Name: a method to define the effects of environmental enrichment on colon microbiome biodiversity in a mouse colon tumor model
Uploaded: 2018-02-28T13:00:00.000+00:00
Duration: 8 min 14 s
Description: Watch this Scientific Journal Video about A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model at JoVE.com

We thank B. Dalley in the University of Utah Genomics core for library sequencing, and K. Boucher in the University of Utah Biostatistics core for statistical advice, and access to these technical cores supported by National Cancer Institute award P30 CA042014. The project described was supported by the National Cancer Institute Grants P01 CA073992 and K01 CA128891 and the Huntsman Cancer Foundation.

<ol>
	<li>Bechard, A., Meagher, R., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+reduces+the+likelihood+of+alopecia+in+adult+C57BL/6J+mice.">Environmental enrichment reduces the likelihood of alopecia in adult C57BL/6J mice.</a> Journal of the American Association for Laboratory Animal Science : JAALAS. 50 (2), 171-174 (2011).</li><li>Jankowsky, J. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+mitigates+cognitive+deficits+in+a+mouse+model+of+Alzheimer's+disease.">Environmental enrichment mitigates cognitive deficits in a mouse model of Alzheimer's disease.</a> J Neurosci. 25 (21), 5217-5224 (2005).</li><li>Kondo, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+ameliorates+a+motor+coordination+deficit+in+a+mouse+model+of+Rett+syndrome--Mecp2+gene+dosage+effects+and+BDNF+expression.">Environmental enrichment ameliorates a motor coordination deficit in a mouse model of Rett syndrome--Mecp2 gene dosage effects and BDNF expression.</a> Eur J Neurosci. 27 (12), 3342-3350 (2008).</li><li>Reichmann, F., Painsipp, E., Holzer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+enrichment+and+gut+inflammation+modify+stress-induced+c-Fos+expression+in+the+mouse+corticolimbic+system.">Environmental enrichment and gut inflammation modify stress-induced c-Fos expression in the mouse corticolimbic system.</a> PLoS One. 8 (1), 54811 (2013).</li><li>Cao, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+and+genetic+activation+of+a+brain-adipocyte+BDNF/leptin+axis+causes+cancer+remission+and+inhibition.">Environmental and genetic activation of a brain-adipocyte BDNF/leptin axis causes cancer remission and inhibition.</a> Cell. 142 (1), 52-64 (2010).</li><li>Bice, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Environmental+Enrichment+Induces+Pericyte+and+IgA-Dependent+Wound+Repair+and+Lifespan+Extension+in+a+Colon+Tumor+Model.">Environmental Enrichment Induces Pericyte and IgA-Dependent Wound Repair and Lifespan Extension in a Colon Tumor Model.</a> Cell reports. 19 (4), 760-773 (2017).</li><li>Moser, A. R., Pitot, H. C., Dove, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+dominant+mutation+that+predisposes+to+multiple+intestinal+neoplasia+in+the+mouse.">A dominant mutation that predisposes to multiple intestinal neoplasia in the mouse.</a> Science. 247 (4940), 322-324 (1990).</li><li>Angus-Hill, M. L., Elbert, K. M., Hidalgo, J., Capecchi, M. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T-cell+factor+4+functions+as+a+tumor+suppressor+whose+disruption+modulates+colon+cell+proliferation+and+tumorigenesis.">T-cell factor 4 functions as a tumor suppressor whose disruption modulates colon cell proliferation and tumorigenesis.</a> Proc Natl Acad Sci U S A. 108 (12), 4914-4919 (2011).</li><li>Holmdahl, R., Malissen, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+need+for+littermate+controls.">The need for littermate controls.</a> Eur J Immunol. 42 (1), 45-47 (2012).</li><li>Ubeda, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Familial+transmission+rather+than+defective+innate+immunity+shapes+the+distinct+intestinal+microbiota+of+TLR-deficient+mice.">Familial transmission rather than defective innate immunity shapes the distinct intestinal microbiota of TLR-deficient mice.</a> J Exp Med. 209 (8), 1445-1456 (2012).</li><li>Spor, A., Koren, O., Ley, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unravelling+the+effects+of+the+environment+and+host+genotype+on+the+gut+microbiome.">Unravelling the effects of the environment and host genotype on the gut microbiome.</a> Nat Rev Microbiol. 9 (4), 279-290 (2011).</li><li>Fujiwara, R., Watanabe, J., Sonoyama, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assessing+changes+in+composition+of+intestinal+microbiota+in+neonatal+BALB/c+mice+through+cluster+analysis+of+molecular+markers.">Assessing changes in composition of intestinal microbiota in neonatal BALB/c mice through cluster analysis of molecular markers.</a> Br J Nutr. 99 (6), 1174-1177 (2008).</li><li>Castelhano-Carlos, M. J., Sousa, N., Ohl, F., Baumans, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+methods+in+newborn+C57BL/6+mice:+a+developmental+and+behavioural+evaluation.">Identification methods in newborn C57BL/6 mice: a developmental and behavioural evaluation.</a> Lab Anim. 44 (2), 88-103 (2010).</li><li>Curley, J. P., Davidson, S., Bateson, P., Champagne, F. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Social+enrichment+during+postnatal+development+induces+transgenerational+effects+on+emotional+and+reproductive+behavior+in+mice.">Social enrichment during postnatal development induces transgenerational effects on emotional and reproductive behavior in mice.</a> Frontiers in behavioral neuroscience. 3, 25 (2009).</li><li>National Research Council (U.S.). <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Update+of+the+Guide+for+the+Care+and+Use+of+Laboratory+Animals.">Update of the Guide for the Care and Use of Laboratory Animals.</a> Institute for Laboratory Animal Research (U.S.). , 220 (2011).</li><li>Silver, L. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Mouse genetics : concepts and applications. , (1995).</li><li>Chen, M., Kan, L., Ledford, B. T., He, J. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tattooing+Various+Combinations+of+Ears,+Tail,+and+Toes+to+Identify+Mice+Reliably+and+Permanently.">Tattooing Various Combinations of Ears, Tail, and Toes to Identify Mice Reliably and Permanently.</a> Journal of the American Association for Laboratory Animal Science : JAALAS. 55 (2), 189-198 (2016).</li><li>Truett, G. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+of+PCR-quality+mouse+genomic+DNA+with+hot+sodium+hydroxide+and+tris+(HotSHOT).">Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT).</a> Biotechniques. 29 (1), 52-54 (2000).</li><li>Cole, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+Database+Project:+data+and+tools+for+high+throughput+rRNA+analysis.">Ribosomal Database Project: data and tools for high throughput rRNA analysis.</a> Nucleic Acids Res. 42, 633-642 (2014).</li><li>Bosshard, P. P., Zbinden, R., Altwegg, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Turicibacter+sanguinis+gen.+nov.,+sp.+nov.,+a+novel+anaerobic,+Gram-positive+bacterium.">Turicibacter sanguinis gen. nov., sp. nov., a novel anaerobic, Gram-positive bacterium.</a> Int J Syst Evol Microbiol. 52, 1263-1266 (2002).</li><li>Chen, W., Liu, F., Ling, Z., Tong, X., Xiang, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+intestinal+lumen+and+mucosa-associated+microbiota+in+patients+with+colorectal+cancer.">Human intestinal lumen and mucosa-associated microbiota in patients with colorectal cancer.</a> PLoS One. 7 (6), 39743 (2012).</li><li>16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. Illumina Available from: <a target="_blank" href="https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf">https://suport.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf</a> (2017)</li><li>Illumina Experiment Manager. Illumina Available from: <a target="_blank" href="https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html">https://www.illumina.com/informatics/research/experimental-design/illumina-experiment-manager.html</a> (2017)</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=QIIME+allows+analysis+of+high-throughput+community+sequencing+data.">QIIME allows analysis of high-throughput community sequencing data.</a> Nat Methods. 7 (5), 335-336 (2010).</li><li>Aronesty, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ea-utils:+Command-line+tools+for+processing+biological+sequencing+data.">ea-utils: Command-line tools for processing biological sequencing data.</a> Expression Analysis. , (2011).</li><li>Edgar, R. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Search+and+clustering+orders+of+magnitude+faster+than+BLAST.">Search and clustering orders of magnitude faster than BLAST.</a> Bioinformatics. 26 (19), 2460-2461 (2010).</li><li>Caporaso, J. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PyNAST:+a+flexible+tool+for+aligning+sequences+to+a+template+alignment.">PyNAST: a flexible tool for aligning sequences to a template alignment.</a> Bioinformatics. 26 (2), 266-267 (2010).</li><li>DeSantis, T. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Greengenes,+a+chimera-checked+16S+rRNA+gene+database+and+workbench+compatible+with+ARB.">Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB.</a> Appl Environ Microbiol. 72 (7), 5069-5072 (2006).</li><li>Moon, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vertically+transmitted+faecal+IgA+levels+determine+extra-chromosomal+phenotypic+variation.">Vertically transmitted faecal IgA levels determine extra-chromosomal phenotypic variation.</a> Nature. 521 (7550), 90-93 (2015).</li><li>Chakravorty, S., Helb, D., Burday, M., Connell, N., Alland, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+detailed+analysis+of+16S+ribosomal+RNA+gene+segments+for+the+diagnosis+of+pathogenic+bacteria.">A detailed analysis of 16S ribosomal RNA gene segments for the diagnosis of pathogenic bacteria.</a> J Microbiol Methods. 69 (2), 330-339 (2007).</li><li>Chen, H. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Decreased+dietary+fiber+intake+and+structural+alteration+of+gut+microbiota+in+patients+with+advanced+colorectal+adenoma.">Decreased dietary fiber intake and structural alteration of gut microbiota in patients with advanced colorectal adenoma.</a> Am J Clin Nutr. 97 (5), 1044-1052 (2013).</li><li>Zhu, Q., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+the+intestinal+lumen+microbiota+in+an+animal+model+of+colorectal+cancer.">Analysis of the intestinal lumen microbiota in an animal model of colorectal cancer.</a> PLoS One. 9 (6), 90849 (2014).</li><li>Evans, C. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exercise+prevents+weight+gain+and+alters+the+gut+microbiota+in+a+mouse+model+of+high+fat+diet-induced+obesity.">Exercise prevents weight gain and alters the gut microbiota in a mouse model of high fat diet-induced obesity.</a> PLoS One. 9 (3), 92193 (2014).</li></ol>

