We thank members in the Zhang lab for providing stimulating discussions and members in the Zhan lab for providing technical assistance. This research was supported by grants 31500860 (to C.Z.) of the NSFC, 2012CB837700 (to E.E.Z. and C.Z.) of the 973 Program from the M.O.S.T. of China, and by funding from the Beijing Municipal Government. E.E.Z. was supported by the Chinese &#34;Recruitment Program of Global Youth Experts&#34;.

All procedures in this protocol were conducted with the approval of the Institutional Animal Care and Use Committee (IACUC) of the National Institute of Biological Sciences, Beijing, in accordance with the governmental regulations of China.
1. Construction of the Cry1 Fluorescence Reporter
Note: Previous circadian studies using the bioluminescence system2,12,13 fuse a circadian promoter with a destabilized luciferase (dLuc) to induce rhythmic dLuc expression. To develop a fluorescence reporter, destabilized luciferase was replaced with destabilized fluorescence protein (dVenus) to induce rhythmic dVenus expression. The generation of the P(Cry1)-dVenus reporter is described below, the construct of which is currently being submitted to Addgene and will be available soon for academic use.
<ol>
	<li>Amplify the functional mouse Cry1 promoter (+328 to -1208 bp region of the Cry1 gene, transcription start site designated as &#8216;&#8216;-1&#8217;&#8217;). Use the PCR enzyme (KOD Plus Neo), primers F1 and R1 (see Table 2), mouse genome as a template and the manufacturer&#8217;s PCR protocol to amplify the Cry1 promoter DNA fragment.</li>
	<li>Amplify intron 336 of the Cry1 gene, which is important for the circadian clock function of Cry114. Use the PCR enzyme, primers F2 and R2, mouse genome as a template and the manufacturer&#8217;s PCR protocol to amplify the intron 336 DNA fragment.</li>
	<li>Amplify Venus. Use the PCR enzyme, primers F3 and R3, pVENUS-N1 plasmid as a template and the manufacturer&#8217;s PCR protocol to amplify the Venus DNA fragment.</li>
	<li>Amplify the NLS-D2 DNA fragment. Use the PCR enzyme, primers F4 and R4, pcDNA3.3-d2eGFP plasmid as a template and the manufacturer&#8217;s PCR protocol to amplify the NLS-D2 DNA fragment.</li>
	<li>Synthesize DNA fragment 1 as exon 1.</li>
	<li>Synthesize DNA fragment 2 as the linker between intron 336 and the Venus DNA fragment.</li>
	<li>Cut the pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA vector plasmid with the MluI and EcoRI enzymes. Use the Gel Extraction Kit to purify the larger DNA fragment. Use the manufacturer&#8217;s protocol.</li>
	<li>Using a Gibson assembly mix and its standard protocol, assemble all of the DNA fragments together to produce the pAAV-P(Cry1)-intron336-Venus-NLS-D2-WPRE-HGHpA reporter. Use the manufacturer&#8217;s protocol.</li>
</ol>
2. Production of Adeno-associated Virus15
<ol>
	<li>Prepare the following plasmid DNA stocks: 31.25 &#181;g of pRV1, 31.25 &#181;g of pH21, 125 &#181;g of pFdelta6, and 62.5 &#181;g of pAAV-P(Cry1)-intron336-Venus-NLS- D2-WPRE-HGHpA.</li>
	<li>Prepare five 15 cm dishes of 293T cells and wait until the cells become 90% confluent.</li>
	<li>Transfect the plasmids into the 297T cells following the transfection reagent protocol. For each dish, use 6.25 &#181;g of pRV1, 6.25 &#181;g of pH21, 25 &#181;g of pFdelta6, 12.5 &#181;g of pAAV-P(Cry1)-intron336-Venus-NLS-D2-WPRE-HGHpA, and 120 &#181;L of transfection reagent.</li>
	<li>72 h after transfection, detach the cells from each plate using a pipette gun; harvest the cells into two 50 mL tubes.</li>
	<li>Pellet the cells at 800 x g for 10 min and discard the supernatant. Wash the cells by placing 20 mL of phosphate-buffered saline (PBS) into each tube; pellet the cells at 800 x g for 10 min, and discard the supernatant.</li>
	<li>Resuspend pellets in 150 mM NaCl and 20 mM Tris solution, pH 8.0; use 25 mL of solution/tube. Add 1.25 mL of freshly prepared 10% sodium deoxycholate (in dH2O) to each tube. Add benzonase nuclease to a final concentration of 50 units per mL, and mix thoroughly. Incubate at 37 &#176;C for 1 h.</li>
	<li>Remove cellular debris by centrifuging at 3000 x g for 15 min. Further ensure that all debris has been removed by pushing the mixture through a 0.45 &#956;m syringe filter; this step will help prevent blocking of heparin columns.</li>
	<li>Set up the heparin columns using a peristaltic pump; set the flow rate to 1 mL/min, ensuring that no air bubbles are introduced into the columns.</li>
	<li>Equilibrate the columns with 10 mL of a 150 mM NaCl, 20 mM Tris solution, pH 8.0. Add the solution containing the virus to each column. Wash the columns with 20 mL of a 100 mM NaCl, 20 mM Tris solution, pH 8.0. Then, using a 5 mL syringe, wash the columns with 1 mL of a 200 mM NaCl and 20 mM Tris solution pH 8.0, followed by 1 mL of a 300 mM NaCl and 20 mM Tris solution, pH 8.0.</li>
	<li>Use a 5 mL syringe to elute the virus with 3 mL of a 400 mM NaCl, 20 mM Tris solution, pH 8.0, followed by 4 mL of a 450 mM NaCl, 20 mM Tris solution, pH 8.0, and finally by a 3 mL of a 500 mM NaCl, 20 mM Tris solution, pH 8.0. Collect the extracted materials.</li>
	<li>For recombinant adeno-associated virus (rAAV) concentration, load the extracted materials, 4 mL at a time, into centrifugal filter units with a 100,000 molecular weight cutoff. Centrifuge each 4-mL sample at 2000 x g for 5 min at room temperature, discarding the flow-through.</li>
	<li>When all extracted materials have been run through the centrifugal filter units, add 4 mL of PBS and centrifuge the mixture into approximately 250 &#956;L. Remove rAAVs (viral titer should be about 2 - 8 x 1012 viral particles per mL) from the centrifugal filter units, aliquot and store at -80 &#176;C until use. At this stage, the virus can be stored for several months.</li>
