The authors thank Dr. M. Rubini (Konstanz, Germany) for providing the plasmid encoding pyrrolysyl-tRNA and for providing pRSFduet-pyrtRNAsynth encoding the corresponding aminoacyl-tRNA synthetase.

1. Production of the BMP2 Variant BMP2-K3Plk
<ol>
	<li>Cloning of BMP2-K3Plk by site-directed mutagenesis using PCR12
	<ol>
		<li>Amplify human mature BMP2 (hmBMP2) from a p25N-hmBMP2 vector (see Table of Materials) with a forward primer (5&#39; GACCAGGACATATGGCTCAAGCCTAGCACAAACAGC 3&#39;) and a reverse primer (5&#39; CCAGGAGGATCCTTAGCGACACCCACAACCCT 3&#39;) introducing an amber stop codon (TAG) at the position of the first lysine of BMP2&#180;s mature part. Perform the PCR reaction using 33.5 &#181;L of H2O, 10 &#181;L of PCR reaction mix, 1.5 &#181;L of 10 &#181;M dNTP stock solution, 1.5 &#181;L of forward primer (10 pmol/&#181;L), 1.5 &#181;L of reverse primer (10 pmol/&#181;L), 1 &#181;L of p25N-hmBMP2 (10 ng/&#181;L), and 1 &#181;L of DNA polymerase (see Table of Materials) in a thermal cycler (denaturation at 95 &#176;C for 5 min, 30 cycles of denaturation at 95 &#176;C for 1 min, annealing at 60 &#176;C for 1 min, elongation at 72 &#176;C for 1 min, and a final extension at 72 &#176;C for 10 min).</li>
		<li>Purify the PCR product using a commercially available kit following manufacturer recommendations (see Table of Materials).</li>
		<li>Digest the PCR product with the restriction enzyme NdeI at 37 &#176;C for 45 min using 16 &#181;L of H2O, 3 &#181;L of digestion buffer, 10 &#181;L of DNA (20 ng/&#181;L), and 1 &#181;L of restriction enzyme. Heat-inactivate the enzyme at 65 &#176;C for 5 min. Digest the PCR product with the restriction enzyme BamHI at 37 &#176;C for 1 h using 16 &#181;L of H2O, 3 &#181;L of digestion buffer, 10 &#181;L of DNA (20 ng/&#181;L), and 1 &#181;L of restriction enzyme. Heat-inactivate enzyme at 80 &#176;C for 5 min.</li>
		<li>Digest the pET11a-pyrtRNA vector with NdeI at 37 &#176;C for 2 h and 45 min using 16 &#181;L of H2O, 3 &#181;L of digestion buffer, 10 &#181;L of DNA (20 ng/ &#181;L), and 1 &#181;L of restriction enzyme. Heat-inactivate at 65 &#176;C for 5 min. Digest the pET11a-pyrtRNA vector with BamHI at 37 &#176;C for 1 h using 16 &#181;L of H2O, 3 &#181;L of digestion buffer, 10 &#181;L of DNA (20 ng/&#181;L), and 1 &#181;L of restriction enzyme. Heat-inactivate at 80 &#176;C for 5 min.</li>
		<li>Separate the digested vector from undigested vector and digestion remnants by agarose gel electrophoresis (0.8% agarose, 60 min at 100 V). Ligate the digested BMP2-K3TAG insert with digested pET11a-pyrtRNA backbone at room temperature (RT) for 2 h using 100 ng of pET11a-pyrtRNA backbone and 34.5 ng of BMP2-K3TAG insert (1:3 molar ratio). The reaction mixture contains the DNA backbone and insert, 2 &#181;L of ligase buffer, 1 &#181;L of DNA ligase, and H2O to a total volume of 20 &#181;L.</li>
		<li>Perform a co-transformation of pET11a-pyrtRNA-BMP2-K3Plk and pSRF-duet-pyrtRNAsynth in BL21(DE3) bacteria:
		<ol>
			<li>Add 50 ng of each plasmid to the bacteria, place the mixture on ice for 30 min, heat shock at 42 &#176;C for 50 s, place on ice for 5 min, add 500 &#181;L of Lysogeny Broth (LB) medium in the mixture, and shake at 300 rpm for 60 min.</li>
			<li>Spread 100 &#181;L of the bacterial mixture onto pre-warmed kanamycin (50 &#181;g/mL)/ampicillin (100 &#181;g/mL) plates, and incubate overnight at 37 &#176;C.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Expression and Purification of BMP2-K3Plk13,14
	<ol>
		<li>Propagate a single colony overnight in 50 mL of LB medium with 50 &#181;g/mL of kanamycin and 100 &#181;g/mL of ampicillin at 37 &#176;C.</li>
		<li>Dilute overnight cultures 1:20 into 800 mL of Terrific Broth (TB) medium supplemented with 50 &#181;g/mL of kanamycin and 100 &#181;g/mL of ampicillin, and grow at 37 &#176;C until an OD600 of 0.7 is reached. Add propargyl-L-lysine to a final concentration of 10 mM. Collect a 100 &#181;L sample from the culture before isopropyl &#946;-D-1-thiogalactopyranoside (IPTG) induction.</li>
		<li>Induce gene expression by the addition of IPTG to a final concentration of 1 mM. Grow the culture at 37 &#176;C for 16 h in an orbital shaker at 180 rpm. Collect a 100 &#181;L sample from the culture.</li>
		<li>Centrifuge the whole culture at 9000 x g for 30 min. Discard the supernatant, and resuspend the bacterial pellet in 30 mL of TBSE buffer (10 mM Tris, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA)) with 1:1000 (v/v) 2-mercaptoethanol (freshly added). 