The authors declare they have no conflicts of interest.

This procedure allows for the analysis of microbiota isolated from stool following environmental enrichment of normal or tumor bearing animals. Because these are large experiments which involve breeding to obtain many animals of different sexes and genotypes, normalizing the microbiome between animals prior to commencement of the experiment is essential to avoid non-EE related effects on microbiome biodiversity.
For consistency between NE and EE conditions, the breeding process is conducted to ensure that all mice initially have exposure to the same microbes and, therefore, are expected to have similar microbiome contents. It is possible, and likely, that mouse genotype affects microbiome composition. For this reason, mouse numbers per genotype are maintained between NE and EE conditions to be certain that any animal that is consuming stool will encounter a similar diversity of the microbiome.
Several difficulties are apparent when designing EE experiments. First, the total number of animals needed for the experiments is dependent upon the experimental details, but the total number is also limited by the number of animals allowed in the cage. For example, historical data surrounding mouse survival in a preliminary EE experiment were used to calculate the number of animals to define the mechanism underlying improved survival observed in previous experiments. From this data, a total of 17 animals in the comparison group were required for an 80% power to detect a difference in survival in a two-sided t-test where alpha=0.05. So, 4-5 animals in the control group vs. 20-24 (or up to 41) animals per cage in the experimental group must accommodate a power calculation. Therefore, several control group cages are needed along with the experimental cage. Further, with complex genotypes, it is difficult to obtain sufficient animal numbers of every genotype, which necessitates the large numbers of breeding females required. However, with other models where fewer transgenic differences are present, more animals of the same genotype can be analyzed in this system and fewer breeders are necessary. In the United States, 12 pregnant females can be housed in the 633 in2 of space (Table 2). The issue with this is that as pups get older, they take up more space. Given that male pups are separated from female pups at 14-21 days, an approved exception to the space rule in certain countries may be feasible. Otherwise, male and female pups can be genotyped and selected, and then separated at a younger age with mothers to stay below the maximum mouse numbers. It is essential to gain approval for these studies and to adhere to local rules on space restrictions. Finally, with microbiota, the number of animals needed to detect even small differences in microbiota composition is difficult to calculate a priori. While in this study, significant differences in the microbiota were found with 4 animals per group, it is possible that increasing that number of animals would reveal microbiota that are more variable between EE mice or are only slightly altered by EE.
This method article describes the particular equipment and bedding that are used, which on the surface may not appear essential. However, several non-obvious issues that affect consistency can be encountered and need to be addressed prior to embarking on these very large, expensive, and time-consuming studies. One major issue is cage ventilation. With large numbers of animals in a cage, ventilation becomes an issue, and is an issue that most researchers do not take into account when attempting to provide consistent environments between control and experimental cages. All cages in the described setup are placed in a ventilated cabinet to equalize ventilation across the experimental and control cages. This cannot be accomplished when using cages that do not fit in a ventilated cabinet. Other means to normalize ventilation between experimental and control animals could be tested and consistently applied, but these methods are not explored in this study. Similar consistency issues arise with bedding. In the colon cancer model system used in this study, animals that have digestive disease will ingest certain types of bedding, especially corn cob bedding, leading to digestive blockages and illness. It is important to keep this in mind if the animals are known to ingest bedding when not otherwise occupied, as in the control environment. This phenomenon and the subsequent inconsistent health effects will profoundly affect all data.
The ribosomal 16S gene has been used as a means to study bacterial populations. It contains nine regions that express genetic variability, V1-V9, and interspersed conserved regions that remain relatively unchanged between bacterial species39. The V1-V3 region, in particular, provides the highest probability of species-level identification39. Similar V1-V3 studies on Colorectal Cancer (CRC) and Advanced Colorectal Adenoma found changes in three phyla of interest: Bacteroidetes, Firmicutes, and Proteobacteria21,40,41. It has also been reported that exercise can shift the microbial population and lead to an increase in Firmicutes42. For this reason, this study identified microbiome populations by using V1-V3 primers following a 16S metagenomic library prep protocol22 to potentially define the effects of environmental enrichment on these phyla known to be altered in adenoma and CRC. This procedure can be modified to amplify and sequence other variable regions of the 16S rRNA genes. One way is to use Probe Match to understand the phylogenetic classification of microbiota present in the sample that will be identified by the probe. In this way, probes can be targeted to specifically define and phylogenetically classify microbes of interest. This allows a different characterization of the microbiota present in the stool samples, and may reveal additional EE-dependent alterations in the microbiome of tumor bearing mice that may affect disease progression.
Using this procedure, the genus Sutterella was identified as the most altered genus following EE of tumor bearing animals. This procedure can be adapted to accommodate studies that utilize any method meant to analyze the effects of a perturbation on microbiome composition in genetically modified models of human disease. For example, in place of EE, mice could be inoculated with Sutterella to define whether Sutterella inoculation is sufficient to increase microbial biodiversity and wound repair in 16-week-old male tumor bearing animals.
Undoubtedly, the most unique aspect of this protocol is the concern over normalizing microbiota prior to EE and maintaining microbiome diversity throughout the EE studies. Since microbiome studies are continually improving, it is likely that more robust methods for characterizing the microbiome will arise, and the microbiome characterization in this protocol will become obsolete. For example, with the current study, the probes used to amplify the 16S rRNA have bias, depending on the probes that are chosen, and do not characterize all of the bacteria present in the microbiome. While the methods used to survey and characterize the microbiome will undoubtedly improve, the basic foundation of designing and running EE experiments while keeping normalization of the microbiome in mind will remain an essential facet of EE experiments.

