Name: crispr-mediated loss of function analysis in cerebellar granule cells using in utero electroporation-based gene transfer
Uploaded: 2018-06-09T13:30:00.000+00:00
Duration: 9 min 39 s
Description: Watch this Scientific Journal Video about CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer at JoVE.com

We appreciate Laura Sieber, Anna Neuerburg, Yassin Harim, and Petra Schroeter for technical assistance. We also thank Drs. K. Reifenberg, K. Dell and P. Pr&#252;ckl&#160;for helpful assistance for animal experiments at DKFZ; the Imaging Core Facilities of the DKFZ and the Carl Zeiss Imaging Center in the DKFZ for confocal microscopy imaging. This work was supported by the Deutsche Forschungsgemeinschaft, KA 4472/1-1 (to D.K.).

All animal experiments were conducted according to animal welfare regulations and have been approved by the responsible authorities (Regierungspr&#228;sidium Karlsruhe, approval numbers: G90/13, G176/13, G32/14, G48/14, and G133/14).
1. Generate pU6-sgRNA-Cbh-Cre Plasmids
<ol>
	<li>Design the sgRNA to target a gene-of-interest according to the previously published protocol14. 
	NOTE: In this experiment, two sgRNAs are designed to target the mouse Top2b gene and a non-targeted control sgRNA (Table 1). To knockout gene(s) using the CRISPR technology, sgRNAs need to be designed to target either the coding sequence of the 5&#39; region or the essential functional domain of the protein. One convenient starting point is to test publicly available pre-designed sgRNA sequences, like the GeCKO v2 mouse knockout pool library15 from the Zhang lab. Alternatively, sgRNAs can be designed using public available software such as the following website: crispr.mit.edu.</li>
	<li>Clone the sgRNAs into the pU6-sgRNA-Cbh-Cre vector. 
	NOTE: The pU6-sgRNA-Cbh-Cre vector12 used in this study is derived from the original pX330 plasmid16 by replacing the coding sequence of SpCas9 with the Cre recombinase.
	<ol>
		<li>Synthesize two DNA oligos as follows. Sense: 5&#39; - CACCGNNNNNNNNNNNNNNNNNNNN - 3&#39;; Antisense: 3&#39; - CNNNNNNNNNNNNNNNNNNNNCAAA - 5&#39;. 
		NOTE: The 20 N&#39;s shown above stand for the sgRNA sequence.</li>
		<li>Digest pU6-sgRNA-Cbh-Cre with BbsI for 30 min at 37 &#176;C using the following reagents, load the digested sample to a 1% agarose gel, and purify them using a gel-extraction kit. Use 3 &#181;g Plasmid; 3 &#181;L BbsI; 1 &#181;L FastAP; 5 &#181;L 10X digestion buffer; add ddH2O to bring the total volume to 50 &#181;L.</li>
		<li>Phosphorylate and anneal each pair of sgRNA oligos using the following reagents (10 &#181;L total volume): 1 &#181;L Customized sense oligo (100 mM); 1 &#181;L Customized antisense oligo (100 mM); 1 &#181;L 10X T4 Ligation Buffer; 6.5 &#181;L ddH2O; 0.5 &#181;L T4 PNK. Incubate in a thermo-cycler for 30 min at 37 &#176;C, and 5 min at 95 &#176;C, and then ramp down to 25 &#176;C at 5 &#176;C/min.</li>
		<li>Set up the following ligation reaction, and incubate for 10 min at room temperature (10 &#181;L total volume): X &#181;L BbsI digested plasmid (50 ng); 1 &#181;L phosphorylated and annealed, oligo duplex (1:200 dilution); 5 &#181;L 2X ligation buffer; X &#181;L ddH2O; 1 &#181;L quick ligase.</li>
		<li>Add 2 &#181;L of the ligation product into 50 &#181;L of chemically competent DH5&#945; Escherichia coli cells. After 30 min of incubation on ice, heat shock the sample for 90 s at 42 &#176;C, and incubate for 2 min on ice. Add 100 &#181;L of LB medium and plate it onto a LB plate containing 100 &#181;g/mL ampicillin. 
		NOTE: The integration of the sgRNA sequence into the pU6-sgRNA-Cbh-Cre plasmid is performed according to the cloning steps for the pX330 plasmid14.</li>
		<li>Inoculate two colonies, each in 2 mL of LB medium at 37 &#176;C for a minimum of 6 h, and perform a mini-prep DNA isolation using a kit.</li>
		<li>Sanger sequence the mini-prep DNA using the hU6-Forward primer, and identify colonies with the correct insertion of sgRNAs by aligning with the sequence shown in step 1.2.1. The primer sequence is shown in Table 1. Plasmids used in this study were named pU6-sgTop2b-1-Cbh-Cre, pU6-sgTop2b-2-Cbh-Cre, and pU6-sgControl-Cbh-Cre.</li>
		<li>Inoculate the correctly-identified colonies and purify the endotoxin-free plasmid DNA for in utero electroporation using a kit, e.g., from Qiagen. Elute the DNA with endotoxin-free TE-Buffer diluted in ddH2O at 1:10 (10% TE buffer). The DNA concentration of the plasmid needs to be higher than 2 mg/mL. 
		NOTE: Do not use a regular maxi-prep kit for DNA preparation. Store plasmid-solutions at 4 &#176;C for regular short-term use (up to 4 weeks), or aliquot an appropriate volume of about 25 &#181;L and keep at -20 &#176;C for long-term storage.</li>
	</ol>
	</li>
</ol>
2. Test the Efficiency of the sgRNAs Using the EGxxFP Plasmid System
NOTE: The efficiency of the sgRNAs is normally tested by Surveyor or T7E1 (T7 endonuclease I) assays. In this protocol, an easy and efficient alternative approach is used. The key of this approach is to use the pCAG-EGxxFP plasmid which contains overlapping EGFP fragments separated by a DNA sequence containing the sgRNA targeting site17. Upon the expression of pCAG-EGxxFP together with the sgRNA and Cas9 in the transfected cells, the Cas9-mediated double strand break (DSB) in the target sequence is repaired by endogenous homology-dependent mechanisms, which reconstitutes the EGFP expression cassette.
<ol>
	<li>Design primers to amplify the genomic region centered with the sgRNA targeting sequences. The PCR amplicon is approximately 500 bp. In this experiment, a DNA assembly was applied to clone a PCR-amplified fragment into the pCAG-EGxxFP plasmid. 
	NOTE: Alternatively, appropriate restriction sites can be added to the 5&#39; end of the PCR primers. Available restriction sites in the pCAG-EGxxFP vector are BamHI, NheI, PstI, SalI, EcoRI, and EcoRV.</li>
	<li>Amplify the genomic DNA with designed primers using the form and PCR parameters below. Load the sample (19.7 &#181;L H2O; 0.3 &#181;L of 10 ng/&#181;L mouse genomic DNA; 2.5 &#181;L 10 &#181;M EGxxFP-Top2b-F; 2.5 &#181;L 10 &#181;M EGxxFP-Top2b-R; 25 &#181;L 2X PCR master mix; 50 &#181;L total volume) onto a 1% agarose gel and gel-purify the PCR fragments using a gel-extraction kit. Use the following reaction conditions:95 &#176;C for 3 min; then 35x cycles of 98 &#176;C for 20 s, 60 &#176;C for 15 s, 72 &#176;C for 20 s, and 72 &#176;C for 1 min; 4 &#176;C, indefinitely. 
	NOTE: In this experiment, one region in Top2b exon 1 was amplified; find the primer sequences in Table 1.</li>
	<li>Digest the pCAG-EGxxFP vector with restriction enzymes BamHI and EcoRI for 2 h at 37 &#176;C, then load the sample onto a 1% agarose gel and gel-purify the vector backbone using a gel-extraction kit. Use the following reagents (50 &#181;L total volume): X &#181;L Plasmid (3 &#181;g); 2 &#181;L BamHI; 2 &#181;L EcoRI; 5 &#181;L 10X Buffer; X &#181;L ddH2O.</li>
	<li>Set up the DNA assembly reaction18 according to the manufacturer&#39;s instructions, and transform into DH5&#945; competent E. coli.</li>
	<li>Inoculate two colonies, each in 2 mL of LB medium at 37 &#176;C for a minimum of 6 h, perform a mini-prep DNA isolation using a kit, e.g., from Qiagen, and identify colonies with the correct insertion (hereafter referred to as pCAG-EG-Top2b-FP) using Sanger sequencing with the EGxxFP-Top2b-F primer.</li>
	<li>Transfect HEK293T cells.
	<ol>
		<li>Seed the HEK293T cells into a 24-well plate 24 h before transfection. 
		NOTE: Cells were cultured in a 37 &#176;C cell incubator with 5% CO2, in DMEM with glutamine supplement containing 10% FBS and 1% Penicillin/Streptomycin. Ensure that the cells are 60% confluent on the day of transfection. In this experiment, we used self-made HEK293T cells stably expressing SpCas9 to test pU6-sgRNA-Cbh-Cre. However, wildtype HEK293T cells can be used if an SpCas9 expression vector is provided.</li>
		<li>Transfect the HEK293T cells using the polyethylenimine (PEI) reagent. Transfect the cells with 120 ng/well of pCAG-EG-Top2b-FP plasmid12 and 120 ng/well of pU6-sgTop2b-1-Cbh-Cre or pU6-sgTop2b-2-Cbh-Cre in a 24-well plate. Mix the plasmid DNAs and the 1.8 &#181;L of PEI reagent in 80 &#181;L of unsupplemented DMEM medium with glutamine supplement and incubate for 15 min at room temperature after vortexing.</li>
		<li>6 h after the transfection, remove the medium and replace with fresh medium.</li>
		<li>Monitor the presence of live GFP+ cells 48 h after transfection using a fluorescence microscope at 20x magnification. 
		NOTE: The number of GFP+ cells indicates the targeting efficiency of the sgRNA. Results of effective and non-effective sgRNAs (sgTop2b-1 and sgTop2b-2, respectively) are shown in Figure 2A.</li>
	</ol>
	</li>
</ol>
3. Perform In Utero Electroporation
<ol>
	<li>Breed 6 to 8-week-old mice and prepare the tools for in utero electroporation. Cross male homozygous Rosa26-CAG-LSL-Cas9-P2A-EGFP mice with female CD-1 mice. Time the pregnancy of the CD-1 mice from the day the vaginal plug is detected (E0.5). Embryos are electroporated at day E13.5.
	<ol>