		Caution: Handle 2-mercaptoethanol under the fume hood. Avoid contact with skin and eyes. Avoid inhalation of vapor or mist. Perform all the resuspension steps with buffers containing 2-mercaptoethanol under the fume hood.</li>
		<li>Weigh an empty centrifuge beaker and transfer the resuspended pellet into the empty beaker. Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the beaker with the pellet. Subtract the weight of the empty beaker to calculate the weight of the pellet. 
		NOTE: The protocol can be paused here. Freeze the pellet at -20 &#176;C in the short term or at -80 &#176;C in the long term. Upon resuming the protocol, thaw the pellet at RT.</li>
		<li>Resuspend the pellet in STE buffer (10 mM Tris pH 8.0; 150 mM NaCl; 1 mM EDTA, 375 mM sucrose; 1:1000 (v/v) 2-mercaptoethanol (freshly added)). Use 200 mL of STE buffer for every 10 g of pellet.</li>
		<li>Sonicate the suspension on ice (10 min with 40 s pulse, 20 s brake, and 30% amplitude). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet. Repeat the sonication and centrifugation steps 4 times.</li>
		<li>Resuspend the pellet in 100 mL of TBS buffer (10 mM Tris, 150 mM NaCl). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh pellet.</li>
		<li>Resuspend the pellet in nuclease buffer (100 mM Tris, 1 mM EDTA, 3 mM MgCl2) with freshly added 80 U/mL nuclease (e.g., Benzonase) using 10 mL/g of pellet. Incubate the suspension overnight at RT on a stirring plate (30 rpm).</li>
		<li>Add Triton buffer (60 mM EDTA, 1.5 M NaCl, 6% (v/v) 4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol) to the suspension. The volume of Triton buffer to add corresponds to a 0.5 volume part of the suspension. Incubate for 10 min at RT (no stirring). Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet.</li>
		<li>Resuspend the pellet in TE buffer (100 mM Tris, 20 mM EDTA) using 8 mL/g of pellet. Centrifuge at 6,360 x g for 20 min. Discard the supernatant and weigh the pellet.</li>
		<li>Resuspend the pellet by adding 4 mL/g of 25 mM NaAc pH 5.0 and 5 mL/g of of 6 M GuCl with 1 mM dithiothreitol (DTT) (freshly added). Incubate the suspension overnight at 4 &#176;C on a stirring plate (30 rpm).</li>
		<li>Centrifuge at 75,500 x g for 20 min. The supernatant now contains the unfolded monomeric BMP2 protein. Collect the supernatant and concentrate this extract to 20 OD/mL using a 3 kDa molecular weight cut-off (MWCO) membrane in a concentrating cell (see Table of Materials).</li>
		<li>Add the concentrated monomers in single drops to the Renaturation buffer (2 M LiCl, 50 mM Tris, 25 mM CHAPS, 5 mM EDTA, 1 mM glutathione disulfide (GSSG), 2 mM glutathione (GSH)) while stirring (30 rpm). Incubate at RT for 120 h in the dark. 
		NOTE: During this incubation period, refolding occours. The solution from this step onwards contains the folded dimeric BMP2-K3Plk.</li>
		<li>Adjust the pH of the solution to 3.0 using concentrated HCl. Dialyze the solution against 1 mM HCl. Concentrate the dialyzed solution using a 10 kDa molecular weight cut-off (MWCO) membrane in a concentrating cell.</li>
		<li>Equilibrate the solution by adding buffer A (20 mM NaAc, 30% isopropanol). Add a volume of buffer A corresponding to a 30% volume of the solution. Centrifuge the solution at 4700 x g for 15 min.</li>
		<li>Equilibrate the column for ion exchange on a fast protein liquid chromatography (FPLC) system15 with 150 mL of buffer A. Load the protein solution onto the equilibrated column. Elute fractions using a linear gradient of buffer B (20 mM NaAc, 30% isopropanol, 2 M NaCl) using 100 mL of buffer B. Collect 2 mL fractions. 
		NOTE: Concentrate the protein before loading to the column according to the total column volume. The final protein volume should be &#60;5% of the total column volume.</li>
		<li>Analyze 20 &#181;L of each fraction by SDS Polyacrylamide gel (12%) electrophoresis (SDS-PAGE) 16 and Coomassie Brilliant Blue staining17 (see Table of Materials). 