</ol>
3. rAAV Injection and Optic Fiber Insertion into the Adult Mouse SCN
<ol>
	<li>Injection of circadian fluorescence reporter-carrying rAAVs into the SCN
	<ol>
		<li>Load 5 &#181;L of rAAV (the virus titer is about 2 - 8 x 1012 virus particles per mL) into a micro-syringe.</li>
		<li>Anesthetize an adult mouse (2- to 5-month-old, C57BL/6 background) with Nembutal (80 mg/kg) via intraperitoneal injection. Check for sufficient depth of anesthesia by the lack of a toe-pinch response.</li>
		<li>Use scissors to remove fur from the head of the mouse and then mount the mouse into a stereotaxic apparatus. Provide a heat source to anesthetized animals via a circulating hot water blanket or another heating device. 
		NOTE: Alternatively, use depilatory cream or electric hair clippers to remove the fur.</li>
		<li>Clean the surgical site with the appropriate disinfecting agents. For example, this could include sterile water or alcohol and iodine, betadine,&#160;or dilute chlorhexidine in alternating scrubs. Repeat at least 3 times.&#160;Drape the surgical site.</li>
		<li>&#160;Use the scissors to make an incision in the scalp and expose the skull.</li>
		<li>Adjust the stereotaxic apparatus so that bregma and lambda are in the same horizontal plane; make two symmetrical points of bregma in the same horizontal plane.</li>
		<li>Use a sterile cotton swab soaked in 4% H2O2/H2O to corrode the brain periosteum. Then use a clean, sterile cotton swab to clear and dry the surface of the skull.</li>
		<li>Using a micro drill, make a hole about 1 mm in diameter 0.46 mm posterior and 0.25 mm lateral to bregma.</li>
		<li>fiUse a clean cotton sterile swab with physiological saline solution to clear bone fragments from the exposed surface of the brain.</li>
		<li>Insert a micro-syringe into the brain, ensuring that the tip of the micro-syringe is 0.46 mm posterior and 0.25 mm lateral to bregma, and 5.7 mm deep from the surface of the skull.</li>
		<li>Inject 500 nL of rAAV (50 nL min-1) into the SCN, leaving the micro-syringe in place for 10 min after the injection to ensure complete diffusion of rAAV.</li>
		<li>Slowly withdraw the micro-syringe.</li>
	</ol>
	</li>
	<li>Insert the optical fiber into the SCN area.
	<ol>
		<li>Using an optical fiber knife, cut a fiber 17-mm in length, making sure that each side of the optic fiber is smooth.</li>
		<li>Insert the optic fiber into the ceramic ferrule and fix the optic fiber to a ceramic ferrule with methyl ethyl ketone peroxide (AB glue), ensuring that the surfaces of the optical fiber and ceramic ferrule are flush.</li>
		<li>Clean the fiber with a cold sterilant solution or ethylene oxide.</li>
		<li>After rAAV injection (step 3.1.11), insert the ceramic ferrule-containing optic fiber into the SCN.</li>
		<li>Fix the ceramic ferrule and optical fiber onto the skull using dental resin and allow to dry.</li>
		<li>Smear the surface of the dental resin with back nail polish. Repeat the procedures outlined in 3.1.2&#160;to 3.2.5, omitting the actual injection of rAAV for control.</li>
	</ol>
	</li>
	<li>Post-surgical care
	<ol>
		<li>Provide mice with post-operative analgesics, such as buprenorphine 2 mg/kg body weight, subcutaneously, twice a day.</li>
		<li>Place mice in a recovery cage while they come out of anesthesia.</li>
		<li>House mice individually under a 12 h light/dark condition (light intensity ~100 lux at the bottom of the cage) with food/water available ad libitum. Eight days should be allotted before further experimentation to allow for sufficient recovery time and to ensure optimal fluorescence reporter expression.</li>
	</ol>
	</li>
</ol>
4. In vivo Fluorescence Signal Monitoring and Data Collection
<ol>
	<li>Eight days after surgery, connect the fiber on the mouse head with the fluorescence signal monitor (e.g., Gene Observer). Check the fluorescence signal in the SCN of control mice to establish the background signal. Conduct the observation and measurement of this signal using fluorescence signal monitor.</li>
	<li>Evaluate the fluorescence signal of experimental mouse with the same operation of the control mouse. Exclude mice which have received the viral vector but which only display the background signal from analysis, as this likely indicates that the tip of the optic fiber has missed the SCN. After these initial measures, return mice to their home cages for another 3 weeks to allow the fluorescence signal to stabilize.</li>
	<li>After 3 weeks, connect the mice with the fluorescence signal monitor. Measure the fluorescence for 15 s every 10 min, at a frequency of 100 Hz. During these measurements, the mice are freely moving in their cages with food/water available ad libitum. Use a light intensity at the bottom of the cage of ~100 lux, and a the laser power at the tip of the optic fiber between 15 - 20 &#181;W.</li>
	<li>After the completion of all recordings, perfuse mice with 4% paraformaldehyde, and remove and slice the brains to check placement of the optic fiber. Exclude mice from analysis if the optic fiber tip is not correctly implanted in the SCN.</li>
</ol>
5. Data Analysis and Presentation
<ol>
	<li>Measure fluorescence signal every 10 min for 15 s, at a frequency of 100 Hz, to yield 1500 data points. The average of these 1500 points translates to the fluorescence signal at any given time point. Plotting multiple averages over time produces a signal-to-time curve which corresponds to the transcriptional rhythm of Cry1 under a control light condition in the SCN of freely moving mice.</li>
</ol>