		<li>Pull borosilicate glass capillaries (inside diameter: 0.6-0.8 mm) with a micropipette puller. Use the following settings: P = 500, Heat = 560, Pull = 150, Vel = 75, Time = 250. Label the capillary tip with black ink for better visualization during the injection. Trim the capillary taper under a stereomicroscope using a ruler and sharp needle tweezers and trim the tip at a length of about 6 mm.</li>
		<li>Maintain the unity of the capillaries to keep the experiment reproducible. Create a one-sided beveled edge during the trimming. The tip should be as sharp as possible for easy penetration of the uterine wall and to avoid tissue damage of the embryo. 
		NOTE: Alternatively, use a micro grinder to adjust a 35&#176; angle19. The capillaries can be stored at room temperature in a 10 cm Petri dish under pathogen-free conditions.</li>
		<li>Autoclave the surgical instruments.</li>
		<li>Mix the sgRNA-plasmids in equal parts with pT2K-IRES-Luc to a final concentration of at least 1 &#181;g/&#181;L for each plasmid and color the plasmid-solution with fast green (final concentration of 0.05%). Prepare 1% fast green stock solution with endotoxin-free distilled water and filter through a 0.22 &#181;m filter to remove dye particles from the solution. 
		NOTE: Co-transfection of pT2K IRES-Luc is optional, but allows for identification of viable electroporated animals after birth using bioluminescence imaging. Please see step 3.5. Prepare a sufficient amount of plasmid-mix for the total number of pregnant mice to be operated. Use about 15-20 &#181;L mix per mouse (~ 12 embryos). Proceed immediately with the surgery.</li>
	</ol>
	</li>
	<li>Prepare mice for surgery.
	<ol>
		<li>Anesthetize pregnant CD-1 mice with isoflurane. Induce anesthesia in a box with 3-4 vol-% isoflurane (oxygen flow rate: 1.5 L/min) and maintain it with 2 vol-% during surgery via nose cone. 
		NOTE: The complete surgery should not take longer than 30 min. Reduce the number of injected and electroporated embryos, if necessary.&#160;Use sterile gloves for surgery.</li>
		<li>Place the mouse on its back on a heating pad and adjust anesthesia.</li>
		<li>Inject analgesic (Metamizol, 800 mg/kg body weight, subcutaneously (s.c.), 24 h depot). 
		NOTE: You may use other authorized analgesics than Metamizol.</li>
		<li>Apply eye ointment to prevent eye-dryness during surgery.</li>
		<li>Fix limbs with tape and sterilize the abdomen with a disinfectant. Cover the mouse with gauze, leaving only the surgical area exposed. Spread 70% ethanol over surgical area and gauze.</li>
		<li>Make a skin incision of about 2 cm in length and widen the gap gently with straight surgical scissors. Locate the linea alba and make a slightly smaller second incision through the peritoneum using tissue scissors with blunt tip.</li>
		<li>Moisten the opened abdominal cavity with pre-warmed sterile 1x PBS.</li>
		<li>Carefully extract the uterine horns from the abdominal cavity using ring forceps. Pull gently by grabbing the uterine wall solely at the gap between the yolk sacs of two neighboring embryos.Avoid any pressure on the embryo while pulling it through the incision. Enlarge the incision if necessary and take extra care to position the uterine horns onto the abdomen while not compressing blood flow through the uterine artery. 
		NOTE: In some cases, it is advised to extract one uterine horn at a time and replace it before proceeding with the second uterine horn.</li>
	</ol>
	</li>
	<li>Injection and electroporation of plasmid DNAs
	<ol>
		<li>Aspirate approximately 15 &#181;L of colored plasmid-solution with the prepared glass capillary. Avoid any air-bubbles during this process. 
		NOTE: The plasmid-solution can clog the tip easily if its concentration is high. Test the capillary by releasing some DNA right before the injection.</li>
		<li>Gently hold the embryo with ring forceps and locate the neck area. 
		NOTE: If the embryo is in a position difficult to inject, skip it and go for the next embryo. Increased repositioning of the embryo may increase chances of damage to them.</li>
		<li>Slowly pierce with the tip of the previously prepared glass capillary into the fourth ventricle by penetrating through the dorsal hindbrain and subsequently inject about 1 &#181;L of the plasmid-mix. Confirm that the dyed DNA is not leaked from the brain and is visible as a diamond shaped structure. 
		NOTE: As an option, use 2.5-fold magnifying glasses for better visualization of the fourth ventricle and surrounding blood vessels. Deliver electric pulses immediately after injection to prevent diffusion of the plasmid-solution to the other ventricles.</li>
		<li>Apply electric square pulses (5 pulses, 32 mV, 50 ms-on, 950 ms-off) with forceps-like platinum tweezers (see Table of Materials). Place the electrodes laterally with the negative pole covering the ear and the positive pole positioned at the cerebellar primordium over the uterine wall. Use 5 mm-diameter electrode plates for effective electroporation of E13.5 embryos. 
		NOTE: Increase the survival rate of pups by manipulating less than 2/3rd of the total number of embryos per dam. Avoid embryos too close to the cervix. If manipulated, they might cause complications during labor and jeopardize the entire litter. If electrodes are too close to the embryo&#39;s heart, this may cause cardiac arrest.</li>
	</ol>
	</li>
	<li>Post-electroporation and post-surgery care
	<ol>
		<li>Carefully place uterine horns back into the abdominal cavity and fill with pre-warmed sterile 1x PBS. Let the uterine horns slide into a natural position.</li>
		<li>Close the peritoneum and skin separately with a simple continuous suture. 
		NOTE: Take extra care not to pierce through the uterine wall when suturing the peritoneum.</li>
		<li>Shut-down the anesthesia and place the animal belly-down into a new cage.</li>
		<li>Monitor the animal during the waking phase and again 24 h after the surgery. Place the cage under a heating lamp, if the trembling doesn&#39;t improve within a 15 min time-frame and the animal doesn&#39;t start grooming.</li>
		<li>Confirm successful electroporation by luciferase imaging.
		<ol>
			<li>Make sure that the operated dams drop embryos on time (at E19.5). 
			NOTE: The birthdate may be delayed to the next day probably because of the operation.</li>
			<li>Anesthetize the electroporated pups (P5-P7) with 2.5% isoflurane and inject (intraperitoneal (i.p.)) with D-Luciferin (3 mg/kg body weight) 5 min prior to imaging.</li>
			<li>Detect luciferase signals in the electroporated pups using the bioluminescence imager. 
			NOTE: A 1 min exposure time is sufficient to detect the luciferase signal. Radiance (p/s/cm2/sr) is approximately &#62;1 x 106.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
4. Prepare Cryosections from the Electroporated Cerebella
<ol>
	<li>Euthanize the electroporated P7 pups and dissect out the cerebellum. 
	NOTE: The GFP signal can be observed using an epifluorescent stereoscope.</li>
	<li>Fix the cerebella overnight in 5 mL per brain of 4% PFA in PBS at 4 &#176;C.</li>
	<li>Transfer the fixed cerebella overnight in 10 mL per brain of 30% sucrose in PBS at 4 &#176;C. 
	NOTE: The tissue should reach the bottom of a 15-mL tube after incubation in the sucrose solution.</li>
	<li>After soaking up the remaining sucrose solution with a piece of cellulose filter paper, immerse the cerebellum in an optimal cutting temperature (OCT) compound in a disposable plastic mold and freeze it on dry ice. The cryogenic block can be stored at -80 &#176;C until use. 
	NOTE: The protocol can be paused here.</li>
	<li>Cut the cryogenic block into sections with 10 &#181;m in thickness using a cryostat and keep the sections at -80 &#176;C until use. 
	NOTE: One can confirm GFP expression in the sections, after washing out the OCT compound with PBS.</li>
</ol>
5. Immunostaining of the Cryosections
<ol>
	<li>Dry the slides at room temperature for 30 min and wash twice for 10 min in PBS.</li>
	<li>Circle the sections with a liquid blocker pen and incubate the sections in a blocking solution (10% normal donkey serum in PBS containing 0.1% Triton-X100) for 1 h at room temperature.</li>
	<li>Add primary antibodies against the molecules of interest (e.g., GFP and topoisomerase II beta (Top2B) in this study) in the blocking solution and incubate overnight at 4 &#176;C. 
	NOTE: The names and concentrations of antibodies used are listed in the Table of Materials. In order to enhance GFP signals, an anti-GFP antibody can be optionally used together with the other antibodies.</li>
	<li>Wash the slides with 0.1% Triton-containing PBST 3X for 10 min. Incubate the sections for 1 h at room temperature with a fluorophore-conjugated secondary antibody diluted in the blocking solution containing DAPI.</li>
	<li>Wash the slides in PBS 3X for 10 min. Mount the slides and keep at 4 &#176;C until imaging. 
	NOTE: The protocol can be paused here.</li>
</ol>
6. Imaging and Analysis
<ol>
	<li>Image the sections using a confocal microscope at 20x magnification.</li>
	<li>Count the number of GFP positive cells losing the expression of the target protein. A representative image is shown in Figure 2B.</li>
	<li>Check the molecular phenotype upon ablation of the target genes in GNPs and their progenies by immuostaining12.</li>
</ol>