		NOTE: The Coomassie Brilliant Blue stained SDS-PAGE gel shows fractions containing dimers (26 kDa) and fractions containing monomers (13 kDa).</li>
		<li>Pool dimer-containing fractions. Dialyze the pool of dimer containing fractions overnight at 4 &#176;C against 1 mM HCl (5 liter volume). Concentrate the final product by using a 10 kDa concentrating centrifugal filter unit (see Table of Materials). Analyze the final product by SDS Polyacrylamide (12%) gel electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue staining. 
		NOTE: The band on the Coomassie Brilliant Blue stained SDS-PAGE gel should show only one band at 26 kDa. This is the final BMP2-K3Plk product.</li>
	</ol>
	</li>
</ol>
2. Optimization of Copper (I)-Catalyzed Alkyne-Azide Cycloaddition (CuAAC) Conditions
<ol>
	<li>Effect of sodium ascorbate (NaAsc) and copper (II) sulfate (CuSO 4 ) on wild type BMP2 (BMP2-WT)
	<ol>
		<li>Incubate 20 &#181;M BMP2-WT with different ratios of NaAsc to CuSO4. Use 0.5 mM NaAsc and 0.5 mM CuSO4 (starting concentration) in a 50 &#181;L volume. Proceed with the following ratios of NaAsc to CuSO4: (1:1), (1.7:1), (10:1), (20: 1), keeping the CuSO4 concentration constant at 0.5 mM and adjusting the concentration of NaAsc accordingly. Perform the reaction in H2O on a rotating mixer (20 rpm) overnight at RT.</li>
		<li>Prepare reduced samples by adding loading buffer containing 5% 2-mercaptoethanol and incubate sample at 95 &#176;C for 6 min. Analyze reduced and non-reduced samples by SDS Polyacrylamide gel (12%) electrophoresis (SDS-PAGE) and Coomassie Brilliant Blue staining. The Coomasie stained SDS-PAGE gels show bands in the range of 13 kDa (reduced conditons) to 26 kDa and higher molecular weight (non-reduced conditions).</li>
	</ol>
	</li>
	<li>Effect of Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA) on the CuAAC Reaction
	<ol>
		<li>Incubate 20 &#181;M BMP2-K3Plk with different ratios of THPTA to CuSO4. Use 5 mM NaAsc, and 200 &#181;M 3-Azido-7-hydroxycoumarin (keep NaAsc and 3-Azido-7-hydroxycoumarin constant). Use 50 &#181;M THPTA and 0.5 mM of CuSO4 as starting concentrations. Use different ratios of THPTA to CuSO4: (7:1); (10:1); (12:1); (15:1); (20:1). Perform reaction in H2O (50 &#181;L total volume) for 24 h at RT on a rotating mixer (20 rpm).</li>
		<li>Upon coupling, 3-Azido-7-hydroxycoumarin becomes a fluorescent dye. Prepare samples in reduced and non-reduced conditions and analyze them by SDS-PAGE. Visualize the gels under the excitation channel with the specific wavelength for the 3-Azido-7-hydroxycoumarin (&#955;abs = 404 nm; &#955;em = 477 nm).</li>
	</ol>
	</li>
</ol>
3. Covalent Coupling Technique of BMP2-K3Plk to Azide Functionalized Agarose Beads
<ol>
	<li>Incubate 20 &#181;M of BMP2-K3Plk or BMP2-WT (used as negative control) with 20 &#181;L of azide-activated agarose beads in a total volume of 500 &#181;L in reaction buffer (0.1 M HEPES pH 7.0, 3.9 M urea, 50 &#181;M CuSO4, 250 &#181;M THPTA, 5 mM sodium ascorbate) for 2 h at RT on a rotating mixer (20 rpm). Stop the reaction by adding 5 mM EDTA (final concentration).</li>
	<li>Incubate at RT for 15 min on a rotating mixer (20 rpm). Centrifuge samples at 20,000 x g for 1 min at RT. Collect the supernatants.</li>
	<li>Wash the pellet containing the beads three times with 1,000 &#181;L of HBS500 buffer (50 mM HEPES, 500 mM NaCl), three times with 1,000 &#181;L of 4 M MgCl2, and two times with 1,000 &#181;L of phosphate buffered saline (PBS). At every washing step, centrifuge at 20,000 x g for 1 min at RT and collect supernatants. Store coupled beads in 1,000 &#181;L of PBS at 4 &#176;C. 