<ol><li>Welsh, D. K., Takahashi, J. S., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Suprachiasmatic+nucleus%3A+cell+autonomy+and+network+properties%5BTitle%5D)+AND+%22Annual+Review+of+Physiology%22%5BJournal%5D)">Suprachiasmatic nucleus: cell autonomy and network properties.</a> Annual Review of Physiology. 72, 551-577 (2010).</li>
<li>Zhang, E. E., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clocks+not+winding+down%3A+unravelling+circadian+networks%5BTitle%5D)+AND+%22Nature+Reviews+Molecular+Cell+Biology%22%5BJournal%5D)">Clocks not winding down: unravelling circadian networks.</a> Nature Reviews Molecular Cell Biology. 11, 764-776 (2010).</li>
<li>Takahashi, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Transcriptional+architecture+of+the+mammalian+circadian+clock%5BTitle%5D)+AND+%22Nature+Reviews+Genetics%22%5BJournal%5D)">Transcriptional architecture of the mammalian circadian clock.</a> Nature Reviews Genetics. 18, 164-179 (2017).</li>
<li>Yoo, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((PERIOD2%3A%3ALUCIFERASE+real-time+reporting+of+circadian+dynamics+reveals+persistent+circadian+oscillations+in+mouse+peripheral+tissues%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+U+S+A%22%5BJournal%5D)">PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues.</a> Proceedings of the National Academy of Sciences U S A. 101, 5339-5346 (2004).</li>
<li>Davidson, A. J., Castanon-Cervantes, O., Leise, T. L., Molyneux, P. C., Harrington, M. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Visualizing+jet+lag+in+the+mouse+suprachiasmatic+nucleus+and+peripheral+circadian+timing+system%5BTitle%5D)+AND+%22European+Journal+of+Neuroscience%22%5BJournal%5D)">Visualizing jet lag in the mouse suprachiasmatic nucleus and peripheral circadian timing system.</a> European Journal of Neuroscience. 29, 171-180 (2009).</li>
<li>Savelyev, S. A., Larsson, K. C., Johansson, A. S., Lundkvist, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Slice+preparation%2C+organotypic+tissue+culturing+and+luciferase+recording+of+clock+gene+activity+in+the+suprachiasmatic+nucleus%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Slice preparation, organotypic tissue culturing and luciferase recording of clock gene activity in the suprachiasmatic nucleus.</a> Journal of Visualized Experiments. (48), (2011).</li>
<li>Yamaguchi, S., et al. <a target="_blank" href="https://www.nature.com/articles/35055628">Gene expression: View of a mouse clock gene ticking.</a> Nature. 409, 684-684 (2001).</li>
<li>Ono, D., Honma, K. I., Honma, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circadian+and+ultradian+rhythms+of+clock+gene+expression+in+the+suprachiasmatic+nucleus+of+freely+moving+mice%5BTitle%5D)+AND+%22Science+Reports%22%5BJournal%5D)">Circadian and ultradian rhythms of clock gene expression in the suprachiasmatic nucleus of freely moving mice.</a> Science Reports. 5, 12310(2015).</li>
<li>Ono, D., Honma, S., Honma, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Circadian+PER2%3A%3ALUC+rhythms+in+the+olfactory+bulb+of+freely+moving+mice+depend+on+the+suprachiasmatic+nucleus+but+not+on+behaviour+rhythms%5BTitle%5D)+AND+%22European+Journal+of+Neuroscience%22%5BJournal%5D)">Circadian PER2::LUC rhythms in the olfactory bulb of freely moving mice depend on the suprachiasmatic nucleus but not on behaviour rhythms.</a> European Journal of Neuroscience. 42, 3128-3137 (2015).</li>
<li>Ono, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Dissociation+of+Per1+and+Bmal1+circadian+rhythms+in+the+suprachiasmatic+nucleus+in+parallel+with+behavioral+outputs%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+U+S+A%22%5BJournal%5D)">Dissociation of Per1 and Bmal1 circadian rhythms in the suprachiasmatic nucleus in parallel with behavioral outputs.</a> Proceedings of the National Academy of Sciences U S A. 114, E3699-E3708 (2017).</li>
<li>Reppert, S. M., Weaver, D. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Coordination+of+circadian+timing+in+mammals%5BTitle%5D)+AND+%22Nature%22%5BJournal%5D)">Coordination of circadian timing in mammals.</a> Nature. 418, 935-941 (2002).</li>
<li>Liu, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Redundant+function+of+REV-ERBalpha+and+beta+and+non-essential+role+for+Bmal1+cycling+in+transcriptional+regulation+of+intracellular+circadian+rhythms%5BTitle%5D)+AND+%22PLoS+Genetics%22%5BJournal%5D)">Redundant function of REV-ERBalpha and beta and non-essential role for Bmal1 cycling in transcriptional regulation of intracellular circadian rhythms.</a> PLoS Genetics. 4, e1000023(2008).</li>
<li>Maywood, E. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Analysis+of+core+circadian+feedback+loop+in+suprachiasmatic+nucleus+of+mCry1-luc+transgenic+reporter+mouse%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences+U+S+A%22%5BJournal%5D)">Analysis of core circadian feedback loop in suprachiasmatic nucleus of mCry1-luc transgenic reporter mouse.</a> Proceedings of the National Academy of Sciences U S A. 110, 9547-9552 (2013).</li>
<li>Ukai-Tadenuma, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Delay+in+feedback+repression+by+cryptochrome+1+is+required+for+circadian+clock+function%5BTitle%5D)+AND+%22Cell%22%5BJournal%5D)">Delay in feedback repression by cryptochrome 1 is required for circadian clock function.</a> Cell. 144, 268-281 (2011).</li>
<li>McClure, C., Cole, K. L., Wulff, P., Klugmann, M., Murray, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Production+and+titering+of+recombinant+adeno-associated+viral+vectors%5BTitle%5D)+AND+%22Journal+of+Visualized+Experiments%22%5BJournal%5D)">Production and titering of recombinant adeno-associated viral vectors.</a> Journal of Visualized Experiments. 57, e3348(2011).</li>
<li>Yamaguchi, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Mice+genetically+deficient+in+vasopressin+V1a+and+V1b+receptors+are+resistant+to+jet+lag%5BTitle%5D)+AND+%22Science%22%5BJournal%5D)">Mice genetically deficient in vasopressin V1a and V1b receptors are resistant to jet lag.</a> Science. 342, 85-90 (2013).</li>
<li>Nagano, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((An+abrupt+shift+in+the+day%2Fnight+cycle+causes+desynchrony+in+the+mammalian+circadian+center%5BTitle%5D)+AND+%22Journal+of+Neuroscience%22%5BJournal%5D)">An abrupt shift in the day/night cycle causes desynchrony in the mammalian circadian center.</a> Journal of Neuroscience. 23, 6141-6151 (2003).</li>
<li>Golombek, D. A., Rosenstein, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Physiology+of+Circadian+Entrainment%5BTitle%5D)+AND+%22Physiological+Reviews%22%5BJournal%5D)">Physiology of Circadian Entrainment.</a> Physiological Reviews. 90, 1063-1102 (2010).</li>
<li>Mei, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Long-term+in+vivo+recording+of+circadian+rhythms+in+brains+of+freely+moving+mice%5BTitle%5D)+AND+%22Proceedings+of+the+National+Academy+of+Sciences%22%5BJournal%5D)">Long-term in vivo recording of circadian rhythms in brains of freely moving mice.</a> Proceedings of the National Academy of Sciences. 115, 4276-4281 (2018).</li>
</ol>