<ol>
	<li>Mikuni, T., Nishiyama, J., Sun, Y., Kamasawa, N., Yasuda, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-Throughput,+High-Resolution+Mapping+of+Protein+Localization+in+Mammalian+Brain+by+In+Vivo+Genome+Editing.">High-Throughput, High-Resolution Mapping of Protein Localization in Mammalian Brain by In Vivo Genome Editing.</a> Cell. 165 (7), 1803-1817 (2016).</li><li>Zuckermann, M., Hovestadt, V., Knobbe-Thomsen, C. B., Zapatka, M., Northcott, P. A., Schramm, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Somatic+CRISPR/Cas9-mediated+tumour+suppressor+disruption+enables+versatile+brain+tumour+modelling.">Somatic CRISPR/Cas9-mediated tumour suppressor disruption enables versatile brain tumour modelling.</a> Nat Commun. 6, 7391 (2015).</li><li>Chen, F., Rosiene, J., Che, A., Becker, A., LoTurco, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+and+transforming+neocortical+progenitors+by+CRISPR/Cas9+gene+targeting+and+piggyBac+transposase+lineage+labeling.">Tracking and transforming neocortical progenitors by CRISPR/Cas9 gene targeting and piggyBac transposase lineage labeling.</a> Development. 142 (20), 3601-3611 (2015).</li><li>Saito, T., Nakatsuji, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+gene+transfer+into+the+embryonic+mouse+brain+using+in+vivo+electroporation.">Efficient gene transfer into the embryonic mouse brain using in vivo electroporation.</a> Developmental biology. 240 (1), 237-246 (2001).</li><li>Matsuda, T., Cepko, C. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Electroporation+and+RNA+interference+in+the+rodent+retina+in+vivo+and+in+vitro.">Electroporation and RNA interference in the rodent retina in vivo and in vitro.</a> Proc Natl Acad Sci U S A. 101 (1), 16-22 (2004).</li><li>Matsui, A., Yoshida, A. C., Kubota, M., Ogawa, M., Shimogori, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mouse+in+utero+electroporation:+controlled+spatiotemporal+gene+transfection.">Mouse in utero electroporation: controlled spatiotemporal gene transfection.</a> J Vis Exp. (54), (2011).</li><li>Kawauchi, D., Taniguchi, H., Watanabe, H., Saito, T., Murakami, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+visualization+of+nucleogenesis+by+precerebellar+neurons:+involvement+of+ventricle-directed,+radial+fibre-associated+migration.">Direct visualization of nucleogenesis by precerebellar neurons: involvement of ventricle-directed, radial fibre-associated migration.</a> Development. 133 (6), 1113-1123 (2006).</li><li>Kawauchi, D., Saito, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+cascade+from+Math1+to+Mbh1+and+Mbh2+is+required+for+cerebellar+granule+cell+differentiation.">Transcriptional cascade from Math1 to Mbh1 and Mbh2 is required for cerebellar granule cell differentiation.</a> Developmental biology. 322 (2), 345-354 (2008).</li><li>Saba, R., Nakatsuji, N., Saito, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+BarH1+confers+commissural+neuron+identity+on+dorsal+cells+in+the+spinal+cord.">Mammalian BarH1 confers commissural neuron identity on dorsal cells in the spinal cord.</a> Journal of Neuroscience. 23 (6), 1987-1991 (2003).</li><li>Sato, T., Muroyama, Y., Saito, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inducible+gene+expression+in+postmitotic+neurons+by+an+in+vivo+electroporation-based+tetracycline+system.">Inducible gene expression in postmitotic neurons by an in vivo electroporation-based tetracycline system.</a> J Neurosci Methods. 214 (2), 170-176 (2013).</li><li>Kawauchi, D., Ogg, R. J., Liu, L., Shih, D. J. H., Finkelstein, D., Murphy, B. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+MYC-driven+medulloblastoma+models+from+multiple+embryonic+cerebellar+cells.">Novel MYC-driven medulloblastoma models from multiple embryonic cerebellar cells.</a> Oncogene. , (2017).</li><li>Feng, W., Kawauchi, D., Korkel-Qu, H., Deng, H., Serger, E., Sieber, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chd7+is+indispensable+for+mammalian+brain+development+through+activation+of+a+neuronal+differentiation+programme.">Chd7 is indispensable for mammalian brain development through activation of a neuronal differentiation programme.</a> Nat Commun. 8, 14758 (2017).</li><li>Platt, R. J., Chen, S., Zhou, Y., Yim, M. J., Swiech, L., Kempton, H. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+engineering+using+the+CRISPR-Cas9+system.">Genome engineering using the CRISPR-Cas9 system.</a> Nat Protoc. 8 (11), 2281-2308 (2013).</li><li>Joung, J., Konermann, S., Gootenberg, J. S., Abudayyeh, O. O., Platt, R. J., Brigham, M. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+CRISPR-Cas9+knockout+and+transcriptional+activation+screening.">Genome-scale CRISPR-Cas9 knockout and transcriptional activation screening.</a> Nat Protocols. 12 (4), 828-863 (2017).</li><li>Cong, L., Ran, F. A., Cox, D., Lin, S., Barretto, R., Habib, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplex+genome+engineering+using+CRISPR/Cas+systems.">Multiplex genome engineering using CRISPR/Cas systems.</a> Science. 339 (6121), 819-823 (2013).</li><li>Mashiko, D., Fujihara, Y., Satouh, Y., Miyata, H., Isotani, A., Ikawa, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+mutant+mice+by+pronuclear+injection+of+circular+plasmid+expressing+Cas9+and+single+guided+RNA.">Generation of mutant mice by pronuclear injection of circular plasmid expressing Cas9 and single guided RNA.</a> Scientific Reports. 3, 3355 (2013).</li><li>Gibson, D. G., Smith, H. O., Hutchison, C. A., Venter, J. C., Merryman, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+synthesis+of+the+mouse+mitochondrial+genome.">Chemical synthesis of the mouse mitochondrial genome.</a> Nature. 7 (11), 901-903 (2010).</li><li>Baumgart, J., Baumgart, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cortex-,+Hippocampus-,+Thalamus-,+Hypothalamus-,+Lateral+Septal+Nucleus-+and+Striatum-specific+In+Utero+Electroporation+in+the+C57BL/6+Mouse.">Cortex-, Hippocampus-, Thalamus-, Hypothalamus-, Lateral Septal Nucleus- and Striatum-specific In Utero Electroporation in the C57BL/6 Mouse.</a> J Vis Exp. (107), e53303 (2016).</li><li>Martinez, S., Andreu, A., Mecklenburg, N., Echevarria, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cellular+and+molecular+basis+of+cerebellar+development.">Cellular and molecular basis of cerebellar development.</a> Frontiers in Neuroanatomy. 7, 18 (2013).</li></ol>