	Caution: Do not disturb the bead pellet while removing the supernatant.</li>
</ol>
4. Validating the Presence and Biological Activity of Immobilized BMP2-K3Plk Using Texas Red Labeled BMP Receptor I A Ectodomain (BMPR-IA EC )
<ol>
	<li>Incubate 50 &#181;L of the BMP2-K3Plk functionalized beads with 1 &#181;M of Texas Red labeled BMPR-IAEC with 150 &#181;L of HBS500 buffer (50 mM HEPES, 500 mM NaCl) at RT for 1 h on a rotating mixer (20 rpm).</li>
	<li>Centrifuge the beads at 20,000 x g for 1 min at RT. Discard the supernatant. Wash the beads with 1000 &#181;L of HBS500 buffer. Repeat the washing step an additional 3 times. Centrifuge at 20,000 x g for 1 min at RT after each washing step.</li>
	<li>Resuspend the beads in 500 &#181;L of PBS and pipette 50 &#181;L on a glass cover slide. Set the microscope filter between 561 or 594 nm. Detect Texas Red&#8211;BMPR-IAEC&#8211;BMP2-K3Plk functionalized beads using fluorescent microscopy and take pictures.</li>
</ol>
5. Measuring Alkaline phosphatase (ALP) Expression to Prove the In Vitro Bioactivity of the Produced BMP2-K3Plk Before and After the Coupling Reaction.
<ol>
	<li>Alkaline phosphatase (ALP) assay
	<ol>
		<li>Culture promyoblastic C2C12 cells (ATCC CRL-172) in Dulbecco&#39;s Modified Eagle&#39;s Medium (DMEM) with 10% Fetal Calf Serum (FCS), 100 U/mL penicillin G and 100 &#181;g/mL streptomycin at 37 &#176;C in a humidified atmosphere at 5% CO2.</li>
		<li>Seed C2C12 cells at a density of 3 &#215; 104 cells/well into a 96-well microplate. Let cells attach overnight. Remove medium and incubate C2C12 cells in the presence of 0.5-200 nM of BMP2-WT or BMP2-K3Plk in 100 &#181;L/well of DMEM (2% FCS, 100 U/mL penicillin G and 100 &#181;g/mL streptomycin) at 37 &#176;C in a humidified atmosphere at 5% CO2 for 72 h.</li>
		<li>Remove medium and wash cells with 100 &#181;L of PBS per well. Lyse cells at RT for 1 h with 100 &#181;L/well of lysis buffer (1% NP-40, 0.1 M glycine, pH 9.6, 1 mM MgCl2, 1 mM ZnCl2) on a shaking plate (220 rpm).</li>
		<li>Add 100 &#181;L/well of ALP buffer (0.1 M glycine, pH 9.6, 1 mM MgCl2, 1 mM ZnCl2) with 1 mg/mL p-nitrophenylphosphate (freshly added) to the cell lysate.</li>
		<li>Measure absorption at 405 nm in a multiplate reader after adding the ALP buffer, and every 5 min until the development of the color is complete. Generate dose response curves and EC50 values using a logistic model, y = A2 + (A1-A2)/(1 + (x/x0)p).</li>
	</ol>
	</li>
	<li>Alkaline phosphatase (ALP) staining 
	<ol>
		<li>Culture promyoblastic C2C12 cells (ATCC CRL-172) in Dulbecco&#39;s Modified Eagle Medium (DMEM) with 10% Fetal Calf Serum (FCS), 100 U/mL penicillin G and 100 &#181;g/mL streptomycin at 37 &#176;C in a humidified atmosphere at 5% CO2.</li>
		<li>Seed C2C12 cells at a density of 3 &#215; 104 cells/well in a 96-well microplate. Let cells attach overnight. Remove medium and add 20 &#181;L/well of BMP2-K3Plk coupled beads. BMP2-K3Plk coupled beads are in 1000 &#181;L of a PBS suspension.</li>
		<li>Prepare a solution of 0.4% low-melting-point agarose in DMEM. Melt in the microwave (600 W for 3 min) and let it cool down in a water bath at 37 &#176;C until use.</li>
		<li>Add 20 &#181;L of 0.4% low-melting-point agarose in each well (covering beads and cells). Centrifuge at 2000 x g for 5 min at 20 &#176;C. Add 80 &#181;L DMEM (2% FCS, 100 U/mL penicillin G and 100 &#181;g/mL streptomycin) and incubate at 37 &#176;C in a humidified atmosphere at 5% CO2 for 72 h.</li>
		<li>Remove medium, being careful not to detach the solidified 0.4% agarose. Add 100 &#181;L/well of 1-Step NBT/BCIP (Nitro-blue tetrazolium chloride, 5-bromo-4-chloro-3&#39;-indolyphosphate p-toluidine salt) substrate solution.</li>
		<li>Analyze alkaline phosphatase staining using light microscopy immediately after the purple staining becomes apparent. Use bright field microscopy and take pictures.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Giannoudis, P. V., Dinopoulos, H., Tsiridis, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+substitutes:+An+update.">Bone substitutes: An update.</a> Injury. 36, S20-S27 (2005).</li><li>Oryan, A., Alidadi, S., Moshiri, A., Bigham-Sadegh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bone+morphogenetic+proteins:+A+powerful+osteoinductive+compound+with+non-negligible+side+effects+and+limitations.">Bone morphogenetic proteins: A powerful osteoinductive compound with non-negligible side effects and limitations.</a> Biofactors. 40 (5), 459-481 (2014).</li><li>Luginbuehl, V., Meinel, L., Merkle, H. P., Gander, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localized+delivery+of+growth+factors+for+bone+repair.">Localized delivery of growth factors for bone repair.</a> Eur J Pharm Biopharm. 58 (2), 197-208 (2004).