Environmental enrichment (EE) studies utilize complex housing parameters to affect social stimulation (large housing cages, larger groups of animals), cognitive stimulation (huts, tunnels, nesting materials, platforms) and physical activity (running wheels). EE has been utilized by many labs to understand the effects of increased activity and improved social and cognitive interactions on disease initiation and progression using a wide array of mouse models, including barbering induced alopecia, Alzheimer&#39;s disease, Rett syndrome, and several tumor and digestive disease models1,2,3,4,5,6.
Several mouse models have been developed to study colon tumorigenesis in mice. Perhaps the most well-defined model is the ApcMin mouse. The ApcMin&#160;mouse was developed in the laboratory of William Dove in 19907, and has been used as a mouse model of mutations in the APC gene that are commonly associated with human colorectal cancer. In contrast to humans harboring APC mutations, ApcMin mice primarily develop small intestinal tumors, with very rare occurrence of colon tumors. However, a Tcf4Het allele with a single knockin-knockout heterozygous mutation in Tcf4, vastly increases colon tumorigenesis when combined with the ApcMin&#160;allele8. Recently, this mouse model of colon tumorigenesis has been used to determine the effects of EE on colon tumorigenesis6. In the Bice et al. study, the physiological and phenotypic effects of EE on males and females of four different mouse lines (wild-type (WT), Tcf4Het/+ Apc+/+, Tcf4+/+ ApcMin/+, and Tcf4Het/+ApcMin/+)) were defined. Perhaps the most interesting finding was that EE significantly increases the lifespan of both male and female colon tumor-bearing animals. This demonstrated that EE may reduce at least some of the symptoms associated with colon tumorigenesis, and improve animal health. Remarkably, this improved lifespan in males is not a direct result of reduced tumorigenesis, and instead was linked to the initiation of a tumor wound healing response, including improved microbiome biodiversity6.
Several EE specific studies have been published with interesting results. However, from a technical standpoint, important results are often not translatable to other laboratories. Maintaining identical EE methodologies between different laboratories is an incredibly complex issue, not only due to enrichment devices and housing used, but also bedding, food, ventilation, breeding, genetics, activity in the room, and animal protocol requirements, among others9,10,11. One example is animal integration, where animals must be stably integrated into the mouse colony, therefore normalizing genetic background and diet composition, to avoid non-treatment related effects. Further, many EE studies have been completed prior to the realization of the importance of the microbiome in disease, and the way that common mouse husbandry practices can affect the composition of the gut microbiome10,12.
Breeding strategy and animal placement in EE can increase stress if not performed properly. Since EE studies utilize large numbers of both male and female animals and multiple genotypes, experimental setup can be difficult given the requirement for animals from several litters to be combined. Therefore, a breeding and weaning strategy was developed to allow for combining of weaned animals of the correct genotype from different litters. The primary rationale for this was to normalize the microbiota among litters and to reduce stress when animals were moved to the experimental environment. The microbiome was transmitted from the dam10. To provide microbial diversity to the colony, females were purchased from Jackson Labs and integrated into the colony for one month before the experiment began9,10,12. To further normalize microbiome biodiversity between animals, females were co-housed prior to breeding. Following breeding, communal housing during rearing and the ability to escape nursing pups improved the stress levels of maternal care13,14, possibly furthering microbiome normalization. To prevent non-EE related effects on the microbiome, this communal housing of all experimental animals prevented fighting and additional stress that occurred when combining several males from different litters into one experimental cage. Finally, equal numbers of animals of all genotypes were included in the cages. This provided the opportunity for improved microbiota biodiversity across genotypes, and removed the contribution of coprophagia (the animal&#39;s tendency to consume stool) or possible genotype-specific behavioral differences to the overall study.
This protocol provides a strategy that expands previous EE studies to include known aspects of microbiome research, including microbiota transmission and animal colony integration for microbiota normalization, to enable more uniform microbiome populations between experimental animals. Heeding these precautions is essential due to the ability of non-treatment related microbiota differences to confound study findings. Eliminating non-EE related microbiota changes will enable researchers to specifically define the role of EE on microbiota composition during disease development and progression.