The authors have nothing to disclose.

Using exo utero electroporation, we have previously reported siRNA-based in vivo functional analyses of Atoh1 at an early stage of cerebellar granule cell differentiation8. Due to siRNA dilution/degradation and exposure of embryos outside the uterine wall, phenotypic analysis of the electroporated granule cells was limited to embryonic stages. However, the current method enabled analysis of the phenotype of postnatal animals.
Our previous study demonstrated that Cas9-mediated knockout of tumor suppressor Ptch1 via in utero electroporation successfully induced medulloblastoma2. In comparison, the current approach exhibits two major advantages: 1) Cas9 does not have to be delivered with the plasmid, allowing for multiple gene targeting by carrying multiple sgRNA expression cassettes in a single plasmid instead; and 2) the target cells and their progenies are permanently labeled with GFP, enabling visualization of the live cells and analysis of the behavior of transforming tumor cells in vivo.
The most critical steps of this protocol are the proper injection of plasmid DNAs into the correct location and the delivery of electric pulses into the appropriate places in the brain. Cerebellar neurons are born from the cerebellar neuroepithelium sequentially in a birthdate-dependent manner. Not all types of cells in the cerebellar primordium can be targeted via electroporation, because only a specific time window at E12.5-14.5 is technically feasible. Deep cerebellar nuclei neurons and Purkinje cells have been known to arise at E10.5-11.5, when the extra-embryonic membranes are not transparent, and the embryo is not clearly visible for DNA injection. Later, unipolar brush cells are derived from E17.5 upper RL (uRL), when the fourth ventricle is too narrow to inject a sufficient amount of DNA in the vicinity of the uRL. Thus, our method is only applicable at E12.5-14.5, which mainly targets mid- and later-born progenitors, such as GNPs and inhibitory interneurons. Another drawback of the method is that a full knockout phenotype may not be feasible when compared to Cre/LoxP-mediated germline GEMMs, since only thousands of cerebellar cells can be targeted by electroporation in each embryo.
In an earlier study, approximately 80% of GFP-positive cerebellar granule cells lost expression of the targeted gene12. While the identity of the granule cells was confirmed by molecular markers and their distribution, this identification approach might not be always applicable, as genes of interest could be involved in the marker expression and neuronal migration. Conditional activation of Cre using a cell-specific promoter would solve the problem in this case. Therefore, the current ubiquitous Cbh promoter in the pU6-sgRNA-Cbh-Cre plasmid can be replaced with a cell-specific promoter.

Brain diseases are one of the most dreadful mortal diseases. They often result from genetic mutations and subsequent dysregulation. To understand molecular mechanisms of brain diseases, ever-lasting efforts to decipher the genomes of human patients have discovered a number of potential causative genes. So far, germline genetically engineered animal models have been utilized for in vivo gain-of-function (GOF) and loss-of-function (LOF) analyses of such candidate genes. Due to the accelerated development of functional validation studies, a more feasible and flexible in vivo gene assay system for studying gene function is desirable.
The application of an in vivo electroporation-based gene transfer system to the developing mouse brain is suitable for this purpose. In fact, several studies using in utero electroporation have shown their potential to conduct functional analyses in the developing brain1,2,3. Actually, several regions of the mouse brain, such as the cerebral cortex4, retina5, diencephalon6, hindbrain7, cerebellum8, and spinal cord9 have been targeted by somatic gene delivery approaches, so far.
Indeed, transient gene expression by in vivo electroporation on embryonic mouse brains has long been used for GOF analysis. Recent transposon-based genomic integration technologies further enabled long-term and/or conditional expression of genes of interest10,11, which is advantageous to dissect gene function in a spatial and temporal manner during development. In contrast to GOF analysis, LOF analysis has been more challenging. While transient transfection of siRNAs and shRNA-carrying plasmids was performed, long-term effects of LOF of genes are not guaranteed due to eventual degradation of exogenously introduced nucleic acids, such as plasmids and dsRNAs. However, the CRISPR/Cas technology provides a break-through in LOF analyses. Genes encoding fluorescent proteins (e.g., GFP) or bioluminescent proteins (e.g., firefly luciferase) have been co-transfected with CRISPR-Cas9 and sgRNAs to label the cells exposed to CRISPR-Cas9-mediated somatic mutations. Nevertheless, this approach might have limitations in functional studies on proliferating cells, since exogenous marker genes are diluted and degraded after long-term proliferation. While the transfected cells and their daughter cells undergo CRISPR-induced mutations in their genomes, their footprints might get lost over time. Thus, genetic labeling approaches would be suitable to overcome this issue.
We recently developed a CRISPR-based LOF method in cerebellar granule cells that undergo long-term proliferation during their differentiation12. To genetically label the transfected cells, we constructed a plasmid carrying a sgRNA together with Cre and introduced the plasmid into the cerebella of Rosa26-CAG-LSL-Cas9-P2A-EGFP mice13 using in utero electroporation. Unlike regular plasmid vectors encoding EGFP, this approach successfully labeled transfected granule neuron precursors (GNPs) and their daughter cells. This method provides great support in understanding in vivo function of genes of interest in proliferating cells in normal brain development and a tumor-prone background.