The authors have no conflicts of interest to disclose.

In contrast to ex vivo methods, such as slice culture4,5, RT-PCR16, and in situ hybridization17, which require that animals be killed, the in vivo recording method allows investigators to study circadian gene expression in a living animal. As such, this technology provides the ability to evaluate the effect of different physical perturbations (e.g., sleep deprivation, stress, food intake, etc.) on the neural circadian clock. In contrast to the in vivo bioluminescence7,8,10 method that can only work in constant dark conditions, the fluorescence in vivo recording method can be applied under light conditions-a key advantage of the technology as light signals re-entrainment of the SCN circadian clock18. Although relatively constant, robust circadian rhythms can be detected with this method, it should be mentioned that the reporter technology does not provide quantitative information and can therefore not be used to measure levels of gene transcription and translation.
There are many critical steps of this protocol. The concentrated rAAV titer should be as high as 2 - 8x 1012 viral particles per mL; lower viral titers would give off dim or even undetectable fluorescence signals. When fixing the head of the mouse into the stereotaxic apparatus, ensure that the skull is horizontal to secure accurate positioning for virus injection and optical fiber implantation. Injection of the virus should be done slowly (&#8804;50 nL min-1) to ensure that the virus remains in the SCN. The ceramic ferrule and optical fiber should be securely fixed on the skull and dental resin should not contact the skin. If the ceramic ferrule and optical fiber are not adequately fixed, they will gradually detach from the mouse head.
This technique can be extended to include other gene reporters (e.g., Per2, Bmal1, c-Fos, Pomc, etc.) by changing the promoter and the corresponding intron19. By reversing the flag-inton336-Venus-NLS-D2 cassette with two reversed lox sequences and combining the reporter with a Cre mouse line, this technology can be used to record activity in specific neurons. For example, combining this approach with a Vip-cre mouse line would allow for the recording of Cry1 transcriptional rhythms in vasoactive intestinal polypeptide-expressing neurons in the SCN. This method can also employ GCaMP6 as a Ca2+ indicator to record the Ca2+ circadian rhythm in the brain.

In mammals, the suprachiasmatic nucleus (SCN) governs the whole body&#39;s circadian rhythm to coordinate an individual&#39;s response to exogenous environmental changes (e.g., light, temperature, stress, etc.)1. Core clock components consist of Per1-3, Cry1-2, Clock, and Bmal1, and play a central role in regulating the circadian clock of each cell. Each cell in the SCN contains the transcriptional activator, CLOCK/BMAL1, which acts as a heterodimer to induce the expression of PER and CRY. The PER/CRY complex then inhibits the function of CLOCK/BMAL1 to form a transcription-translation feedback loop that takes about 24 h to complete2,3.
Previous studies on the SCN have mainly employed the ex vivo SCN slice culture method4,5,6 and, while this approach has provided valuable information, its limitations have inhibited our ability to obtain data regarding the influence of other brain nuclei on the SCN, as well as the effect of exogenous stimuli (e.g., light) on cells residing in this critical region. In 2001, Hitoshi Okamura&#39;s group was the first to use the bioluminescence system to in vivo monitor circadian clock gene expression in the SCN in freely moving mice7. Ken-ichi Honma&#39;s group has spent the past few years further developing the bioluminescence in vivo recording system in the SCN8,9,10. Together, these studies have provided researchers with the ability to monitor the circadian clock in constant darkness or after a light pulse. However, because bioluminescence is too dim to allow for continuous monitoring during the light/dark cycle, coupled with the fact that light is the predominant signal required for the SCN-mediated entrainment of circadian clocks11, there is increasing demand for the development of experimental methods which overcome the limitations associated with bioluminescence recording. The current report describes a fluorescence-based system which was constructed to monitor the circadian clock of the SCN in vivo in freely moving mice. This easy-to-use method permits continuous monitoring during the light/dark cycle and allows for the long-term observation of the transcription of circadian clock genes in the SCN in real-time and at high temporal resolution.

<table><tbody><tr><td>KOD Plus Neo</td><td>TOYOBO</td><td>KOD-401</td><td>Reagent</td></tr><tr><td>pVENUS-N1</td><td>addgene</td><td>#61854</td><td>Plasmid</td></tr><tr><td>pcDNA3.3_d2eGFP</td><td>addgene</td><td>#26821</td><td>Plasmid</td></tr><tr><td>pAAV-EF1a-double floxed-hChR2(H134R)-mCherry-WPRE-HGHpA</td><td>addgene</td><td>#20297</td><td>Plasmid</td></tr><tr><td>MluI</td><td>Thermo Scientific</td><td>FD0564</td><td>Reagent</td></tr><tr><td>EcoRI</td><td>Thermo Scientific</td><td>FD0274</td><td>Reagent</td></tr><tr><td>Gibson Assembly Mix</td><td>NEB</td><td>E2611s</td><td>Reagent</td></tr><tr><td>Lipofectamine 2000</td><td>Thermo Scientific</td><td>12566014</td><td>Reagent</td></tr><tr><td>Syringe Filter</td><td>EMD Millipore</td><td>SLHV033RS</td><td>0.45&amp;nbsp;&amp;micro;m&amp;nbsp;</td></tr><tr><td>HiTrap heparin columns</td><td>gelifesciences</td><td>17-0406-01</td><td>1 mL&amp;nbsp;</td></tr><tr><td>Amicon ultra-4 centrifugal filter</td><td>EMD Millipore</td><td>&amp;nbsp;UFC810024</td><td>100,000 MWCO</td></tr><tr><td>Benzonase nuclease</td><td>Sigma-Aldrich</td><td>E1014</td><td>Reagent</td></tr><tr><td>Sodium deoxycholate</td><td>Sigma-Aldrich</td><td>D5670</td><td>Make fresh solution for each batch</td></tr><tr><td>mouse stereotaxic apparatus</td><td>B&amp;amp;E TEKSYSTEMS LTD</td><td>#SR-5M/6M</td><td>Equipment</td></tr><tr><td>pentobarbital</td><td>SigmaAldrich</td><td>#1507002</td><td>Reagent</td></tr><tr><td>mouse stereotaxic apparatus</td><td>B&amp;amp;E TEKSYSTEMS LTD</td><td>#SR-5M/6M</td><td>Equipment</td></tr><tr><td>Hydrogen peroxide solution</td><td>SigmaAldrich</td><td>#216763</td><td>Reagent</td></tr><tr><td>Optical Fiber</td><td>Thorlabs</td><td>FT200EMT</td><td>0.39 NA, &amp;Oslash;200 &amp;micro;m</td></tr><tr><td>microsyringe pump</td><td>Nanoliter 2000 Injector, WPI</td><td></td><td>Equipment</td></tr><tr><td>ceramic ferrule</td><td>Shanghai Fiblaser</td><td></td><td>230&amp;thinsp;&amp;mu;m I.D., 2.5 mm O.D.</td></tr><tr><td>Gene Observer</td><td>BiolinkOptics</td><td></td><td>Equipment</td></tr></tbody></table>

in vivo monitoring of circadian clock gene expression in the mouse suprachiasmatic nucleus using fluorescence reporters