<table><tbody><tr><td>Teklad Diets/Harlan Labs Chow</td><td>Harlan Labs</td><td>3980X</td><td>Standard irradiated chow formulated by Dr. Mario Capecchi in collaboration with Harlan Labs.</td></tr><tr><td>Cell-Sorb Plus bedding</td><td>Fangman Specialties</td><td>82010</td><td>Autoclave prior to use.</td></tr><tr><td>AIMS Tattooing System For Neonates</td><td>AIMS</td><td>NEO-9</td><td>https://animalid.com/neonate-rodent-tattoo-identification/32. Other animal grade tattoo systems and inks can be used with similar results including the Aramis Micro Tattoo Kit.</td></tr><tr><td>Zyfone One Cage 2100 AllerZone Mouse Micro-Isolator System Complete with cage, AllerZone filter top and modular diet delivery system</td><td>Lab Products</td><td>82120ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 Life Span Enrichment Device</td><td>Lab Products</td><td>82109ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 Cage 13-7/8&quot; Length X 19-1/16&quot; Width X 7-3/4&quot; Depth</td><td>Lab Products</td><td>82100ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Zyfone One Cage 2100 AllerZone Micro-Isolator filter top</td><td>Lab Products</td><td>82101ZF</td><td>Each EE cage requires one of each catalog # 82120ZF, 82100ZF, and 82101ZF, as well as two of 82109ZF. Food is only in one side.</td></tr><tr><td>Tunnel</td><td>Bio-Serv</td><td>K3323 or K3332</td><td>Connect cages together and use for enrichment</td></tr><tr><td>Grommet to connect Tunnel to cages</td><td>Fabricated by the University of Utah Machine Shop</td><td>n/a</td><td>Be certain the material is resistant to chewing and autoclavable</td></tr><tr><td>Fast-track wheel</td><td>Bio-Serv</td><td>K3250 or K3251</td><td>Use with mouse igloo and floor</td></tr><tr><td>Mouse Igloo</td><td>Bio-Serv</td><td>K3328, K3570 or K3327</td><td>Use with Fast-track wheel and floor</td></tr><tr><td>Mouse Igloo floor</td><td>Bio-Serv</td><td>K3244</td><td>Use with mouse Igloo and Fast-Track</td></tr><tr><td>Mouse Hut</td><td>Bio-Serv</td><td>K3272, K3102 or K3271</td><td></td></tr><tr><td>Crawl Ball</td><td>Bio-Serv</td><td>K3330 or K3329</td><td></td></tr><tr><td>Bio-hut</td><td>Bio-Serv</td><td>K3352</td><td>Wood pulp hut used for sheltering and nesting</td></tr><tr><td>Adhesive film&amp;nbsp;</td><td>VWR</td><td>60941-072</td><td>Use to temporarily cover drilled hole in large cage to prevent mice from escaping</td></tr><tr><td>Laminar Flow Ventilated Rack</td><td>Techniplast</td><td>Bio-C36</td><td>The cabinet we used in this study is not currently supplied. The Bio-C36 is very similar.</td></tr><tr><td>1.5 mL Microfuge Tube- RNAse and DNAse free</td><td>Any supplier</td><td></td><td></td></tr><tr><td>QIAamp DNA Stool MiniKit</td><td>Qiagen</td><td>51504</td><td>This kit supplies reagents for 50 DNA preparations. Stool Lysis Buffer=ASL; Guanidinium Chloride Lysis Buffer= AL; Wash Buffer 1 with Guanidinium Chloride= AW1; Wash Buffer 2= AW2; Elution Buffer with EDTA=AE</td></tr><tr><td>Waterbath (capable of heating to 95)</td><td>Any supplier</td><td></td><td>For 94 degree incubation of stool samples to lyse cells.</td></tr><tr><td>Waterbath (capable of heating to 70 degrees)</td><td>Any supplier</td><td></td><td>For 70 degree incubation of stool samples&amp;nbsp;</td></tr><tr><td>Ethanol (200 proof)</td><td>Sigma Aldrich</td><td>E7023</td><td></td></tr><tr><td>Fluorometer: Qubit</td><td>ThermoFisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>Qubit dsDNA broad Range Assay Kit</td><td>ThermoFisher Scientific</td><td>Q32850</td><td></td></tr><tr><td>EB Buffer or 10 mM Tris pH 8.5</td><td>Qiagen</td><td>19086</td><td></td></tr><tr><td>Experiment specific primers</td><td>Any Supplier</td><td></td><td></td></tr><tr><td>PCR grade water</td><td>Any supplier</td><td></td><td></td></tr><tr><td>2X KAPA HiFi HotStart Ready Mix&amp;nbsp;</td><td>Kapa Biosystems</td><td>KK2601</td><td>For Amplicon Amplification (1.25 mL allows 100 rxns).</td></tr><tr><td>Agarose for running diagnostic gels</td><td>Any supplier</td><td></td><td></td></tr><tr><td>TapeStation High Sensitivity D1000 Screen Tape Trace</td><td>Agilent</td><td>5067-5583</td><td>TapeStation or Bioanalyzer instruments are common in Institutional Genomics Cores to analyze library quality . Alternatively a Bioanalyzer DNA1000 Chip (Agilent, 5067-1504) can be used.</td></tr><tr><td>Agencourt AMPure XP Magnetic Beads</td><td>Beckman Coulter</td><td>A63880</td><td>Magentic beads For PCR cleanup- 5 mL will clean 250 PCR reactions</td></tr><tr><td>Magnetic stand</td><td>Life Technologies</td><td>AM10027</td><td></td></tr><tr><td>Library Preparation Guide</td><td>Illumina</td><td></td><td>Illumina. 16S Metagenomic Sequencing Library Preparation: Preparing 16S ribosomal RNA Gene Amplicons for the Illumina MiSeq System. https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/16s/16s-metagenomic-library-prep-guide-15044223-b.pdf.</td></tr><tr><td>Unique Dual Indexing</td><td>Illumina</td><td>Illumina Experiment Manager Software</td><td>Freely available at: https://support.illumina.com/sequencing/sequencing_software/experiment_manager/downloads.html</td></tr><tr><td>Nextera XT 96 Index Kit</td><td>Illumina</td><td>FC-131-1002</td><td>Used to add barcodes to amplicons</td></tr><tr><td>MicroAmp Optical 96-well reaction plate</td><td>Applied Biosystems/ThermoFisher</td><td>N8010560</td><td></td></tr><tr><td>TruSeq Index Plate Fixture</td><td>Illumina</td><td>FC-130-1005</td><td></td></tr><tr><td>Adhesive clear plate seal</td><td>Applied Biosystems /ThermoFisher</td><td>4360954</td><td>Applied Biosystems/ThermoFisher Microamp adhesive film</td></tr><tr><td>Sequencing by MiSeq with v3 reagents and dual 300 bp reads</td><td>Illumina</td><td>MS-102-3003</td><td></td></tr><tr><td>PhiX Control Kit</td><td>Illumina</td><td>FC-110-3001</td><td></td></tr><tr><td>Proteinase K (600 mAU/ml)</td><td>Qiagen</td><td>19131</td><td>Equivalent to 20 mg/ml of proteinase K. Supplied with QiaAmp kit</td></tr><tr><td>Data Analysis Tools</td><td>Qiime</td><td>QIIME software Tools</td><td>Installation may differ based on your system and the QIIME website describes several options (http://qiime.org/install/install.html). For this study, MacQIIME software package 1.9.1 was utilized (compiled by Werner Lab, SUNY, http://www.wernerlab.org/software/macqiime</td></tr><tr><td>Step 13.2.</td><td>Qiime</td><td>FastQ Join method</td><td>&amp;nbsp;(http://code.google.com/p/ea-utils &amp;nbsp;).&amp;nbsp; For this study Multiple join paired ends was used http://qiime.org/scripts/multiple_join_paired_ends.html. Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expression Analysis, Durham, NC. (2011).</td></tr><tr><td>Step 13.3.</td><td>Qiime</td><td>De-Novo OTU picking protocol</td><td>http://qiime.org/scripts/pick_de_novo_otus.html.</td></tr><tr><td>Step 13.3.1.</td><td></td><td>Open Taxonomic Units (OTUs) using Uclust</td><td>Edgar, R.C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 26 (19), 2460-2461, doi:10.1093/bioinformatics/btq461 (2010).</td></tr><tr><td>Step 13.3.1.</td><td>Pynast</td><td>Pynast</td><td>Caporaso, J.G. et al. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 26 (2), 266-267, doi:10.1093/bioinformatics/btp636 (2010).&amp;nbsp;</td></tr><tr><td>Step 13.3.1.</td><td>Pynast</td><td>Pynast_Greengenes</td><td>DeSantis, T.Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl Environ Microbiol. 72 (7), 5069-5072, doi:10.1128/AEM.03006-05 (2006). Greengenes version 13_8 was used in this study</td></tr><tr><td>13.3.1. Note:&amp;nbsp;</td><td>Qiime</td><td>Multiple Split Libraries</td><td>http://qiime.org/scripts/multiple_split_libraries_fastq.html.</td></tr><tr><td>13.3.1. Note:&amp;nbsp;</td><td>Qiime</td><td>Pick de novo OTUs script</td><td>http://qiime.org/scripts/pick_de_novo_otus.html&amp;nbsp;</td></tr><tr><td>Step 13.2.2.</td><td>Qiime</td><td>Create a mapping file</td><td>http://qiime.org/documentation/file_formats.html.</td></tr><tr><td>Step 13.2.2.</td><td>Qiime</td><td>Validate a mapping file</td><td>http://qiime.org/scripts/validate_mapping_file.html.</td></tr><tr><td>Step 13.3.3.</td><td>Qiime</td><td>Link the OTU to sample description to mapping file</td><td>http://qiime.org/scripts/make_otu_network.html.</td></tr><tr><td>Step 13.3.4.</td><td>Qiime</td><td>Summarize Taxa through plots</td><td>http://qiime.org/scripts/summarize_taxa_through_plots.html.</td></tr><tr><td>Step 13.3.5.</td><td>Qiime</td><td>Biome Summarize table</td><td>http://biom-format.org/documentation/summarizing_biom_tables.html&amp;nbsp; In this study, all samples were rarified to 20,000 OTUs followed by analysis using alpha rarefaction script in QIIME.</td></tr></tbody></table>