<table><tbody><tr><td>Alexa 488 Goat anti-Chicken</td><td>ThermoFisher</td><td>A11039</td><td>1:400 dilution</td></tr><tr><td>Alexa 568 Donkey anti-Mouse</td><td>Life Technologies</td><td>A-10037</td><td>1:400 dilution</td></tr><tr><td>Alexa 594 Donkey anti-Rabbit</td><td>ThermoFisher</td><td>A21207</td><td>1:400 dilution</td></tr><tr><td>Alexa 647 Donkey anti-Rabbit</td><td>Life Technologies</td><td>A31573</td><td>1:400 dilution</td></tr><tr><td>Alkaline Phosphatase (FastAP)</td><td>ThermoFisher</td><td>EF0654</td><td></td></tr><tr><td>Autoclave band</td><td>Kisker Biotech</td><td>150262</td><td></td></tr><tr><td>BamHI (HF)</td><td>NEB</td><td>R3136S</td><td></td></tr><tr><td>BbsI (FastDigest)</td><td>ThermoFisher</td><td>FD1014</td><td></td></tr><tr><td>Cellulose Filter Paper (Whatman)</td><td>Sigma-Aldrich</td><td>WHA10347525</td><td></td></tr><tr><td>Cloth</td><td>Tork</td><td>530378</td><td></td></tr><tr><td>Confocal laser scanning microscope</td><td>Zeiss</td><td>LSM800</td><td></td></tr><tr><td>D-Luciferin</td><td>biovision</td><td>7903-1</td><td></td></tr><tr><td>DAPI</td><td>Sigma-Aldrich</td><td>D9542</td><td>1:1000 dilution</td></tr><tr><td>Disposable plastic molds (Tissue-Tek Cyromold)</td><td>VWR</td><td>4566</td><td></td></tr><tr><td>DMEM Glutamax</td><td>ThermoFisher</td><td>31966047</td><td></td></tr><tr><td>Donkey serum</td><td>Sigma-Aldrich</td><td>D9663</td><td></td></tr><tr><td>EcoRI (HF)</td><td>NEB</td><td>R3101S</td><td></td></tr><tr><td>Electro Square Porator</td><td>BTX</td><td>ECM830</td><td></td></tr><tr><td>Endofree Maxi Kit</td><td>Qiagen</td><td>12362</td><td></td></tr><tr><td>Ethanol</td><td>Merck</td><td>107017</td><td></td></tr><tr><td>Eye ointment (Bepanthen)</td><td>Bayer</td><td>81552983</td><td></td></tr><tr><td>Fast Green</td><td>Merck</td><td>104022</td><td></td></tr><tr><td>FBS</td><td>ThermoFisher</td><td>10270-016</td><td></td></tr><tr><td>Filter (0.22 &amp;micro;m)</td><td>Merck</td><td>F8148</td><td></td></tr><tr><td>Fluorescent cell imager (ZOE)</td><td>Biorad</td><td>1450031</td><td></td></tr><tr><td>Forceps straight</td><td>Fine Science Tools</td><td>91150-20</td><td></td></tr><tr><td>Gauze (X100 ES-pads 8f 10 x 10 cm)</td><td>Fisher Scientific</td><td>15387311</td><td></td></tr><tr><td>GFP antibody</td><td>Abcam</td><td>ab13970</td><td>1:1000 dilution</td></tr><tr><td>Gibson Assembly Master Mix</td><td>NEB</td><td>E2611S</td><td></td></tr><tr><td>Glass Capillary with Filament</td><td>Narishige</td><td>GD1-2</td><td></td></tr><tr><td>Heating Pad</td><td>ThermoLux</td><td>463265 / -67</td><td></td></tr><tr><td>Image Processing software (ImageJ and Fiji)</td><td>NIH</td><td>-</td><td></td></tr><tr><td>Insulin syringe (B. Braun OMNICAN U-100)</td><td>Carl Roth</td><td>AKP0.1</td><td></td></tr><tr><td>Isoflurane</td><td>Zoetis</td><td>TU061219</td><td></td></tr><tr><td>IVIS Lumina LT Series III Caliper</td><td>Perkin Elmer</td><td>CLS136331</td><td></td></tr><tr><td>Kalt Suture Needles</td><td>Fine Science Tools</td><td>12050-02</td><td></td></tr><tr><td>KAPA HIFI HOTSTART READY mix</td><td>Kapa Biosystems</td><td>KK2601</td><td></td></tr><tr><td>Ki67 antibody</td><td>Abcam</td><td>ab15580</td><td>1:500 dilution</td></tr><tr><td>Light Pointer</td><td>Photonic</td><td>PL3000</td><td></td></tr><tr><td>Liquid blocker pen</td><td>Kisker Biotech</td><td>MKP-1</td><td></td></tr><tr><td>Metamizol</td><td>WDT</td><td>-</td><td></td></tr><tr><td>Microgrinder</td><td>Narishige</td><td>EG-45</td><td></td></tr><tr><td>Microinjector</td><td>Narishige</td><td>IM300</td><td></td></tr><tr><td>Micropipette Puller</td><td>Sutter Instrument Co.</td><td>P-97</td><td></td></tr><tr><td>Microscope software ZEN</td><td>Zeiss</td><td>-</td><td></td></tr><tr><td>Non-sterile Silk Suture Thread (0.12 mm)</td><td>Fine Science Tools</td><td>18020-50</td><td></td></tr><tr><td>O.C.T. Compound (Tissue-Tek)</td><td>VWR</td><td>4583</td><td></td></tr><tr><td>p27 antibody</td><td>BD bioscience</td><td>610241</td><td>1:200 dilution</td></tr><tr><td>Paraformaldehyde</td><td>Roth</td><td>335.3</td><td></td></tr><tr><td>PBS (1x)</td><td>Life Technologies</td><td>14190169</td><td></td></tr><tr><td>pCAG-EGxxFP</td><td>Addgene</td><td>50716</td><td></td></tr><tr><td>Polyethylenimine</td><td>Sigma-Aldrich</td><td>408727</td><td></td></tr><tr><td>pX330 plasmid</td><td>Addgene</td><td>42230</td><td></td></tr><tr><td>QIAprep Spin Miniprep Kit</td><td>Qiagen</td><td>27104</td><td></td></tr><tr><td>QIAquick Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td></td></tr><tr><td>Quick Ligation Kit</td><td>NEB</td><td>M2200S</td><td></td></tr><tr><td>Ring Forceps</td><td>Fine Science Tools</td><td>11103-09</td><td></td></tr><tr><td>Slides (SuperFrost)</td><td>ThermoFisher</td><td>10417002</td><td></td></tr><tr><td>Software for biostatistics (Prism 7)</td><td>GraphPad Software, Inc</td><td>-</td><td></td></tr><tr><td>Spitacid</td><td>EcoLab</td><td>3003840</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>C-PS</td><td></td></tr><tr><td>Sucrose</td><td>Sigma-Aldrich</td><td>S5016</td><td></td></tr><tr><td>Surgical scissors</td><td>Fine Science Tools</td><td>91460-11</td><td></td></tr><tr><td>Surgical scissors with blunt tip</td><td>Fine Science Tools</td><td>14072-10</td><td></td></tr><tr><td>Suture (Supramid schwarz DS 16, 1.5 (4/0))</td><td>SMI</td><td>220340</td><td></td></tr><tr><td>T4 DNA Ligation Buffer</td><td>NEB</td><td>B0202S</td><td></td></tr><tr><td>T4 PNK</td><td>NEB</td><td>M0201S</td><td></td></tr><tr><td>Tissue scissors Blunt (11.5 cm)</td><td>Fine Science Tools</td><td>14072-10</td><td></td></tr><tr><td>TOP2B antibody</td><td>Santa Cruz</td><td>sc13059</td><td>1:200 dilution</td></tr><tr><td>Trypsin (2.5 %)</td><td>ThermoFisher</td><td>15090046</td><td></td></tr><tr><td>Tweezers w/5mm &amp;Oslash; disk electrodes Platinum</td><td>Xceltis GmbH</td><td>CUY650P5</td><td></td></tr><tr><td>Vaporizer</td><td>Dr&amp;auml;gerwerk AG</td><td>GS186</td><td></td></tr></tbody></table>

crispr-mediated loss of function analysis in cerebellar granule cells using in utero electroporation-based gene transfer

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors of the diseases. To validate the contribution of a dysfunction of the mutated genes to disease development, the generation of animal models carrying the mutations is one obvious approach. While germline genetically engineered mouse models (GEMMs) are popular biological tools and exhibit reproducible results, it is restricted by time and costs. Meanwhile, non-germline GEMMs often enable exploring gene function in a more feasible manner. Since some brain diseases (e.g., brain tumors) appear to result from somatic but not germline mutations, non-germline chimeric mouse models, in which normal and abnormal cells coexist, could be helpful for disease-relevant analysis. In this study, we report a method for the induction of CRISPR-mediated somatic mutations in the cerebellum. Specifically, we utilized conditional knock-in mice, in which Cas9 and GFP are chronically activated by the CAG (CMV enhancer/chicken &#223;-actin) promoter after Cre-mediated recombination of the genome. The self-designed single-guide RNAs (sgRNAs) and the Cre recombinase sequence, both encoded in a single plasmid construct, were delivered into cerebellar stem/progenitor cells at an embryonic stage using in utero electroporation. Consequently, transfected cells and their daughter cells were labeled with green fluorescent protein (GFP), thus facilitating further phenotypic analyses. Hence, this method is not only showing electroporation-based gene delivery into embryonic cerebellar cells but also proposing a novel quantitative approach to assess CRISPR-mediated loss-of-function phenotypes.