</li><li>Haidar, Z. S., Hamdy, R. C., Tabrizian, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+recombinant+bone+morphogenetic+proteins+for+bone+regeneration+and+repair.+Part+A:+Current+challenges+in+BMP+delivery.">Delivery of recombinant bone morphogenetic proteins for bone regeneration and repair. Part A: Current challenges in BMP delivery.</a> Biotechnol Lett. 31 (12), 1817-1824 (2009).</li><li>Hollinger, J. O., Uludag, H., Winn, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sustained+release+emphasizing+recombinant+human+bone+morphogenetic+protein-2.">Sustained release emphasizing recombinant human bone morphogenetic protein-2.</a> Adv Drug Deliv Rev. 31 (3), 303-318 (1998).</li><li>Uludag, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Implantation+of+recombinant+human+bone+morphogenetic+proteins+with+biomaterial+carriers:+A+correlation+between+protein+pharmacokinetics+and+osteoinduction+in+the+rat+ectopic+model.">Implantation of recombinant human bone morphogenetic proteins with biomaterial carriers: A correlation between protein pharmacokinetics and osteoinduction in the rat ectopic model.</a> J Biomed Mater Res. 50 (2), 227-238 (2000).</li><li>Uludag, H., Golden, J., Palmer, R., Wozney, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biotinated+bone+morphogenetic+protein-2:+In+vivo+and+in+vitro+activity.">Biotinated bone morphogenetic protein-2: In vivo and in vitro activity.</a> Biotechnol Bioeng. 65 (6), 668-672 (1999).</li><li>Aono, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Potent+ectopic+bone-inducing+activity+of+bone+morphogenetic+protein-4/7+heterodimer.">Potent ectopic bone-inducing activity of bone morphogenetic protein-4/7 heterodimer.</a> Biochem Biophys Res Commun. 210 (3), 670-677 (1995).</li><li>Suzuki, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alginate+hydrogel+linked+with+synthetic+oligopeptide+derived+from+BMP-2+allows+ectopic+osteoinduction+in+vivo.">Alginate hydrogel linked with synthetic oligopeptide derived from BMP-2 allows ectopic osteoinduction in vivo.</a> J Biomed Mater Res. 50 (3), 405-409 (2000).</li><li>Knaus, P., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cooperativity+of+binding+epitopes+and+receptor+chains+in+the+BMP/TGFbeta+superfamily.">Cooperativity of binding epitopes and receptor chains in the BMP/TGFbeta superfamily.</a> Biol Chem. 382 (8), 1189-1195 (2001).</li><li>Wang, L., Xie, J., Schultz, P. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expanding+the+genetic+code.">Expanding the genetic code.</a> Annu Rev Biophys Biomol Struct. 35, 225-249 (2006).</li><li>Costa, G. L., Weiner, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+PCR+site-directed+mutagenesis.">Rapid PCR site-directed mutagenesis.</a> CSH Protoc. 2006 (1), (2006).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+recombinant+BMP+receptor+IA+ectodomain+and+its+2:1+complex+with+BMP-2.">Isolation of recombinant BMP receptor IA ectodomain and its 2:1 complex with BMP-2.</a> FEBS Lett. 468 (2-3), 215-219 (2000).</li><li>Tabisz, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Site-directed+immobilization+of+BMP-2:+Two+approaches+for+the+production+of+innovative+osteoinductive+scaffolds.">Site-directed immobilization of BMP-2: Two approaches for the production of innovative osteoinductive scaffolds.</a> Biomacromolecules. 18 (3), 695-708 (2017).</li><li>Duong-Ly, K. C., Gabelli, S. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+ion+exchange+chromatography+to+purify+a+recombinantly+expressed+protein.">Using ion exchange chromatography to purify a recombinantly expressed protein.</a> Methods Enzymol. 541, 95-103 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-dimensional+SDS-polyacrylamide+gel+electrophoresis+(1D+SDS-PAGE).">One-dimensional SDS-polyacrylamide gel electrophoresis (1D SDS-PAGE).</a> Methods Enzymol. 541, 151-159 (2014).</li><li>Brunelle, J. L., Green, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Coomassie+blue+staining.">Coomassie blue staining.</a> Methods Enzymol. 541, 161-167 (2014).</li><li>Kirsch, T., Nickel, J., Sebald, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMP-2+antagonists+emerge+from+alterations+in+the+low-affinity+binding+epitope+for+receptor+BMPR-II.">BMP-2 antagonists emerge from alterations in the low-affinity binding epitope for receptor BMPR-II.</a> EMBO J. 19 (13), 3314-3324 (2000).</li><li>Hein, J. E., Fokin, V. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Copper-catalyzed+azide-alkyne+cycloaddition+(CuAAC)+and+beyond:+new+reactivity+of+copper(I)+acetylides.">Copper-catalyzed azide-alkyne cycloaddition (CuAAC) and beyond: new reactivity of copper(I) acetylides.</a> Chem Soc Rev. 39 (4), 1302-1315 (2010).</li><li>Alborzinia, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+kinetics+analysis+of+BMP2+uptake+into+cells+and+its+modulation+by+BMP+antagonists.">Quantitative kinetics analysis of BMP2 uptake into cells and its modulation by BMP antagonists.