a method to define the effects of environmental enrichment on colon microbiome biodiversity in a mouse colon tumor model

Several recent studies have illustrated the beneficial effects of living in an enriched environment on improving human disease. In mice, environmental enrichment (EE) reduces tumorigenesis by activating the mouse immune system, or affects tumor bearing animal survival by stimulating the wound repair response, including improved microbiome diversity, in the tumor microenvironment. Provided here is a detailed procedure to assess the effects of environmental enrichment on the biodiversity of the microbiome in a mouse colon tumor model. Precautions regarding animal breeding and considerations for animal genotype and mouse colony integration are described, all of which ultimately affect microbial biodiversity. Heeding these precautions may allow more uniform microbiome transmission, and consequently will alleviate non-treatment dependent effects that can confound study findings. Further, in this procedure, microbiota changes are characterized using 16S rDNA sequencing of DNA isolated from stool collected from the distal colon following long-term environmental enrichment. Gut microbiota imbalance is associated with the pathogenesis of inflammatory bowel disease and colon cancer, but also of obesity and diabetes among others. Importantly, this protocol for EE and microbiome analysis can be utilized to study the role of microbiome pathogenesis across a variety of diseases where robust mouse models exist that can recapitulate human disease.

Several studies have demonstrated that the practice of mind-body medicine improves health outcomes. Similarly, in mice, environmental enrichment improves outcomes including improved lifespan and tumor wound repair6. Therefore, an EE procedure was developed with the aim of defining the role of microbiota in this phenotype while first normalizing the microbiome prior to the initiation of the experiment (Figure 1). Importantly, all breeding animals are integrated into the mouse colony for at least one month prior to the commencement of breeding, and newborn pups are co-housed with mothers in one large cage to normalize microbiota transmission prior to the experiment. When animals are between 21 and 28 days old, equal numbers of each genotype are weaned into their respective housing, either EE or NE environments (Figure 2A). At 16 weeks, stool from all animals is collected and homogenized (Figure 2B), followed by bacterial DNA isolation. Finally, 16S amplicons are amplified from stool microbiome DNA and barcode indexed to allow for sequencing of all microbiome libraries simultaneously (Figure 3). The unique sequences identified in WT and tumor bearing animals in both NE and EE conditions are shown in Figure 4. Interestingly, EE does not improve biodiversity in WT animals, but vastly increases biodiversity in tumor bearing animals (Figure 4), demonstrating that this method allows biodiversity improvements. This increase in biodiversity can be attributed to the increased presence of the phylum Proteobacteria, with significant increases in the classes Alphaproteobacteria and Betaproteobacteria, and decreases in pathogenic Gammaproteobacteria (Figure 5; Supplemental Table 1). The largest increase is in the Betaproteobacteria class is the genus Sutterella, a likely commensal involved in secreted IgA degradation (Figure 6, also see38).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57182/57182fig1.jpg" /> 
Figure 1: A representation of the experimental timeline. The short bands represent 7-day windows, as most of the protocol is accomplished in 7-day increments. This also aids in visualization of the range of pup ages across the experiment. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57182/57182fig2.jpg" /> 
Figure 2: EE and NE housing conditions and stool homogenates (as described in the protocol). <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/57182/57182fig3.jpg" /> 
Figure 3: 16S Microbiome Library Preparation. (A) Unpurified PCR amplicon products derived from stool genomic DNA.(B) Indexing plate graphic designed as per the software used (Table of Materials, 23). The dual index combinations, I7 (Index 1; Row) and I5 (Index 2; Column), are shown for each sample. Each index is 8 bp in length. The sample numbers refer to the respective mouse numbers from EE studies. (C) Unpurified Index PCR products. (D) Quality analysis of final purified and pooled 16S libraries. (A,C,D) Black arrows denote 550 bp amplicon and 668 bp indexed library. Red arrows denote non-specific products that are eliminated following purification as shown in D. Upper and Lower markers are size markers added to the sample for size reference. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/57182/57182fig4.jpg" /> 
Figure 4: Changes in alpha diversity following EE of Tcf4Het/+ ApcMin/+ animals. Alpha diversity of WT and Tcf4Het/+ ApcMin/+ tumor bearing animals. At 20,000 reads, NE and EE of WT, p=0.64 and NE and EE of Tcf4Het/+ ApcMin/+, p=0.03 using two-sample t-test with Welch correction. Adapted from Bice et al., 20176. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/57182/57182fig5.jpg" /> 
Figure 5: EE-mediated changes following EE of Tcf4Het/+ ApcMin/+ animals. R-ggplot2 generated box-whisker plots denoting changes in abundance of the phylum Proteobacteria and classes Alphaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Outliers are noted as circles. **p=0.005 using two-sample t-tests with Welch correction. Error bars calculated using standard error of the mean (SEM). Adapted from Bice et al., 20176. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" class="xfigimg" src="/files/ftp_upload/57182/57182fig6.jpg" /> 
Figure 6: Changes in the relative abundance of Sutterella following EE of Tcf4Het/+ ApcMin/+ animals. Outliers are noted as circles. **p=0.005 using two-sample t-test with Welch correction. Error bars calculated using SEM. Adapted from Bice et al., 20176. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/57182fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Supplemental Table 1" src="/files/ftp_upload/57182/57182suptable1.jpg" /> 
Supplemental Table 1: Classification of Bacteria Isolated from Stool Collected from NE and EE mice. Classification across genotypes at the (A) Phylum, (B) Class, (C) Order, (D) Family, and (E) Genus level. Comparisons of NE and EE of the same genotype or WT to Tcf4Het/+ ApcMin/+. P-values are calculated using a two-sample t-test with Welch correction. Adapted from Bice et al., 20176. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/57182/Supplemental_Table_1_Fuller_et_al.xlsx" target="_blank">Please click here to download this file.</a>