For in vivo functional analysis, it is critical to identify the cells into which exogenous gene(s) have been introduced. While the expression of a marker, such as GFP in non-proliferating cells can be followed-up for a long period of time, the signal gets sequentially lost in proliferating cells. An illustration of this effect is demonstrated in Figure 1. To circumvent losing the footprint of transfected cells in LOF analyses, we developed a novel approach by combining electroporation-based gene delivery with the CRISPR/Cas9 technology.
Representative results are shown in Figure 2. Functionality of the plasmid constructs is tested by transient transfection of pU6-sgTop2b-Cbh-Cre and pCAG-EG-Top2b-FP17, carrying the sgTop2b target sequence, into HEK293T cells stably expressing SpCas9 (Figure 2A). The sgRNA-guided Cas9 endonuclease activity induces DSB-mediated homology-directed repair of the EGFP expression cassette. Hence, the function of the sgRNA was directly analyzed by detection of GFP expression. According to Mashiko et al., a transfection efficiency of more than 30% determines an sgRNA as effective17.
GNPs originate from the rhombic lip (RL), a region bordering the roof of the fourth ventricle at embryonic stages E12.5 until E16.5. These cells have been known to undergo massive proliferation after birth in the outer external granule layer (oEGL) and shift to the inner EGL (iEGL) after exiting cell cycle20. Thus, GNPs are an appropriate example to test the advantages of our genetic labeling approach.
By following this protocol, in utero electroporation of GNPs allows tracing of edited cells with GFP. We introduced the pU6-sgRNA-Cbh-Cre plasmid expressing sgControl into the cerebellar primordium of Rosa26-CAG-LSL-Cas9-P2A-EGFP mice at embryonic stage E13.5. Mice were sacrificed at postnatal day P7, and sagittal sections of cerebellar tissue sections were stained by immunohistochemistry. Outer and inner EGL were defined by Ki67 expression (oEGL) and p27 expression (iEGL), respectively. Despite undergoing proliferation and maturation, mature cerebellar granule neurons (CGNs) still retained strong GFP expression (Figure 2B).
Emphasizing the utility of this protocol, we furthermore used the sgRNA targeting DNA Top2b as a representative example. Experimental procedures were performed as described above (see Figure 2B). Most of the GFP-positive cells transfected with sgRNAs for Top2b exhibited a loss of Top2b expression in the internal granule layer (IGL), while the introduction of control sgRNAs did not result in clear reduction of its expression (Figure 2C). A quantification of this result is shown in Figure 2D. These data present a valuable tool for tracing edited cells for a long period of time during development or tumor formation.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57311/57311fig1.jpg" /> 
Figure 1: Schematic representation of GFP expression in proliferating and non-proliferating cells. (A) When an exogenous gene encoding GFP (e.g., pCAG-EGFP) is transfected in non-proliferating cells, the cells may express GFP for a long time (upper lane). Meanwhile, GFP expression could disappear in proliferating cells due to dilution of exogenous GFP (middle lane). In contrast, the cells that carry the LoxP-Stop-LoxP-GFP (LSL-GFP) transgene can keep the GFP expression during proliferation after transfection with Cre recombinase (lower lane). (B) The principle of SpCas9-mediated gene silencing and GFP expression after Cre and sgRNA transfection in a Rosa26-CAG-LSL-Cas9-P2A-EGFP mouse strain. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57311/57311fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57311/57311fig2.jpg" /> 
Figure 2: Representative images of results from this protocol. (A) HEK293T cells stably expressing SpCas9 were transfected with pU6-sgTop2b-Cbh-Cre and pCAG-EG-Top2b-FP plasmids. GFP expression in live cells was monitored using a fluorescent cell imager (see Table of Materials) 48 h after transfection. Left and right panels show an effective and non-effective sgRNA sequence based on GFP expression, respectively. Scale bars: 100 &#181;m. (B) Immunostaining of GFP, Ki67, and p27 on the P7 cerebella from a Rosa26-CAG-LSL-Cas9-P2A-EGFP mouse subjected to electroporation at E13.5 with pU6-sgRNA-Cbh-Cre plasmid constructs expressing control sgRNA. The section is counterstained with DAPI (blue). Scale bars: 50 &#181;m; 20x magnification. Note GFP-expressing cells in the oEGL marked by Ki67. (C) Immunostaining of GFP (green) and Top2b (magenta) on the P7 cerebella from a Rosa26-CAG-LSL-Cas9-P2A-EGFP mouse that was electroporated at E13.5 with pU6-sgRNA-Cbh-Cre plasmid constructs expressing sgRNA against Top2b (sgTop2b) and a control sequence (sgControl). Arrows indicate Top2b expression in GFP+ cells in the same field. Scale bars: 20 &#181;m; 20x magnification. (D) Quantification of Top2b in electroporated (GFP-positive) cells in sgControl and sgTop2b experiments. Two and three pups were investigated for sgControl and sgTop2b, respectively, and 25 cells from each brain were analyzed. Error bars represent &#177; standard error of the mean (SEM) and p-values were calculated by unpaired t-test, *p = 0.0002. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57311/57311fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Name</td>
			<td colspan="2">Sequence</td>
			<td>Application</td>
		</tr>
		<tr>
			<td>sgTop2b-1</td>
			<td colspan="2">CTTCGTCCTGATACATACAT</td>
			<td>sgRNA target sequence</td>
		</tr>
		<tr>
			<td>sgTop2b-2</td>
			<td colspan="2">AGCTGTCCAAAAATTAAAGC</td>
			<td>sgRNA target sequence</td>
		</tr>
		<tr>
			<td>sgControl</td>
			<td colspan="2">GCGACCAATACGCGAACGTC&#8232;</td>
			<td>sgRNA target sequence</td>
		</tr>
		<tr>
			<td>EGxxFP-Top2b-F</td>
			<td colspan="2">gctgcccgacaaccactgagTACCTTGATATCTTAGAGAGCTG</td>
			<td>Cloning into pCAG-EGxxFP</td>
		</tr>
		<tr>
			<td>EGxxFP-Top2b-R</td>
			<td colspan="2">gggtcagcttgccgatatcgCTCGCGCATTGTCTTAGC</td>
			<td>Cloning into pCAG-EGxxFP</td>
		</tr>
		<tr>
			<td>hU6-F</td>
			<td colspan="2">GAGGGCCTATTTCCCATGATT</td>
			<td>Sequencing for sgRNA</td>
		</tr>
	</tbody>
</table>
Table 1: Sequences of oligos being used in this study.

Watch this Scientific Journal Video about CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer at JoVE.com

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Conventional loss-of-function studies of genes using knockout animals have often been costly and time-consuming. Electroporation-based CRISPR-mediated somatic mutagenesis is a powerful tool to understand gene functions in vivo. Here, we report a method to analyze knockout phenotypes in proliferating cells of the cerebellum.

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Brain malformation is often caused by genetic mutations. Deciphering the mutations in patient-derived tissues has identified potential causative factors ...

crispr-mediated-loss-function-analysis-cerebellar-granule-cells-using

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

9.4K Views.  German Cancer Research Center (DKFZ), DKFZ-ZMBH Alliance. Conventionele studies van de verlies-van-functie van genen met behulp van knock-out dieren zijn vaak kostbare en tijdrovende geweest. Electroporation gebaseerde CRISPR-gemedieerde somatische mutagenese is een krachtig hulpmiddel om te begrijpen gen functioneert in vivo. Wij rapporteren hier een methode voor het analyseren van de knock-out fenotypen in delende cellen van het cerebellum.

Video: CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Induction of Protein Deletion Through In Utero Electroporation to Define Deficits in Neuronal Migration in Transgenic Models

Genetic deletion using the Cre-Lox system in transgenic mouse lines is a powerful tool used to study protein function. However, except in very specific Cre models, deletion of a protein throughout a tissue or cell population often leads to complex phenotypes resulting from multiple interacting mechanisms. Determining whether a phenotype results from disruption of a cell autonomous mechanism, which is intrinsic to the cell in question, or from a non-cell autonomous mechanism, which would result from impairment of that cell&#8217;s environment, can be difficult to discern. To gain insight into protein function in an in vivo context, in utero electroporation (IUE) enables gene deletion in a small subset of cells within the developing cortex or some other selected brain region. IUE can be used to target specific brain areas, including the dorsal telencephalon, medial telencephalon, hippocampus, or ganglionic eminence. This facilitates observation of the consequences of cell autonomous gene deletion in the context of a healthy environment. The goal of this protocol is to show how IUE can be used to analyze a defect in radial migration in a floxed transgenic mouse line, with an emphasis on distinguishing between the cell autonomous and non-cell autonomous effects of protein deletion. By comparing the phenotype resulting from gene deletion within the entire cortex versus IUE-mediated gene deletion in a limited cell population, greater insight into protein function in brain development can be obtained than by using either technique in isolation.