This technique combines optical fiber mediated fluorescence recordings with the precise delivery of recombinant adeno-associated virus based gene reporters. This new and easy to use in vivo fluorescence monitoring system was developed to record the transcriptional rhythm of the clock gene, Cry1, in the suprachiasmatic nucleus (SCN) of freely moving mice. To do so, a Cry1 transcription fluorescence reporter was designed and packaged into Adeno-associated virus. Purified, concentrated virus was injected into the mouse SCN followed by the insertion of an optic fiber, which was then fixed onto the surface of the brain. The animals were returned to their home cages and allowed a 1-month post-operative recovery period to ensure sufficient reporter expression. Fluorescence was then recorded in freely moving mice via an in vivo monitoring system that was constructed at our institution. For the in vivo recording system, a 488 nm laser was coupled with a 1 &#215; 4 beam-splitter that divided the light into four laser excitation outputs of equal power. This setup enabled us to record from four animals simultaneously. Each of the emitted fluorescence signals was collected via a photomultiplier tube and a data acquisition card. In contrast to the previous bioluminescence in vivo circadian clock recording technique, this fluorescence in vivo recording system allowed the recording of circadian clock gene expression during the light cycle.

Fluorescence reporter design of Cry1 was show in Figure 1A. Using the approach detailed above, 500 nL of rAAV-P(Cry1)-intron336-Venus-NLS-D2 was successfully injected into the SCN of an adult mouse, and exhibited robust Venus expression (Figure 1B, 1C). Fluorescence signals recorded under 12h/12h light/dark (LD) and dark/dark (DD) conditions (Figure 2) yielded robust circadian rhythm in both conditions. Finally, fluorescence signal was recorded in long and short photoperiod conditions (Figure 3).
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56765/56765fig1.jpg" /> 
Figure 1. Fluorescence reporter design and it expression in the SCN 
(A) The fluorescence reporter design of Cry1. (B) Photomicrograph of the mouse brain showing reporter expression 8 days after the virus injection. (C) Magnification of the area boxed in red on the photomicrograph shown in (B). <a href="/files/ftp_upload/56765/56765fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56765/56765fig2.jpg" /> 
Figure 2. Fluorescence in vivo recording in the SCN under LD and DD conditions 
(A) Background fluorescence in the SCN showing no detectable rhythm under both LD and DD conditions. The white and gray areas indicate light-on and light-off periods, respectively. (B) P(Cry1)-intron336-Venus-NLS-D2 expression over the course of 7 days in a 12-12 LD condition and 7 days in a DD condition. (C) Analysis of circadian rhythm in the LD condition (~24.4 h); the red line indicates the converged fit in the Sine curve (the result of the fit is shown in the left panel). (D) Analysis of circadian rhythm in the DD condition (~23.25 h); the red line indicates the converged fit in the Sine curve (the result of the fit is shown in the left panel). <a href="/files/ftp_upload/56765/56765fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56765/56765fig3.jpg" /> 
Figure 3. In vivo fluorescence recordings in the SCN under 20-4 long and 4-20 short photoperiod conditions 
Example of a fluorescence recording of P(Cry1)-intron336-Venus-NLS-D2 expression in the SCN for 7 days under a 12-12 LD condition, followed by 7 days under a 20-4 long photoperiod condition, 3 days under a DD condition, 3 days under a 12-12 LD condition, and then 7 days under a 4-20 short photoperiod condition. White and gray areas indicate the light-on and light-off periods, respectively. <a href="/files/ftp_upload/56765/56765fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1. Specific reagents required for protocol (See Table of Materials)
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>primer name</td>
			<td colspan="3">sequence</td>
		</tr>
		<tr>
			<td>primer F1</td>
			<td colspan="3">cactaggggttcctgcggccgcACGCGTGTAAAGATGCACATGTG</td>
		</tr>
		<tr>
			<td>primer R1</td>
			<td colspan="3">TTGTAACCTTGATACTTACCTACTTAGATCGCAGATCTCGTCCGG</td>
		</tr>
		<tr>
			<td>primer F2</td>
			<td colspan="3">GTTATGACACAGTGTAGAAACTATGGCATAGGACAGATGACTGTG</td>
		</tr>
		<tr>
			<td>primer R2</td>
			<td colspan="3">CATGGTCTTTGTAGTCCATGGTGGGTACCtCTTGACAGCTCTACC</td>
		</tr>
		<tr>
			<td>primer F3</td>
			<td colspan="3">ctgtattttcagggcCCTGCAGGtGTGAGCAAGGGCGAGGAGCTG</td>
		</tr>
		<tr>
			<td>primer R3</td>
			<td colspan="3">TACCTTTCTCTTCTTTTTTGGAGGCTTGTACAGCTCGTCCATGCC</td>
		</tr>
		<tr>
			<td>primer F4</td>
			<td colspan="3">GCATGGACGAGCTGTACAAGCCTCCAAAAAAGAAGAGAAAGGTAG</td>
		</tr>
		<tr>
			<td>primer R4</td>
			<td colspan="3">tgatatcgaattcGGATCCCTACACATTGATCCTAGCAGAAGCAC</td>
		</tr>
	</tbody>
</table>
Table 2. Primer used in the protocol
Table 3. DNA sequence used in the protocol <a href="/files/ftp_upload/56765/Table3.xlsx">Please click here to download this file.</a>

Watch this Scientific Journal Video about In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters at JoVE.com

In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

This newly developed fluorescence-based technology enables long-term monitoring of the transcription of circadian clock genes in the suprachiasmatic nucleus (SCN) of freely moving mice in real-time and at a high temporal resolution.

