ...

Exon Skipping in Directly Reprogrammed Myotubes Obtained from Human Urine-Derived Cells

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin protein. To date, we have completed an investigator-initiated first-in-human study at the National Center of Neurology and Psychiatry based on the systemic injection of the morpholino oligonucleotides which are prone to exon-53 skipping. For the effective treatment of DMD, in vitro testing with myoblasts derived from DMD patients to screen drugs and assess patient eligibility before undertaking clinical trials is thought to be essential. Very recently, we reported a new MYOD1-converted urine-derived cell (UDC) treated with the histone methyltransferase inhibitor (3-deazaneplanocin A hydrochloride), as a cellular model of DMD. The new autologous UDC might show phenocopy of the disease-specific phenotypes of DMD, leading to the application of precision medicine in a variety of muscle-related diseases. In this article, we describe a detailed protocol for efficient modelling of DMD muscle cells using MYOD1-converted UDCs along with reverse transcriptase polymerase chain reaction (RT-PCR), Western blotting, and immunocytochemistry to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

In this article, we describe a detailed protocol for efficient modelling of Duchenne muscular dystrophy muscle using MYOD1-converted urine-derived cells to evaluate the restoration of dystrophin mRNA and protein levels after exon skipping.

Duchenne muscular dystrophy (DMD), a progressive and fatal muscle disease, is caused by mutations in the DMD gene that result in the absence of dystrophin ...

Direct Reprogramming of Human Fibroblasts into Myoblasts to Investigate Therapies for Neuromuscular Disorders

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of human myoblasts. Several mouse models have been created but they either do not truly represent the human physiopathology of the disease or are not representative of the broad spectrum of mutations found in humans. The immortalization of human primary myoblasts is an alternative to this limitation; however, it is still dependent on muscle biopsies, which are invasive and not easily available. In contrast, skin biopsies are easier to obtain and less invasive to patients. Fibroblasts derived from skin biopsies can be immortalized and transdifferentiated into myoblasts, providing a source of cells with excellent myogenic potential. Here, we describe a fast and direct reprogramming method of fibroblast into a myogenic lineage. Fibroblasts are transduced with two lentiviruses: hTERT to immortalize the primary culture and a tet-inducible MYOD, which upon the addition of doxycycline, induces the conversion of fibroblasts into myoblasts and then mature myotubes, which express late differentiation markers. This quick transdifferentiation protocol represents a powerful tool to investigate pathological mechanisms and to investigate innovative gene-based or pharmacological biotherapies for neuromuscular disorders.

This protocol describes the conversion of skin fibroblasts into myoblasts and their differentiation into myotubes. The cell lines are derived from patients with neuromuscular disorders and can be used to investigate pathological mechanisms and to test therapeutic strategies.

Investigations into both the pathophysiology and therapeutic targets in muscular dystrophies have been hampered by the limited proliferative capacity of ...

Using the E1A Minigene Tool to Study mRNA Splicing Changes

mRNA processing involves multiple simultaneous steps to prepare mRNA for translation, such as 5&#180;capping, poly-A addition and splicing. Besides constitutive splicing, alternative mRNA splicing allows the expression of multifunctional proteins from one gene. As interactome studies are generally the first analysis for new or unknown proteins, the association of the bait protein with splicing factors is an indication that it can participate in mRNA splicing process, but to determine in what context or what genes are regulated is an empirical process. A good starting point to evaluate this function is using the classical minigene tool. Here we present the adenoviral E1A minigene usage for evaluating the alternative splicing changes after different cellular stress stimuli. We evaluated the splicing of E1A minigene in HEK293 stably overexpressing Nek4 protein after different stressing treatments. The protocol includes E1A minigene transfection, cell treatment, RNA extraction and cDNA synthesis, followed by PCR and gel analysis and quantification of the E1A spliced variants. The use of this simple and well-established method combined with specific treatments is a reliable starting point to shed light on cellular processes or what genes can be regulated by mRNA splicing.

This protocol presents a rapid and useful tool for evaluating the role of a protein with uncharacterized function in alternative splicing regulation after chemotherapeutic treatment.

mRNA processing involves multiple simultaneous steps to prepare mRNA for translation, such as 5&#180;capping, poly-A addition and splicing. Besides ...