</a> J Cell Sci. 126 (Pt 1), 117-127 (2013).</li><li>Paarmann, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamin-dependent+endocytosis+of+Bone+Morphogenetic+Protein2+(BMP2)+and+its+receptors+is+dispensable+for+the+initiation+of+Smad+signaling.">Dynamin-dependent endocytosis of Bone Morphogenetic Protein2 (BMP2) and its receptors is dispensable for the initiation of Smad signaling.</a> Int J Biochem Cell Biol. 76, 51-63 (2016).</li><li>Pohl, T. L., Boergermann, J. H., Schwaerzer, G. K., Knaus, P., Cavalcanti-Adam, E. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+immobilization+of+bone+morphogenetic+protein+2+via+a+self-assembled+monolayer+formation+induces+cell+differentiation.">Surface immobilization of bone morphogenetic protein 2 via a self-assembled monolayer formation induces cell differentiation.</a> Acta Biomater. 8 (2), 772-780 (2012).</li></ol>

The authors declare no competing financial interests.

Generating tagged protein variants by genetic codon expansion allows the introduction of various non-natural amino acid analogs principally at any position of the primary protein sequence. In case of BMPs like BMP2, common tags such as a 6-Histidine (His) tag can only be introduced N-terminally, since the protein&#180;s C-terminal end is buried within the tertiary protein structure, and is thus not accessible from the outside. At other positions, the size of the introduced tag may very likely cause structural alterations that consequently obliterate the BMP&#180;s bioactivity. Further, introducing a mutation into the BMP2 sequence can affect the refolding efficacy, and can also change other protein parameters such as the isoelectric point of the modified protein. Thus, every single step in an established protein production protocol might need to be adapted according to the altered protein variant&#180;s characteristics. The production of the BMP2-K3Plk indeed required a modification of the established method for the expression of wild type BMP2. Different culture times or propargyl-L-lysine (Plk) concentrations were tested (data not shown) in order to reach the highest expression yield. Refolding, separation and purification steps fortunately did not require further adaptions. We have already reported that in case of other BMP2 variants produced in our lab, some protein characteristics were altered significantly, which required the modification of several steps of the BMP production method18. The produced BMP2-K3Plk showed biological activity comparable to that of the wild type protein. A difference occurs at high BMP2 concentrations, probably as a consequence of a lower solubility of the BMP2-K3Plk variant in medium compared to that of wild type BMP2.
Despite the known advantages of copper-catalyzed azide-alkyne cycloaddition (CuAAC)19, CuAAC reactions should be carefully adapted to particular applications. We showed how BMP2 can be fragmented or create aggregates or multimers due to the strong reducing reaction conditions. Thus, all reaction parameters had to be analyzed in detail in order to find conditions that leave the protein unaffected.
Our approach to covalently couple the BMP2 variant to azide-functionalized agarose beads by click chemistry could be realized with high efficiency resulting in functionalized beads triggering osteogenic differentiation in vitro. When wild type BMP2 protein was used in the reaction with the beads instead, we could observe only weak staining of ALP expression, indicating that coupling indeed occurred highly specifically via the propargyl-L-lysin residue of BMP2-K3Plk.
This positional coupling specificity reflects a great improvement compared to the immobilization procedures involving classical NHS/EDC chemistry. In such cases, random coupling occurs, mainly involving the primary amine groups present in lysine residues. The coupled protein has a variable osteogenic activity, due to the multiplicity of possible connections to the scaffold, leading to different orientations of the protein towards cell receptors.
The use of site-direct immobilized BMP2 might overcome the mentioned drawbacks related to the high doses of soluble BMP2, which are needed to induce bone formation. In addition, the results clearly show that certain cellular responses, such as the osteogenic differentiation of C2C12 cells, are entirely initiated by immobilized BMP2, despite recent studies claiming that signal transduction requires endocytosis of the ligand/ligand-receptor complex20,21. Our findings are in agreement with other studies demonstrating that BMP2, which is coupled covalently (but not site-directed) to non-endocytosable surfaces, is still able to induce osteoblast differentiation22.