In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

This technique combines optical fiber mediated fluorescence recordings with the precise delivery of recombinant adeno-associated virus based gene ...

in-vivo-monitoring-circadian-clock-gene-expression-mouse

Nanyang Technological University

Research

JoVE Journal

Neuroscience

8.2K Views.  Peking University. Deze nieuw ontwikkelde fluorescentie gebaseerde technologie kan op lange termijn van de transcriptie van de circadiane klok genen in de suprachiasmatic kern (SCN) vrij bewegen muizen in real time en met een hoge temporele resolutie.

Video: In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

Parallel Measurement of Circadian Clock Gene Expression and Hormone Secretion in Human Primary Cell Cultures

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental changes. Considerable progress in our understanding of the tight connection between the circadian clock and most aspects of physiology has been made in the field over the last decade. However, unraveling the molecular basis that underlies the function of the circadian oscillator in humans stays of highest technical challenge. Here, we provide a detailed description of an experimental approach for long-term (2-5 days) bioluminescence recording and outflow medium collection in cultured human primary cells. For this purpose, we have transduced primary cells with a lentiviral luciferase reporter that is under control of a core clock gene promoter, which allows for the parallel assessment of hormone secretion and circadian bioluminescence. Furthermore, we describe the conditions for disrupting the circadian clock in primary human cells by transfecting siRNA targeting CLOCK. Our results on the circadian regulation of insulin secretion by human pancreatic islets, and myokine secretion by human skeletal muscle cells, are presented here to illustrate the application of this methodology. These settings can be used to study the molecular makeup of human peripheral clocks and to analyze their functional impact on primary cells under physiological or pathophysiological conditions.

Here, we describe settings to monitor in parallel circadian bioluminescence and the secretory activity of human islet cells and primary myotubes. For this, we employed lentiviral gene delivery of a luciferase core clock reporter, followed by in vitro synchronization and collection of outflow medium by continuous cell perifusion.

Circadian clocks are functional in all light-sensitive organisms, allowing for an adaptation to the external world by anticipating daily environmental ...

Genetics

In Vitro Bioluminescence Assay to Characterize Circadian Rhythm in Mammary Epithelial Cells

The circadian rhythm is a fundamental physiological process present in all organisms that regulates biological processes ranging from gene expression to sleep behavior. In vertebrates, circadian rhythm is controlled by a molecular oscillator that functions in both the suprachiasmatic nucleus (SCN; central pacemaker) and individual cells comprising most peripheral tissues. More importantly, disruption of circadian rhythm by exposure to light-at-night, environmental stressors and/or toxicants is associated with increased risk of chronic diseases and aging. The ability to identify agents that can disrupt central and/or peripheral biological clocks, and agents that can prevent or mitigate the effects of circadian disruption, has significant implications for prevention of chronic diseases. Although rodent models can be used to identify exposures and agents that induce or prevent/mitigate circadian disruption, these experiments require large numbers of animals. In vivo studies also require significant resources and infrastructure, and require researchers to work all night. Thus, there is an urgent need for a cell-type appropriate in vitro system to screen for environmental circadian disruptors and enhancers in cell types from different organs and disease states. We constructed a vector that drives transcription of the destabilized luciferase in eukaryotic cells under the control of the human PERIOD 2 gene promoter. This circadian reporter construct was stably transfected into human mammary epithelial cells, and circadian responsive reporter cells were selected to develop the in vitro bioluminescence assay. Here, we present a detailed protocol to establish and validate the assay. We further provide details for proof of concept experiments demonstrating the ability of our in vitro assay to recapitulate the in vivo effects of various chemicals on the cellular biological clock. The results indicate that the assay can be adapted to a variety of cell types to screen for both environmental disruptors and chemopreventive enhancers of circadian clocks.

In Vitro Bioluminescence Assay to Characterize Circadian Rhythm in Mammary Epithelial Cells

An in vitro bioluminescence assay to determine cellular circadian rhythm in mammary epithelial cells is presented. This method utilizes mammalian cell reporter plasmids expressing destabilized luciferase under the control of the PERIOD 2 gene promoter. It can be adapted to other cell types to evaluate organ-specific effects on circadian rhythm.

The circadian rhythm is a fundamental physiological process present in all organisms that regulates biological processes ranging from gene expression to ...

Slice Preparation, Organotypic Tissue Culturing and Luciferase Recording of Clock Gene Activity in the Suprachiasmatic Nucleus

A central circadian (~24 hr) clock coordinating daily rhythms in physiology and behavior resides in the suprachiasmatic nucleus (SCN) located in the anterior hypothalamus. The clock is directly synchronized by light via the retina and optic nerve. Circadian oscillations are generated by interacting negative feedback loops of a number of so called "clock genes" and their protein products, including the Period (Per) genes. The core clock is also dependent on membrane depolarization, calcium and cAMP 1. The SCN shows daily oscillations in clock gene expression, metabolic activity and spontaneous electrical activity. Remarkably, this endogenous cyclic activity persists in adult tissue slices of the SCN 2-4. In this way, the biological clock can easily be studied in vitro, allowing molecular, electrophysiological and metabolic investigations of the pacemaker function.
The SCN is a small, well-defined bilateral structure located right above the optic chiasm 5. In the rat it contains ~8.000 neurons in each nucleus and has dimensions of approximately 947 &mu;m (length, rostrocaudal axis) x 424 &mu;m (width) x 390 &mu;m (height) 6. To dissect out the SCN it is necessary to cut a brain slice at the specific level of the brain where the SCN can be identified. Here, we describe the dissecting and slicing procedure of the SCN, which is similar for mouse and rat brains. Further, we show how to culture the dissected tissue organotypically on a membrane 7, a technique developed for SCN tissue culture by Yamazaki et al. 8. Finally, we demonstrate how transgenic tissue can be used for measuring expression of clock genes/proteins using dynamic luciferase reporter technology, a method that originally was used for circadian measurements by Geusz et al. 9. We here use SCN tissues from the transgenic knock-in PERIOD2::LUCIFERASE mice produced by Yoo et al. 10. The mice contain a fusion protein of PERIOD (PER) 2 and the firefly enzyme LUCIFERASE. When PER2 is translated in the presence of the substrate for luciferase, i.e. luciferin, the PER2 expression can be monitored as bioluminescence when luciferase catalyzes the oxidation of luciferin. The number of emitted photons positively correlates to the amount of produced PER2 protein, and the bioluminescence rhythms match the PER2 protein rhythm in vivo 10. In this way the cyclic variation in PER2 expression can be continuously monitored real time during many days. The protocol we follow for tissue culturing and real-time bioluminescence recording has been thoroughly described by Yamazaki and Takahashi 11.