Cancer Research

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes to join exons and remove introns prior to cytoplasmic export of the mature mRNA. Splicing efficiency can be altered by the presence of mutations at splice sites, the influence of trans-acting splicing factors, or the activity of therapeutics. Here, we describe the protocol for a cellular assay that can be applied for monitoring the splicing efficiency of any given exon. The assay uses an adaptable plasmid encoded 3-exon/2-intron minigene reporter, which can be expressed in mammalian cells by transient transfection. Post-transfection, total cellular RNA is isolated, and the efficiency of exon splicing in the reporter mRNA is determined by either primer extension or semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We describe how the impact of disease associated 5&#8242; splice-site mutations can be determined by introducing them in the reporter; and how the suppression of these mutations can be achieved by co-transfection with U1 small nuclear RNA (snRNA) construct carrying compensatory mutations in its 5&#8242; region that basepairs with the 5&#8242;-splice sites at exon-intron junctions in pre-mRNAs. Thus, the reporter can be used for the design of therapeutic U1 particles to improve recognition of mutant 5&#8242; splice-sites. Insertion of cis-acting&#160;regulatory sites, such as splicing enhancer or silencer sequences, into the reporter can also be used to examine the role of U1 snRNP in regulation mediated by a specific alternative splicing factor. Finally, reporter expressing cells can be incubated with small molecules to determine the effect of potential therapeutics on constitutive pre-mRNA splicing or on exons carrying mutant 5&#8242; splice sites. Overall, the reporter assay can be applied to monitor splicing efficiency in a variety of conditions to study fundamental splicing mechanisms and splicing-associated diseases.

This protocol describes a minigene reporter assay to monitor the impact of 5&#180;-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes ...

Biochemistry

Multi-exon Skipping Using Cocktail Antisense Oligonucleotides in the Canine X-linked Muscular Dystrophy

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon skipping employs short DNA/RNA-like molecules called antisense oligonucleotides (AONs) that restore the reading frame and produce shorter but functional proteins. However, exon skipping therapy faces two major hurdles: limited applicability (up to only 13% of patients can be treated with a single AON drug), and uncertain function of truncated proteins. These issues were addressed with a cocktail AON approach. While approximately 70% of DMD patients can be treated by single exon skipping (all exons combined), one could potentially treat more than 90% of DMD patients if multiple exon skipping using cocktail antisense drugs can be realized. The canine X-linked muscular dystrophy (CXMD) dog model, whose phenotype&#160;is&#160;more similar to human DMD patients, was&#160;used to test the systemic efficacy and safety of multi-exon skipping of exons 6 and 8. The CXMD dog model harbors a splice site mutation in intron 6, leading to a lack of exon 7 in dystrophin mRNA. To restore the reading frame in CXMD requires multi-exon skipping of exons 6 and 8; therefore, CXMD is a good middle-sized animal model for testing the efficacy and safety of multi-exon skipping. In the current study, a cocktail of antisense morpholinos targeting exon 6 and exon 8 was designed and it restored dystrophin expression in body-wide skeletal muscles. Methods for transfection/injection of cocktail oligos and evaluation of the efficacy and safety of multi-exon skipping in the CXMD dog model are presented.

Exon skipping is currently a&#160;most promising therapeutic option for Duchenne muscular dystrophy (DMD). To expand the applicability for DMD patients and to optimize the stability/function of the resulting truncated dystrophin proteins, a multi-exon skipping approach using cocktail antisense oligonucleotides was developed and we demonstrated systemic dystrophin rescue in a dog model.

Duchenne muscular dystrophy (DMD) is one of the most common lethal genetic diseases worldwide, caused by mutations in the dystrophin (DMD) gene. Exon ...

Characterizing Exon Skipping Efficiency in DMD Patient Samples in Clinical Trials of Antisense Oligonucleotides

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations often cause a distorted reading frame and premature stop codons, resulting in an almost total lack of dystrophin protein. The reading frame can be corrected using antisense oligonucleotides (AONs) that induce exon skipping. The morpholino AON viltolarsen (code name: NS-065/NCNP-01) has been shown to induce exon 53 skipping, restoring the reading frame for patients with exon 52 deletions. We recently administered NS-065/NCNP-01 intravenously to DMD patients in an exploratory investigator-initiated, first-in-human trial of NS-065/NCNP-01. In this methods article, we present the molecular characterization of dystrophin expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial. The characterization of dystrophin expression was fundamental in the study for showing the efficacy since no functional outcome tests were performed.

Here, we present the molecular characterization of dystrophin 38 expression using Sanger sequencing, RT-PCR, and western blotting in the clinical trial.

Duchenne muscular dystrophy (DMD) is a degenerative muscle disease that causes progressive loss of muscle mass, leading to premature death. The mutations ...

Evaluation of Exon Inclusion Induced by Splice Switching Antisense Oligonucleotides in SMA Patient Fibroblasts

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video