Considering that we have used supra-physiological concentrations of BMP2 for the coupling reaction, the amount of the immobilized BMP2 might be further reduced while still conserving the osteogenic properties of the beads. Prior to such optimization steps, however, the BMP2-K3Plk-functionalized scaffold needs to be tested in animal experiments to prove its osteogenic potential in vivo.

The ultimate goal of bone tissue engineering and bone regeneration is to overcome the disadvantages and limitations occurring during common treatments of non-union fractures. Auto- or allo-transplantations are predominantly used as current therapy strategies, even though they both have several drawbacks. The ideal bone graft should induce osteogenesis by osteoinduction as well as osteoconduction, leading to the osteointegration of the graft into the bone. Nowadays, only auto-transplantation is considered as the &#34;gold standard&#34; since it provides all characteristics of an ideal bone graft. Unfortunately, it also presents important negative aspects, such as long surgery times, and a second trauma site that usually entails more complications (e.g., chronic pain, hematoma formations, infections, cosmetic defects, etc.). Allogenic grafts, on the other hand have suboptimal characteristics for all general aspects1. Alternative bone graft technologies have been improved in the last few years, with the aim to produce scaffolds that are osteoinductive, osteoconductive, biocompatible, and bioresorbable. Since many biomaterials do not show all of these osteogenic characteristics, different growth factors, mainly BMP2 and BMP7, have been incorporated in order to improve the osteogenic potential of the particular scaffold2.
As an essential criterion, such growth factor delivery systems should provide a controlled dose release over time in order to facilitate the essential events like cell recruitment and attachment, cell ingrowth, and angiogenesis. However, BMPs as well as other osteogenic growth factors have been commonly immobilized non-covalently3. Entrapment and adsorption techniques require the use of supra-physiological amounts of protein due to an initial burst release, which leads to severe disadvantages in vivo, typically affecting the surrounding tissues by inducing bone overgrowth, osteolysis, swelling, and inflammation4. Thus, the retention of growth factors at the delivery site for longer periods of time can be achieved by covalent immobilization methods. Chemically modified BMP2 (succinylated5, acetylated6 or biotinylated7), engineered heterodimers8, or BMP2 derived oligopeptides9 have been designed and used to overcome the limitations related to absorption. However, the bio-activity of these constructs is not predictable since the arrangement potentially inhibits the binding of the immobilized ligand to the cellular receptors. As previously shown, it is essential that all four receptor chains involved in the formation of activated ligand-receptor complexes interact with the immobilized BMP2 in order to fully activate all downstream signaling cascades10.
To overcome the problems of an inhomogeneous product outcome with limitations in terms of bioactivity, stability, and bioavailability of the immobilized factor, we designed a BMP variant capable of covalently binding scaffolds in a site-directed manner. This variant, termed BMP2-K3Plk, comprises an artificial amino acid which was introduced by genetic codon expansion11. This variant has been successfully linked to scaffolds using a covalent coupling strategy while maintaining its biological activity.

<table><tbody><tr><td>&lt;strong&gt;Material&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>1-Step NBT/BCIP</td><td>Thermo Fisher</td><td>34042</td><td>Add solution to cells</td></tr><tr><td>3-Azido-7-hydroxycoumarin</td><td>BaseClick</td><td>BCFA-047-1</td><td>Chemical used for click reaction</td></tr><tr><td>Agarose low melting point</td><td>Biozym</td><td>840101</td><td>Agarose for ALP assay&amp;nbsp;</td></tr><tr><td>Azide agarose beads</td><td>Jena Bioscience</td><td>CLK-1038-2</td><td>Beads used for reaction</td></tr><tr><td>BamHI (Fast Digest enzyme)</td><td>Thermo Fisher Scientific</td><td>FD0054</td><td>Restriction enzyme</td></tr><tr><td>BMP receptor IA (BMPR-IA&lt;sub&gt;EC)&lt;/sub&gt;</td><td>--</td><td>--</td><td>Produced in our