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Item</td>
			<td>Total Area (inch2)</td>
			<td>Total Area (cm2)</td>
			<td>Cage Size (inch) L x W x H</td>
			<td>Cage Size (cm) L x W x H</td>
		</tr>
		<tr>
			<td>One Control Cage (NE)</td>
			<td>68.25</td>
			<td>440.32</td>
			<td>10.5 x 6.5 x 5.5&#160;</td>
			<td>26.67 x 16.51 x&#160; 13.97</td>
		</tr>
		<tr>
			<td>One Large Cage (EE)</td>
			<td>264.36</td>
			<td>1706.32</td>
			<td>13.87 x 19.06 x 7.75&#160;</td>
			<td>35.24 x 48.42 x 19.69</td>
		</tr>
		<tr>
			<td>Two Large Cages (EE)</td>
			<td>528.72</td>
			<td>3412.64</td>
			<td>2@&#160; 13.87 x 19.06 x 7.75&#160;</td>
			<td>2@ 35.24 x 48.42 x 19.69</td>
		</tr>
		<tr>
			<td>Two Platforms (EE)</td>
			<td>93</td>
			<td>600</td>
			<td>&#160;2@ 11.8 x 3.94 x 2.95</td>
			<td>2@ 30 x 10 x 7.5</td>
		</tr>
		<tr>
			<td>Two Large Cages with Two Platforms (EE)</td>
			<td>621.72</td>
			<td>4013</td>
			<td>2@&#160; 13.87 x 19.06 x 7.75 + 2@ 11.8 x 3.94 x 2.95</td>
			<td>2@ 35.24 x 48.42 x 19.69 + 2@ 30 x 10 x 7.5</td>
		</tr>
	</tbody>
</table>
Table 1: EE and NE Cage sizes and Floor Space.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Animals Allowed in Cage</td>
			<td>Required Inches Squared Per Animal</td>
			<td>EE Cage Area (Inches2)</td>
			<td>Total Animals allowed</td>
		</tr>
		<tr>
			<td>Up to 25</td>
			<td>12</td>
			<td>622 in2 (4013 cm2)</td>
			<td>&#160;up to 25</td>
		</tr>
		<tr>
			<td>25+</td>
			<td>15</td>
			<td>622 in2 (4013 cm2)</td>
			<td>up to 41</td>
		</tr>
		<tr>
			<td>Female with Litter</td>
			<td>51</td>
			<td>622 in2 (4013 cm2)</td>
			<td>up to 12</td>
		</tr>
	</tbody>
</table>
Table 2: Allowed Numbers of Animals in Cages Based on Floor Space15.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td colspan="4">Amplicon PCR Primers</td>
		</tr>
		<tr>
			<td>Forward</td>
			<td colspan="3">5&#39;-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGagagtttgatcMtggctcag-3&#39;</td>
		</tr>
		<tr>
			<td>Reverse</td>
			<td colspan="3">5&#39;- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTTACCGCGGCTGCTGGCAC -3&#39;</td>
		</tr>
		<tr>
			<td colspan="4">Locus specific sequences are shown in bold and the non-bold is the overhang adapter sequence.</td>
		</tr>
	</tbody>
</table>
Table 3: Amplicon PCR Primers.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Amplicon PCR reaction set up</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td>Volume</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Microbial DNA (5ng/&#956;l)</td>
			<td>2.5 &#956;l</td>
		</tr>
		<tr>
			<td>Forward Primer (1 &#956;M; from step 5.1.2)</td>
			<td>5.0 &#956;l</td>
		</tr>
		<tr>
			<td>Reverse Primer (1 &#956;M; from step 5.1.2)</td>
			<td>5.0 &#956;l</td>
		</tr>
		<tr>
			<td>2X HotStart Ready Mix</td>
			<td>12.5 &#956;l</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25.0 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 4: Amplicon PCR Mix.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td colspan="2">Amplicon PCR set up</td>
		</tr>
		<tr>
			<td>95 &#176;C for 3 minutes</td>
			<td></td>
		</tr>
		<tr>
			<td>25 Cycles of:</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td>95 &#176;C for 30 seconds</td>
		</tr>
		<tr>
			<td></td>
			<td>55 &#176;C for 30 seconds</td>
		</tr>
		<tr>
			<td></td>
			<td>72 &#176;C for 60 seconds</td>
		</tr>
		<tr>
			<td>72 &#176;C for 3 minutes</td>
			<td></td>
		</tr>
		<tr>
			<td>Hold at 4 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 5: Amplicon PCR Program Set Up.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td colspan="2">Index PCR barcode assembly</td>
		</tr>
		<tr>
			<td>DNA</td>
			<td>2.5 &#956;l</td>
		</tr>
		<tr>
			<td>Index Primer 1 (N7XX)</td>
			<td>2.5 &#956;l</td>
		</tr>
		<tr>
			<td>Index Primer 2 (S5XX)</td>
			<td>2.5 &#956;l</td>
		</tr>
		<tr>
			<td>2X HotStart Ready Mix</td>
			<td>12.5 &#956;l</td>
		</tr>
		<tr>
			<td>PCR grade water</td>
			<td>5 &#956;l</td>
		</tr>
		<tr>
			<td>Total</td>
			<td>25 &#956;l</td>
		</tr>
	</tbody>
</table>
Table 6: Index PCR Mix.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td colspan="2">Index PCR Setup</td>
		</tr>
		<tr>
			<td>95 &#176;C for 3 minutes</td>
			<td></td>
		</tr>
		<tr>
			<td>8 cycles of:</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td>95 &#176;C for 30 seconds</td>
		</tr>
		<tr>
			<td></td>
			<td>55 &#176;C for 30 seconds</td>
		</tr>
		<tr>
			<td></td>
			<td>72 &#176;C for 30 seconds</td>
		</tr>
		<tr>
			<td>72 &#176;C for 5 minutes</td>
			<td></td>
		</tr>
		<tr>
			<td>Hold at 4 &#176;C</td>
			<td></td>
		</tr>
		<tr>
			<td>Store at -20 &#176;C</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 7: Index PCR Program Set Up.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Sample Concentration Formula for Pooling</td>
		</tr>
		<tr>
			<td>(DNA concentration in ng/&#956;l) &#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;x 106&#160; = Concentration in nM 
			(660 g/mol x average library size)</td>
		</tr>
		<tr>
			<td>An example from this study is:</td>
		</tr>
		<tr>
			<td>(85.2 ng/&#956;l)&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; &#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;x&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160; 10^6&#160; = 193.3 nM 
			(660 g/ mol x 668 bp)</td>
		</tr>
	</tbody>
</table>
Table 8: Formula for Normalizing Before Pooling Samples

Watch this Scientific Journal Video about A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model at JoVE.com

A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model

Environmental Enrichment (EE) is an animal housing environment that is used to reveal mechanisms that underlie the connections between lifestyle, stress, and disease. This protocol describes a procedure that uses a mouse model of colon tumorigenesis and EE to specifically define alterations in microbiota biodiversity that may impact animal mortality.

Several recent studies have illustrated the beneficial effects of living in an enriched environment on improving human disease. In mice, environmental ...

a-method-to-define-effects-environmental-enrichment-on-colon

Nanyang Technological University

Research

JoVE Journal

Cancer Research

8.7K Views.  University of Utah. Milieu verrijking (EE) is een dierverblijven omgeving die wordt gebruikt voor het onthullen van de mechanismen die ten grondslag liggen aan de verbindingen tussen de levensstijl, stress en ziekte. Dit protocol beschrijft een procedure maakt die gebruikmaakt van een muismodel van dikke darm tumorvorming en EE aan wijzigingen in microbiota biodiversiteit die mogelijk van invloed op dierlijke sterfte specifiek te definiëren.