Induction of Protein Deletion Through In Utero Electroporation to Define Deficits in Neuronal Migration in Transgenic Models

Neuron migration is regulated by numerous cell autonomous and non-cell autonomous factors. This protocol shows how in utero electroporation can be used to determine whether a phenotype in a transgenic mouse is due to disruption of a cell intrinsic mechanism or impairment of interaction between the neuron and its environment.

Genetic deletion using the Cre-Lox system in transgenic mouse lines is a powerful tool used to study protein function. However, except in very specific ...

In utero Electroporation followed by Primary Neuronal Culture for Studying Gene Function in Subset of Cortical Neurons

In vitro study of primary neuronal cultures allows for quantitative analyses of neurite outgrowth. In order to study how genetic alterations affect neuronal process outgrowth, shRNA or cDNA constructs can be introduced into primary neurons via chemical transfection or viral transduction. However, with primary cortical cells, a heterogeneous pool of cell types (glutamatergic neurons from different layers, inhibitory neurons, glial cells) are transfected using these methods. The use of in utero electroporation to introduce DNA constructs in the embryonic rodent cortex allows for certain subsets of cells to be targeted: while electroporation of early embryonic cortex targets deep layers of the cortex, electroporation at late embryonic timepoints targets more superficial layers. Further, differential placement of electrodes across the heads of individual embryos results in the targeting of dorsal-medial versus ventral-lateral regions of the cortex. Following electroporation, transfected cells can be dissected out, dissociated, and plated in vitro for quantitative analysis of neurite outgrowth. Here, we provide a step-by-step method to quantitatively measure neuronal process outgrowth in subsets of cortical cells.
The basic protocol for in utero electroporation has been described in detail in two other JoVE articles from the Kriegstein lab 1, 2. We will provide an overview of our protocol for in utero electroporation, focusing on the most important details, followed by a description of our protocol that applies in utero electroporation to the study of gene function in neuronal process outgrowth.

In utero Electroporation followed by Primary Neuronal Culture for Studying Gene Function in Subset of Cortical Neurons

In utero electroporation is a valuable method for transfecting neuronal progenitor cells in vivo. Depending upon the placement of the electrodes and the developmental timepoint of electroporation, certain subsets of cortical cells can be targeted. Targeted cells can then be analyzed in vivo or in vitro for effects of genetic alteration.

In vitro study of primary neuronal cultures allows for quantitative analyses of neurite outgrowth. In order to study how genetic alterations affect ...

Neuroscience

Ex Vivo Culture of Chick Cerebellar Slices and Spatially Targeted Electroporation of Granule Cell Precursors

The cerebellar external granule layer (EGL) is the site of the largest transit amplification in the developing brain, and an excellent model for studying neuronal proliferation and differentiation. In addition, evolutionary modifications of its proliferative capability have been responsible for the dramatic expansion of cerebellar size in the amniotes, making the cerebellum an excellent model for evo-devo studies of the vertebrate brain. The constituent cells of the EGL, cerebellar granule progenitors, also represent a significant cell of origin for medulloblastoma, the most prevalent paediatric neuronal tumour. Following transit amplification, granule precursors migrate radially into the internal granular layer of the cerebellum where they represent the largest neuronal population in the mature mammalian brain. In chick, the peak of EGL proliferation occurs towards the end of the second week of gestation. In order to target genetic modification to this layer at the peak of proliferation, we have developed a method for genetic manipulation through ex vivo electroporation of cerebellum slices from embryonic Day 14 chick embryos. This method recapitulates several important aspects of in vivo granule neuron development and will be useful in generating a thorough understanding of cerebellar granule cell proliferation and differentiation, and thus of cerebellum development, evolution and disease.

Ex Vivo Culture of Chick Cerebellar Slices and Spatially Targeted Electroporation of Granule Cell Precursors

The cerebellar external granule layer is the site of the largest transit amplification in the developing brain. Here, we present a protocol to target genetic modification to this layer at the peak of proliferation using ex vivo electroporation and culture of cerebellar slices from embryonic Day 14 chick embryos.

The cerebellar external granule layer (EGL) is the site of the largest transit amplification in the developing brain, and an excellent model for studying ...

Efficient Gene Delivery into Multiple CNS Territories Using In Utero Electroporation

The ability to manipulate gene expression is the cornerstone of modern day experimental embryology, leading to the elucidation of multiple developmental pathways. Several powerful and well established transgenic technologies are available to manipulate gene expression levels in mouse, allowing for the generation of both loss- and gain-of-function models. However, the generation of mouse transgenics is both costly and time consuming. Alternative methods of gene manipulation have therefore been widely sought. In utero electroporation is a method of gene delivery into live mouse embryos1,2 that we have successfully adapted3,4. It is largely based on the success of in ovo electroporation technologies that are commonly used in chick5. Briefly, DNA is injected into the open ventricles of the developing brain and the application of an electrical current causes the formation of transient pores in cell membranes, allowing for the uptake of DNA into the cell. In our hands, embryos can be efficiently electroporated as early as embryonic day (E) 11.5, while the targeting of younger embryos would require an ultrasound-guided microinjection protocol, as previously described6. Conversely, E15.5 is the latest stage we can easily electroporate, due to the onset of parietal and frontal bone differentiation, which hampers microinjection into the brain. In contrast, the retina is accessible through the end of embryogenesis. Embryos can be collected at any time point throughout the embryonic or early postnatal period. Injection of a reporter construct facilitates the identification of transfected cells.
To date, in utero electroporation has been most widely used for the analysis of neocortical development1,2,3,4. More recent studies have targeted the embryonic retina7,8,9 and thalamus10,11,12. Here, we present a modified in utero electroporation protocol that can be easily adapted to target different domains of the embryonic CNS. We provide evidence that by using this technique, we can target the embryonic telencephalon, diencephalon and retina. Representative results are presented, first showing the use of this technique to introduce DNA expression constructs into the lateral ventricles, allowing us to monitor progenitor maturation, differentiation and migration in the embryonic telencephalon. We also show that this technique can be used to target DNA to the diencephalic territories surrounding the 3rd ventricle, allowing the migratory routes of differentiating neurons into diencephalic nuclei to be monitored. Finally, we show that the use of micromanipulators allows us to accurately introduce DNA constructs into small target areas, including the subretinal space, allowing us to analyse the effects of manipulating gene expression on retinal development.

Efficient Gene Delivery into Multiple CNS Territories Using In Utero Electroporation

In utero electroporation allows for rapid gene delivery in a spatially- and temporally-controlled manner in the developing central nervous system (CNS). Here we describe a highly adaptable in utero electroporation protocol that can be used to deliver expression constructs into multiple embryonic CNS domains, including the telencephalon, diencephalon and retina.

The ability to manipulate gene expression is the cornerstone of modern day experimental embryology, leading to the elucidation of multiple developmental ...

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow for an in-depth characterization to identify pathways involved in these events. Cerebellar granule neurons (CGNs) that are derived from the developing cerebellum are an ideal model system that allows for morphological analyses. Here, we describe a method of how to genetically manipulate CGNs and how to study axono- and dendritogenesis of individual neurons. With this method the effects of RNA interference, overexpression or small molecules can be compared to control neurons. In addition, the rodent cerebellar cortex is an easily accessible in vivo system owing to its predominant postnatal development. We also present an in vivo electroporation technique to genetically manipulate the developing cerebella and describe subsequent cerebellar analyses to assess neuronal morphology and migration.

Genetic Manipulation of Cerebellar Granule Neurons In Vitro and In Vivo to Study Neuronal Morphology and Migration

Neuronal morphogenesis and migration are crucial events underlying proper brain development. Here, we describe methods to genetically manipulate cultured cerebellar granule neurons and the developing cerebellum for the assessment of morphology and migratory characteristics of neurons.

Developmental events in the brain including neuronal morphogenesis and migration are highly orchestrated processes. In vitro and in vivo analyses allow ...