The procedure of preparing slices containing the adult mouse hypothalamic suprachiasmatic nucleus (SCN), and a rapid way to culture the SCN tissue in organotypic culture condition, are reported. Further, the measurement of oscillatory clock gene protein expression using dynamic luciferase reporter technology is described.

A central circadian (~24 hr) clock coordinating daily rhythms in physiology and behavior resides in the suprachiasmatic nucleus (SCN) located in the ...

Simultaneous Electrophysiological Recording and Calcium Imaging of Suprachiasmatic Nucleus Neurons

Simultaneous electrophysiological and fluorescent imaging recording methods were used to study the role of changes of membrane potential or current in regulating the intracellular calcium concentration. Changing environmental conditions, such as the light-dark cycle, can modify neuronal and neural network activity and the expression of a family of circadian clock genes within the suprachiasmatic nucleus (SCN), the location of the master circadian clock in the mammalian brain. Excitatory synaptic transmission leads to an increase in the postsynaptic Ca2+ concentration that is believed to activate the signaling pathways that shifts the rhythmic expression of circadian clock genes. Hypothalamic slices containing the SCN were patch clamped using microelectrodes filled with an internal solution containing the calcium indicator bis-fura-2. After a seal was formed between the microelectrode and the SCN neuronal membrane, the membrane was ruptured using gentle suction and the calcium probe diffused into the neuron filling both the soma and dendrites. Quantitative ratiometric measurements of the intracellular calcium concentration were recorded simultaneously with membrane potential or current. Using these methods it is possible to study the role of changes of the intracellular calcium concentration produced by synaptic activity and action potential firing of individual neurons. In this presentation we demonstrate the methods to simultaneously record electrophysiological activity along with intracellular calcium from individual SCN neurons maintained in brain slices.

Procedures are described to perform simultaneous recordings of membrane potential or current and changes of intracellular calcium concentration. Suprachiasmatic nucleus neurons are filled with the calcium indicator bis-fura-2 using a patch clamp electrode in the whole cell patch clamp configuration.

Simultaneous electrophysiological and fluorescent imaging recording methods were used to study the role of changes of membrane potential or current in ...

Real-time Bioluminescence Imaging of Notch Signaling Dynamics during Murine Neurogenesis

Notch signaling regulates the maintenance of neural stem/progenitor cells by cell-cell interactions. The components of Notch signaling exhibit dynamic expression. Notch signaling effector Hes1 and the Notch ligand Delta-like1 (Dll1) are expressed in an oscillatory manner in neural stem/progenitor cells. Because the period of the oscillatory expression of these genes is very short (2 h), it is difficult to monitor their cyclic expression. To examine such rapid changes in the gene expression or protein dynamics, fast response reporters are required. Because of its fast maturation kinetics and high sensitivity, the bioluminescence reporter luciferase is suitable to monitor rapid gene expression changes in living cells. We used a destabilized luciferase reporter for monitoring the promoter activity and a luciferase-fused reporter for visualization of protein dynamics at single cell resolution. These bioluminescence reporters show rapid turnover and generate very weak signals; therefore, we have developed a highly sensitive bioluminescence imaging system to detect such faint signals. These methods enable us to monitor various gene expression dynamics in living cells and tissues, which are important information to help understand the actual cellular states.

Neural stem/progenitor cells exhibit various expression dynamics of Notch signaling components that lead to different outcomes of cellular events. Such dynamic expression can be revealed by real-time monitoring, not by static analysis, using a highly sensitive bioluminescence imaging system that enables visualization of rapid changes in gene expressions.

Notch signaling regulates the maintenance of neural stem/progenitor cells by cell-cell interactions. The components of Notch signaling exhibit dynamic ...

Developmental Biology

Single-cell Resolution Fluorescence Live Imaging of Drosophila Circadian Clocks in Larval Brain Culture

The circadian pacemaker circuit orchestrates rhythmic behavioral and physiological outputs coordinated with environmental cues, such as day/night cycles. The molecular clock within each pacemaker neuron generates circadian rhythms in gene expression, which underlie the rhythmic neuronal functions essential to the operation of the circuit. Investigation of the properties of the individual molecular oscillators in different subclasses of pacemaker neurons and their interaction with neuronal signaling yields a better understanding of the circadian pacemaker circuit. Here, we present a time-lapse fluorescent microscopy approach developed to monitor the molecular clockwork in clock neurons of cultured Drosophila larval brain. This method allows the multi-day recording of the rhythms of genetically encoded fluorescent circadian reporters at single-cell resolution. This setup can be combined with pharmacological manipulations to closely analyze real-time response of the molecular clock to various compounds. Beyond circadian rhythms, this multipurpose method in combination with powerful Drosophila genetic techniques offers the possibility to study diverse neuronal or molecular processes in live brain tissue.

Single-cell Resolution Fluorescence Live Imaging of Drosophila Circadian Clocks in Larval Brain Culture

The goal of this protocol is to establish ex vivo Drosophila larval brain culture optimized to monitor circadian molecular rhythms with long-term fluorescence time-lapse imaging. The application of this method to pharmacological assays is also discussed.

The circadian pacemaker circuit orchestrates rhythmic behavioral and physiological outputs coordinated with environmental cues, such as day/night cycles. ...

Monitoring Cell-autonomous Circadian Clock Rhythms of Gene Expression Using Luciferase Bioluminescence Reporters