Video: A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model

A Genetically Engineered Mouse Model of Sporadic Colorectal Cancer

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations and do not accurately simulate tumor biology and tumor cell dissemination. Genetically engineered mouse models have been introduced to overcome these limitations; however, such models are technically demanding, especially in large organs such as the colon in which only a single tumor is desired.
As a result, an immunocompetent, genetically engineered mouse model of colorectal cancer was developed which develops highly uniform tumors and can be used for tumor biology studies as well as therapeutic trials. Tumor development is initiated by surgical, segmental infection of the distal colon with adeno-cre virus in compound conditionally mutant mice. The tumors can be easily detected and monitored via colonoscopy. We here describe the surgical technique of segmental adeno-cre infection of the colon, the surveillance of the tumor via high-resolution colonoscopy and present the resulting colorectal tumors.

A protocol for the establishment of a genetically engineered mouse model of colorectal cancer by segmental adeno-cre infection and its surveillance via high-resolution colonoscopy is presented.

Despite the advantages of easy applicability and cost-effectiveness, colorectal cancer mouse models based on tumor cell injection have severe limitations ...

A Protocol for Housing Mice in an Enriched Environment

Environmental enrichment (EE) is a housing environment for mice that boosts mental and physical health compared to standard laboratory housing. Our recent studies demonstrate that environmental enrichment decreases adiposity, increases energy expenditure, resists diet induced obesity, and causes cancer remission and inhibition in mice. EE typically consists of larger living space, a variety of &#8216;toys&#8217; to interact with, running wheels, and can include a number of other novel environmental changes. All of this fosters a more complex social engagement, cognitive and physical stimulations. Importantly, the toy location and type of toy is changed regularly, which encourages the mice to adapt to a frequently changing and novel environment. Many variables can be manipulated in EE to promote health effects in mice. Thus these approaches are difficult to control and must be properly managed to successfully replicate the associated phenotypes. Therefore, the goal of this video is to demonstrate how EE is properly set up and maintained to assure a complex, challenging, and controlled environment so that other researchers can easily reproduce the protective effects of EE against obesity and cancer.

Environmental enrichment for mice requires a complex and challenging setup, as well as comprehensive husbandry and handling techniques to assure robust metabolic and anti-cancer effects in the mice. This protocol provides detailed procedures to reproduce the above mentioned effects in mice.

Environmental enrichment (EE) is a housing environment for mice that boosts mental and physical health compared to standard laboratory housing. Our recent ...

Behavior

Orthotopic Mouse Model of Colorectal Cancer

The traditional subcutaneous tumor model is less than ideal for studying colorectal cancer. Orthotopic mouse models of colorectal cancer, which feature cancer cells growing in their natural location, replicate human disease with high fidelity. Two techniques can be used to establish this model. Both techniques are similar and require mouse anesthesia and laparotomy for exposure of the cecum. One technique involves injection of a colorectal cancer cell suspension into the cecal wall. Cancer cells are first grown in culture, harvested when subconfluent and prepared as a single cell suspension. A small volume of cells is injected slowly to avoid leakage. The other technique involves transplantation of a piece of subcutaneous tumor onto the cecum. A mouse with a previously established subcutaneous colorectal tumor is euthanized and the tumor is removed using sterile technique. The tumor piece is divided into small pieces for transplantation to another mouse. Prior to transplantation, the cecal wall is lightly damaged to facilitate tumor cell infiltration. The time to developing primary tumors and liver metastases will vary depending on the technique, cell line, and mouse species used. This orthotopic mouse model is useful for studying the natural progression of colorectal cancer and testing new therapeutic agents against colorectal cancer.

Two techniques can be used to establish this model: injection of a cancer cell suspension into the cecal wall or transplantation of a piece of subcutaneous tumor onto the cecum. This model is useful for studying the natural progression of colorectal cancer and testing new therapeutic agents against colorectal cancer.

The traditional subcutaneous tumor model is less than ideal for studying colorectal cancer. Orthotopic mouse models of colorectal cancer, which feature ...

Biology

Enrichment and Characterization of the Tumor Immune and Non-immune Microenvironments in Established Subcutaneous Murine Tumors

The tumor immune microenvironment (TIME) has recently been recognized as a critical mediator of treatment response in solid tumors, especially for immunotherapies. Recent clinical advances in immunotherapy highlight the need for reproducible methods to accurately and thoroughly characterize the tumor and its associated immune infiltrate. Tumor enzymatic digestion and flow cytometric analysis allow broad characterization of numerous immune cell subsets and phenotypes; however, depth of analysis is often limited by fluorophore restrictions on panel design and the need to acquire large tumor samples to observe rare immune populations of interest. Thus, we have developed an effective and high throughput method for separating and enriching the tumor immune infiltrate from the non-immune tumor components. The described tumor digestion and centrifugal density-based separation technique allows separate characterization of tumor and tumor immune infiltrate fractions and preserves cellular viability, and thus, provides a broad characterization of the tumor immunologic state. This method was used to characterize the extensive spatial immune heterogeneity in solid tumors, which further demonstrates the need for consistent whole tumor immunologic profiling techniques. Overall, this method provides an effective and adaptable technique for the immunologic characterization of subcutaneous solid murine tumors; as such, this tool can be used to better characterize the tumoral immunologic features and in the preclinical evaluation of novel immunotherapeutic strategies.

Here we describe a method to separate and enrich components of the tumor immune and non-immune microenvironment in established subcutaneous tumors. This technique allows for the separate analysis of tumor immune infiltrate and non-immune tumor fractions which can permit comprehensive characterization of the tumor immune microenvironment.

The tumor immune microenvironment (TIME) has recently been recognized as a critical mediator of treatment response in solid tumors, especially for ...

Modeling Colitis-Associated Cancer with Azoxymethane (AOM) and Dextran Sulfate Sodium (DSS)

Individuals with inflammatory bowel disease (IBD), such as Crohn's disease (CD) or ulcerative colitis (UC) are at increased risk of developing colorectal cancer (CRC) over healthy individuals. This risk is proportional to the duration and extent of disease, with a cumulative incidence as high as 30% in individuals with longstanding UC with widespread colonic involvement.1 Colonic dysplasia in IBD and colitis associated cancer (CAC) are believed to develop as a result of repeated cycles of epithelial cell injury and repair while these cells are bathed in a chronic inflammatory cytokine milieu.2 While spontaneous and colitis-associated cancers share the quality of being adenocarcinomas, the sequence of underlying molecular events is believed to be different.3 This distinction argues the need for specific animal models of CAC.
Several mouse models currently exist for the study of CAC. Dextran sulfate sodium (DSS), an agent with direct toxic effects on the colonic epithelium, can be administered in drinking water to mice in multiple cycles to create a chronic inflammatory state. With sufficient duration, some of these mice will develop tumors.4 Tumor development is hastened in this model if administered in a pro-carcinogenic setting. These include mice with genetic mutations in tumorigenesis pathways (APC, p53, Msh2), as well as mice pre-treated with genotoxic agents (azoxymethane [AOM], 1,2-dimethylhydrazine [DMH]).5 
The combination of DSS with AOM as a model for colitis associated cancer has gained popularity for its reproducibility, potency, low price, and ease of use. Though they have a shared mechanism, AOM has been found to be more potent and stable in solution than DMH. While tumor development in other models generally requires several months, mice injected with AOM and subsequently treated with DSS develop adequate tumors in as little as 7-10 weeks.6, 7 Finally, AOM and DSS can be administered to mice of any genetic background (knock out, transgenic, etc.) without cross-breeding to a specific tumorigenic strain. Here, we demonstrate a protocol for inflammation-driven colonic tumorigenesis in mice utilizing a single injection of AOM followed by three seven-day cycles of DSS over a 10 week period. This model induces tumors with histological and molecular changes closely resembling those occurring in human CAC and provides a highly valuable model for the study of oncogenesis and chemoprevention in this disease.8

Modeling Colitis-Associated Cancer with Azoxymethane AOM and Dextran Sulfate Sodium DSS

We demonstrate a protocol in which administration of the genotoxic agent azoxymethane (AOM) followed by three cycles of the pro-inflammatory agent dextran sulfate sodium (DSS) rapidly and consistently generates colon tumors in mice with morphologic and molecular similarities to those seen in human colitis-associated cancer.