In Vivo Brain Tumor Modeling via Electroporation-Based Delivery of Plasmid DNA

Modeling Brain Tumors In Vivo Using Electroporation-Based Delivery of Plasmid DNA Representing Patient Mutation Signatures

Tumor models are critical for the preclinical testing of brain tumors in terms of exploring new, more efficacious treatments. With significant interest in immunotherapy, it is even more critical to have a consistent, clinically pertinent, immunocompetent mouse model to examine the tumor and immune cell populations in the brain and their response to treatment. While most preclinical models utilize orthotopic transplantation of established tumor cell lines, the modeling system presented here allows for a "personalized" representation of patient-specific tumor mutations in a gradual, yet effective development from DNA constructs inserted into dividing neural precursor cells (NPCs) in vivo. DNA constructs feature the mosaic analysis with the dual-recombinase-mediated cassette exchange (MADR) method, allowing for single-copy, somatic mutagenesis of driver mutations. Using newborn mouse pups between birth and 3 days old, NPCs are targeted by taking advantage of these dividing cells lining the lateral ventricles. Microinjection of DNA plasmids (e.g., MADR-derived, transposons, CRISPR-directed sgRNA) into the ventricles is followed by electroporation using paddles that surround the rostral region of the head. Upon electrical stimulation, the DNA is taken up into the dividing cells, with the potential of integrating into the genome. The use of this method has successfully been demonstrated in developing both pediatric and adult brain tumors, including the most common malignant brain tumor, glioblastoma. This article discusses and demonstrates the different steps of developing a brain tumor model using this technique, including the procedure of anesthetizing young mouse pups, to microinjection of the plasmid mix, followed by electroporation. With this autochthonous, immunocompetent mouse model, researchers will have the ability to expand preclinical modeling approaches, in efforts to improve and examine efficacious cancer treatment.

Author Spotlight: Modeling Brain Tumors In Vivo Using Electroporation-Based Delivery of Plasmid DNA Representing Patient Mutation Signatures  

Utilizing an immunocompetent, autochthonous tumor model driven by common patient mutations for preclinical testing is critical for immunotherapeutic testing. This protocol describes a method to generate brain tumor mouse models using electroporation-based delivery of plasmid DNA that represent common patient mutations, thus providing an accurate, reproducible, and consistent mouse model.

Tumor models are critical for the preclinical testing of brain tumors in terms of exploring new, more efficacious treatments. With significant interest in ...

Cancer Research

A Novel Strategy Combining Array-CGH, Whole-exome Sequencing and In Utero Electroporation in Rodents to Identify Causative Genes for Brain Malformations

Birth defects that involve the cerebral cortex &#8212; also known as malformations of cortical development (MCD) &#8212; are important causes of intellectual disability and account for 20-40% of drug-resistant epilepsy in childhood. High-resolution brain imaging has facilitated in vivo identification of a large group of MCD phenotypes. Despite the advances in brain imaging, genomic analysis and generation of animal models, a straightforward workflow to systematically prioritize candidate genes and to test functional effects of putative mutations is missing. To overcome this problem, an experimental strategy enabling the identification of novel causative genes for MCD was developed and validated. This strategy is based on identifying candidate genomic regions or genes via array-CGH or whole-exome sequencing and characterizing the effects of their inactivation or of overexpression of specific mutations in developing rodent brains via in utero electroporation. This approach led to the identification of the C6orf70 gene, encoding for a putative vesicular protein, to the pathogenesis of periventricular nodular heterotopia, a MCD caused by defective neuronal migration.

A Novel Strategy Combining Array-CGH, Whole-exome Sequencing and In Utero Electroporation in Rodents to Identify Causative Genes for Brain Malformations

Periventricular nodular heterotopia (PNH) is the most common form of malformation of cortical development (MCD) in adulthood but its genetic basis remains unknown in most sporadic cases. We have recently developed a strategy to identify novel candidate genes for MCDs and to directly confirm their causative role in vivo.

Birth defects that involve the cerebral cortex &#8212; also known as malformations of cortical development (MCD) &#8212; are important causes of ...

Inducing Cre-lox Recombination in Mouse Cerebral Cortex Through In Utero Electroporation

Cell-autonomous neuronal functions of genes can be revealed by causing loss or gain of function of a gene in a small and sparse population of neurons. To do so requires generating a mosaic in which neurons with loss or gain of function of a gene are surrounded by genetically unperturbed tissue. Here, we combine the Cre-lox recombination system with in utero electroporation in order to generate mosaic brain tissue that can be used to study the cell-autonomous function of genes in neurons. DNA constructs (available through repositories), coding for a fluorescent label and Cre recombinase, are introduced into developing cortical neurons containing genes flanked with loxP sites in the brains of mouse embryos using in utero electroporation. Additionally, we describe various adaptations to the in utero electroporation method that increase survivability and reproducibility. This method also involves establishing a titer for Cre-mediated recombination in a sparse or dense population of neurons. Histological preparations of labeled brain tissue do not require (but can be adapted to) immunohistochemistry. The constructs used guarantee that fluorescently labeled neurons carry the gene for Cre recombinase. Histological preparations allow morphological analysis of neurons through confocal imaging of dendritic and axonal arbors and dendritic spines. Because loss or gain of function is achieved in sparse mosaic tissue, this method permits the study of cell-autonomous necessity and sufficiency of gene products in vivo.

Inducing Cre-lox Recombination in Mouse Cerebral Cortex Through In Utero Electroporation

Cell-autonomous functions of genes in the brain can be studied by inducing loss or gain of function in sparse populations of cells. Here, we describe in utero electroporation to deliver Cre recombinase into sparse populations of developing cortical neurons with floxed genes to cause loss of function in vivo.

Cell-autonomous neuronal functions of genes can be revealed by causing loss or gain of function of a gene in a small and sparse population of neurons. To ...

Utilizing In Vivo Postnatal Electroporation to Study Cerebellar Granule Neuron Morphology and Synapse Development

Neurons undergo dynamic changes in their structure and function during brain development to form appropriate connections with other cells. The rodent cerebellum is an ideal system to track the development and morphogenesis of a single cell type, the cerebellar granule neuron (CGN), across time. Here, in vivo electroporation of granule neuron progenitors in the developing mouse cerebellum was employed to sparsely label cells for subsequent morphological analyses. The efficacy of this technique is demonstrated in its ability to showcase key developmental stages of CGN maturation, with a specific focus on the formation of dendritic claws, which are specialized structures where these cells receive the majority of their synaptic inputs. In addition to providing snapshots of CGN synaptic structures&#160;throughout cerebellar development, this technique can be adapted to genetically manipulate granule neurons in a cell-autonomous manner to study the role of any gene of interest and its effect on CGN morphology, claw development, and synaptogenesis.

Utilizing In Vivo Postnatal Electroporation to Study Cerebellar Granule Neuron Morphology and Synapse Development

Here we describe a method to visualize synaptogenesis of granule neurons in the mouse cerebellum over the time course of postnatal brain development when these cells refine their synaptic structures and form synapses to integrate themselves into the overall brain circuit.

Neurons undergo dynamic changes in their structure and function during brain development to form appropriate connections with other cells. The rodent ...

Efficient and Cost Effective Electroporation Method to Study Primary Cilium-Dependent Signaling Pathways in the Granule Cell Precursor

The primary cilium is a critical signaling organelle found on nearly every cell that transduces Hedgehog (Hh) signaling stimuli from the cell surface. In the granule cell precursor (GCP), the primary cilium acts as a pivotal signaling center that orchestrates precursor cell proliferation by modulating the Hh signaling pathway. The investigation of primary cilium-dependent Hh signaling machinery is facilitated by in vitro genetic manipulation of the pathway components to visualize their dynamic localization to the primary cilium. However, transfection of transgenes in the primary cultures of GCPs using the currently known electroporation methods is generally costly and often results in low cell viability and undesirable transfection efficiency. This paper introduces an efficient, cost-effective, and simple electroporation protocol that demonstrates a high transfection efficiency of ~80-90% and optimal cell viability. This is a simple, reproducible, and efficient genetic modification method that is applicable to the study of the primary cilium-dependent Hedgehog signaling pathway in primary GCP cultures.

Here, we present a reproducible in vitro electroporation protocol for genetic manipulation of primary cerebellar granule cell precursors (GCPs) that is cost-effective, efficient, and viable. Moreover, this protocol also demonstrates a straightforward method for the molecular study of primary cilium-dependent Hedgehog signaling pathways in primary GCP cells.

The primary cilium is a critical signaling organelle found on nearly every cell that transduces Hedgehog (Hh) signaling stimuli from the cell surface. In ...

CRISPR-mediated Loss of Function Analysis in Cerebellar Granule Cells Using In Utero Electroporation-based Gene Transfer

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video