In mammals, many aspects of behavior and physiology such as sleep-wake cycles and liver metabolism are regulated by endogenous circadian clocks (reviewed1,2). The circadian time-keeping system is a hierarchical multi-oscillator network, with the central clock located in the suprachiasmatic nucleus (SCN) synchronizing and coordinating extra-SCN and peripheral clocks elsewhere1,2. Individual cells are the functional units for generation and maintenance of circadian rhythms3,4, and these oscillators of different tissue types in the organism share a remarkably similar biochemical negative feedback mechanism. However, due to interactions at the neuronal network level in the SCN and through rhythmic, systemic cues at the organismal level, circadian rhythms at the organismal level are not necessarily cell-autonomous5-7. Compared to traditional studies of locomotor activity in vivo and SCN explants ex vivo, cell-based in vitro assays allow for discovery of cell-autonomous circadian defects5,8. Strategically, cell-based models are more experimentally tractable for phenotypic characterization and rapid discovery of basic clock mechanisms5,8-13.
Because circadian rhythms are dynamic, longitudinal measurements with high temporal resolution are needed to assess clock function. In recent years, real-time bioluminescence recording using firefly luciferase as a reporter has become a common technique for studying circadian rhythms in mammals14,15, as it allows for examination of the persistence and dynamics of molecular rhythms. To monitor cell-autonomous circadian rhythms of gene expression, luciferase reporters can be introduced into cells via transient transfection13,16,17 or stable transduction5,10,18,19. Here we describe a stable transduction protocol using lentivirus-mediated gene delivery. The lentiviral vector system is superior to traditional methods such as transient transfection and germline transmission because of its efficiency and versatility: it permits efficient delivery and stable integration into the host genome of both dividing and non-dividing cells20. Once a reporter cell line is established, the dynamics of clock function can be examined through bioluminescence recording. We first describe the generation of P(Per2)-dLuc reporter lines, and then present data from this and other circadian reporters. In these assays, 3T3 mouse fibroblasts and U2OS human osteosarcoma cells are used as cellular models. We also discuss various ways of using these clock models in circadian studies. Methods described here can be applied to a great variety of cell types to study the cellular and molecular basis of circadian clocks, and may prove useful in tackling problems in other biological systems.

Circadian clocks function within individual cells, i.e., they are cell-autonomous. Here, we describe methods for generating cell-autonomous clock models using non-invasive, luciferase-based real-time bioluminescence technology. Reporter cells provide tractable, functional model systems for studying circadian biology.

In mammals, many aspects of behavior and physiology such as sleep-wake cycles and liver metabolism are regulated by endogenous circadian clocks ...

Biology

Rapid Analysis of Circadian Phenotypes in Arabidopsis Protoplasts Transfected with a Luminescent Clock Reporter

The plant circadian clock allows the anticipation of daily changes to the environment. This anticipation aids the responses to temporally predictable biotic and abiotic stress. Conversely, disruption of circadian timekeeping severely compromises plant health and reduces agricultural crop yields. It is therefore imperative that we understand the intricate regulation of circadian rhythms in plants, including the factors that affect motion of the transcriptional clockwork itself.
Testing circadian defects in the model plant Arabidopsis thaliana (Arabidopsis) traditionally involves crossing specific mutant lines to a line rhythmically expressing firefly luciferase from a circadian clock gene promoter. This approach is laborious, time-consuming, and could be fruitless if a mutant has no circadian phenotype. The methodology presented here allows a rapid initial assessment of circadian phenotypes. Protoplasts derived from mutant and wild-type Arabidopsis are isolated, transfected with a rhythmically expressed luminescent reporter, and imaged under constant light conditions for 5 days. Luminescent traces will directly reveal whether the free-running period of mutant plants is different from wild-type plants. The advantage of the method is that any Arabidopsis line can efficiently be screened, without the need for generating a stably transgenic luminescent clock marker line in that mutant background.

The circadian clock regulates about a third of the Arabidopsis transcriptome, but the percentage of genes that feed back into timekeeping remains unknown. Here we visualize a method to rapidly assess circadian phenotypes in any mutant line of Arabidopsis using luminescent imaging of a circadian reporter transiently expressed in protoplasts.

The plant circadian clock allows the anticipation of daily changes to the environment. This anticipation aids the responses to temporally predictable ...

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder (ALLIGATOR)

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In circadian rhythms research, for example, clock gene fusions with firefly luciferase give rise to robust rhythms in cellular bioluminescence that persist over many days. Technical limitations associated with photomultiplier tubes (PMT) or conventional microscopy-based methods for bioluminescence quantification have typically demanded that cells and tissues be maintained under quite non-physiological conditions during recording, with a trade-off between sensitivity and throughput. Here, we report a refinement of prior methods that allows long-term bioluminescence imaging with high sensitivity and throughput which supports a broad range of culture conditions, including variable gas and humidity control, and that accepts many different tissue culture plates and dishes. This automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) also allows the observation of spatial variations in luciferase expression across a cell monolayer or tissue, which cannot readily be observed by traditional methods. We highlight how the ALLIGATOR provides vastly increased flexibility for the detection of luciferase activity when compared with existing methods.

Flexible Measurement of Bioluminescent Reporters Using an Automated Longitudinal Luciferase Imaging Gas- and Temperature-optimized Recorder ALLIGATOR

Genetically encoded luciferase is a popular non-invasive reporter of gene expression. Use of an automated longitudinal luciferase imaging gas- and temperature-optimized recorder (ALLIGATOR) enables longitudinal recording from bioluminescent cells under a wide range of conditions. Here we show how ALLIGATOR may be used in the context of circadian rhythms research.

Luciferase-based reporters of cellular gene expression are in widespread use for both longitudinal and end-point assays of biological activity. In ...

Optimizing Human Intestinal Enteroids for Circadian Rhythm Studies

Monitoring Circadian Oscillations with a Bioluminescence Reporter in Organoids

Most living organisms possess circadian rhythms, which are biological processes that occur within a period of approximately 24 h and regulate a diverse repertoire of cellular and physiological processes ranging from sleep-wake cycles to metabolism. This clock mechanism entrains the organism based on environmental changes and coordinates the temporal regulation of molecular and physiological events. Previously, it was demonstrated that autonomous circadian rhythms are maintained even at the single-cell level using cell lines such as NIH3T3 fibroblasts, which were instrumental in uncovering the mechanisms of circadian rhythms. However, these cell lines are homogeneous cultures lacking multicellularity and robust intercellular communications. In the past decade, extensive work has been performed on the development, characterization, and application of 3D organoids, which are in vitro multicellular systems that resemble in vivo morphological structures and functions. This paper describes a protocol for detecting circadian rhythms using a bioluminescent reporter in human intestinal enteroids, which enables the investigation of circadian rhythms in multicellular systems in vitro.

Author Spotlight: In Vitro Investigations of Circadian Rhythms in Multicellular Systems

Circadian rhythms, which exist in most organisms, regulate the temporal organization of biological processes. 3D organoids have recently emerged as a physiologically relevant in vitro model. This protocol describes the use of bioluminescent reporters to observe circadian rhythms in organoids, enabling in vitro investigations of circadian rhythms in multicellular systems.

Most living organisms possess circadian rhythms, which are biological processes that occur within a period of approximately 24 h and regulate a diverse ...

In Vivo Monitoring of Circadian Clock Gene Expression in the Mouse Suprachiasmatic Nucleus Using Fluorescence Reporters

Samenvatting

Meer video's verkennen