Individuals with inflammatory bowel disease (IBD), such as Crohn's disease (CD) or ulcerative colitis (UC) are at increased risk of developing colorectal ...

Medicine

Non-invasive Assessment of the Efficacy of New Therapeutics for Intestinal Pathologies Using Serial Endoscopic Imaging of Live Mice

Animal models of inflammatory bowel disease (IBD) and colorectal cancer (CRC) have provided significant insight into the cell intrinsic and extrinsic mechanisms that contribute to the onset and progression of intestinal diseases. The identification of new molecules that promote these pathologies has led to a flurry of activity focused on the development of potential new therapies to inhibit their function. As a result, various pre-clinical mouse models with an intact immune system and stromal microenvironment are now heavily used. Here we describe three experimental protocols to test the efficacy of new therapeutics in pre-clinical models of (1) acute mucosal damage, (2) chronic colitis and/or colitis-associated colon cancer, and (3) sporadic colorectal cancer. We also outline procedures for serial endoscopic examination that can be used to document the therapeutic response of an individual tumor and to monitor the health of individual mice. These protocols provide complementary experimental platforms to test the effectiveness of therapeutic compounds shown to be well tolerated by mice.

We describe methods for longitudinal monitoring of the efficacy of therapeutics for the treatment of colonic pathologies in mice using a rigid endoscope. This protocol can be readily used for the characterization of the therapeutic response of an individual tumor in live mice and also for monitoring potential disease relapse.

Animal models of inflammatory bowel disease (IBD) and colorectal cancer (CRC) have provided significant insight into the cell intrinsic and extrinsic ...

Murine Distal Colostomy, A Novel Model of Diversion Colitis in C57BL/6 Mice

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a diverting enterostomy. The etiology of this disease remains ill-defined but appears to differ from that of classical inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Research aimed to decipher the pathophysiological mechanisms leading to the development of this disease has been severely hampered by the lack of an appropriate murine model. This protocol generates a murine model of DC that facilitates the study of the immune system's role and its interaction with the microbiome in the development of DC. In this model using C57BL/6 animals, distal parts of the colon are excluded from the fecal stream by creating a distal colostomy, triggering the development of mild to moderate inflammation in the excluded bowel segments and reproducing the hallmark lesions of human DC with a moderate systemic inflammatory response. In contrast to the rat model, a large number of genetically-modified murine models on the C57BL/6 background are available. The combination of these animals with our model allows the potential roles of individual cytokines, chemokines, or receptors of bioactive molecules (e.g., interleukin (IL)-17; IL-10, chemokine CXCL13, chemokine receptors CXCR5 and CCR7, and the sphingosine-1-phosphate receptor 4) to be assessed in the pathogenesis of DC. The availability of congenic mouse strains on the C57BL/6 background largely facilitates transfer experiments to establish the roles of distinct cell types involved in the etiology of DC. Finally, the model offers the opportunity to assess the influences of local interventions (e.g., modification of the local microbiome or local anti-inflammatory therapy) on mucosal immunity in affected and non-affected bowel segments and the on systemic immune homeostasis.

Murine distal colostomy provides a murine model for human diversion colitis, a predominantly lymphocytic colitis in colon segment excluded from the fecal stream.

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a ...

Liujunzi Decoction: An Effective Treatment for UC-CRC Prevention

Establishment of Coloproctitis Cancer Model in Mice and Evaluation of Therapeutic Effect of Chinese Medicine

Colorectal cancer (CRC) is a common malignancy of the digestive system and has become the third most common malignancy worldwide and the second leading cause of malignancy-related death. Ulcerative coloproctitis (UC) is a precancerous lesion, and UC-associated CRC (UC-CRC) is the most common subtype of CRC. Therefore, a reasonable UC-CRC model is the cornerstone and guarantee of new drug development. Traditional Chinese medicine (TCM) has been widely used in the treatment of UC-CRC due to its good efficacy. As a classic tonic prescription of TCM, Liujunzi decoction (LJZD) has been widely used in the treatment of UC-CRC. In this study, a UC-CRC model was established by combining azomethane and dextran sulfate sodium, and the LJZD was administered. The data confirmed that LJZD can effectively inhibit cancer transition in UC-CRC by using mouse body weight, colorectal length, pathological and inflammatory factors, colorectal barrier function, and cancer markers. This protocol provides a system for evaluating the efficacy of TCM in the prevention and treatment of UC-CRC.

Author Spotlight: Liujunzi Decoction as a Traditional Chinese Treatment for Coloproctitis Cancer

This protocol provides a mouse model of ulcerative coloproctitis-associated colorectal cancer induced by azomethane combined with dextran sulfate sodium. The model was used to evaluate the efficacy of traditional Chinese medicine compounds in the prevention and treatment of colorectal cancer.

Colorectal cancer (CRC) is a common malignancy of the digestive system and has become the third most common malignancy worldwide and the second leading ...

Generating PDOX Mouse Model of Colorectal Cancer: Studying Progression of Colorectal Cancer in a Murine Model

Source: &#160;Moret, R. et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/v/59223"> Patient-derived Orthotopic Xenograft Models for Human Urothelial Cell Carcinoma and Colorectal Cancer Tumor Growth and Spontaneous Metastasis.</a> J. Vis. Exp. (2019).
This video describes the protocol for generating a patient-derived orthotopic xenograft colorectal cancer mouse model to study the progression of colorectal cancer cells in non-obese diabetic/severe combined immunodeficiency (NOD/SCID) mice. This murine model helps in understanding primary tumor growth and metastases pattern.

Source: &#160;Moret, R. et al.  Patient-derived Orthotopic Xenograft Models for Human Urothelial Cell Carcinoma and Colorectal Cancer Tumor Growth and ...

JoVE Encyclopedia of Experiments

Colorectal Cancer

Animal model studies

Stool Microbial DNA Isolation: Studying the Effect of Environmental Enrichment on Microbiome Diversity in Murine Tumor Model

Source: Fuller, A. K, et al.&#160; <a href="https://www-jove-com.remotexs.ntu.edu.sg/v/57182"> A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model.</a> J. Vis. Exp. (2018).
This video describes DNA isolation protocol from stool samples of colon tumor-bearing mice. The extracted DNA is amplified using PCR, and the product is further cleaned using a magnetic beads-based approach. This method can be used to determine the effect of environmental enrichment on colon microbiota and animal mortality.

Source: Fuller, A. K, et al.&#160;  A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor ...

A Method to Define the Effects of Environmental Enrichment on Colon Microbiome Biodiversity in a Mouse Colon Tumor Model

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video