lab</td></tr><tr><td>Coomassie Brilliant Blue G-250 Dye</td><td>Thermo Fisher Scientific</td><td>20279</td><td>Chemical used for Coomassie Brilliant blue staining of SDS PAGE</td></tr><tr><td>Copper (II) sulfate anhydrous (CuSO&lt;sub&gt;4&lt;/sub&gt;)</td><td>Alfa Aesar</td><td>A13986</td><td>Chemical used for click reaction</td></tr><tr><td>DNA Polymerase and reaction buffer&amp;nbsp;</td><td>Kapabiosystems</td><td>KK2102</td><td>KAPA HiFi PCR Kit</td></tr><tr><td>Dulbecco&amp;rsquo;s modified Eagle&amp;rsquo;s medium (DMEM) GlutaMAX</td><td>Gibco</td><td>61965-026</td><td>Cell culture media</td></tr><tr><td>ethylenediaminetetraacetic acid (EDTA)</td><td>Sigma Aldrich GmbH</td><td>E5134-1kg</td><td>Chemical used to stop click reaction</td></tr><tr><td>Isopropyl &amp;szlig;-D-1-thiogalactopyranoside (IPTG)</td><td>Carl Roth GmbH</td><td>2316.5</td><td>Bacteria induction (1mM final concentration)&amp;nbsp;</td></tr><tr><td>NdeI (Fast Digest enzyme)</td><td>Thermo Fisher Scientific</td><td>ER0581</td><td>Restriction enzyme</td></tr><tr><td>NHS-activated Texas Red</td><td>Life technologies</td><td>T6134</td><td>Coupled to receptor</td></tr><tr><td>P- Nitrophenyl Phosphate</td><td>Sigma Aldrich GmbH</td><td>N4645-1G</td><td>Alkaline Phosphatase</td></tr><tr><td>p25N-hmBMP2&amp;nbsp;</td><td>--</td><td>--</td><td>Plasmid kindly provided from Walter Sebald to J. Nickel</td></tr><tr><td>pET11a-pyrtRNA</td><td>--</td><td>--</td><td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td></tr><tr><td>propargyl-L-lysine (Plk)</td><td>--</td><td>--</td><td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td></tr><tr><td>pSRFduet-pyrtRNAsynth</td><td>--</td><td>--</td><td>Provided by the Chair for Pharmaceutics and Biopharmacy, University Wuerzburg</td></tr><tr><td>Qiagen Gel Extraction Kit</td><td>Qiagen</td><td>28704</td><td>Gel Purification</td></tr><tr><td>Qiagen PCR purification Kit</td><td>Qiagen</td><td>28104</td><td>PCR Purification&amp;nbsp;</td></tr><tr><td>Sodium L-ascorbate</td><td>Sigma Aldrich GmbH</td><td>A7631-100G</td><td>Chemical used for click reaction</td></tr><tr><td>T4 DNA Ligase</td><td>ThermoScientific</td><td>EL0011</td><td>Ligation&amp;nbsp;</td></tr><tr><td>tris(3-hydroxypropyltriazolylmethyl)amine (THPTA)</td><td>BaseClick</td><td>BCMI-006-100</td><td>Chemical used for click reaction</td></tr><tr><td>4-(1,1,3,3-Tetramethylbutyl)phenyl-polyethylene glycol</td><td>Sigma Aldrich GmbH</td><td>X100-1L</td><td>Triton X 100&amp;nbsp;</td></tr><tr><td>&lt;strong&gt;Name&lt;/strong&gt;</td><td>&lt;strong&gt;Company&lt;/strong&gt;</td><td>&lt;strong&gt;Catalog Number&lt;/strong&gt;</td><td>&lt;strong&gt;Comments&lt;/strong&gt;</td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Amicon concentrating cell 400 ml&amp;nbsp;</td><td>Merck KGaA</td><td>UFSC40001</td><td>Concentrating unit</td></tr><tr><td>Amicon Ultra-15 Centrifugal Filter Units</td><td>Merck KGaA</td><td>UFC901024</td><td>Concentrating centrifugal unit</td></tr><tr><td>&amp;Auml;KTA avant FPLC</td><td>&amp;Auml;KTA</td><td>--</td><td>FPLC machine</td></tr><tr><td>Avanti J-26XP</td><td>Beckman Coulter&amp;nbsp;</td><td>393124</td><td>Centrifuge for bacterial culture</td></tr><tr><td>Bacterial Shaking Incubator</td><td>Infors HT</td><td></td><td>Shaking incubator for bacterial culture</td></tr><tr><td>FluorChem Q system</td><td>proteinsimple</td><td>--</td><td>Imaging and analysis system for SDS-PAGE</td></tr><tr><td>Fluorescent miscroscope</td><td>Keyence</td><td>BZ-9000 (BIOREVO)</td><td></td></tr><tr><td>Fractogel&amp;reg; EMD SO&lt;sub&gt;3&lt;/sub&gt;&lt;sup&gt;-&lt;/sup&gt; (M)</td><td>Merck KGaA</td><td>116882</td><td>Ion Exchange Chromatography column material</td></tr><tr><td>Greiner CELLSTAR&amp;reg;&amp;nbsp;96 well plates</td><td>Sigma</td><td>M5811-40EA</td><td>96 well plates for cell culture (ALP Assay)</td></tr><tr><td>Heraeus Multifuge X1R</td><td>ThermoScientific</td><td>--</td><td>Centrifuge</td></tr><tr><td>M-20 Microplate Swinging Bucket Rotor</td><td>ThermoScientific</td><td>75003624</td><td>Rotor for Microcentrifuge for plate during ALP staining</td></tr><tr><td>Microcentrifuge - 5417R</td><td>Eppendorf</td><td>--</td><td>Centrifuge</td></tr><tr><td>OriginPro 9.1 G&amp;nbsp;</td><td>OriginLab</td><td>--</td><td>software for stastic analysis of ALP assay data</td></tr><tr><td>Polysine Slides</td><td>ThermoScientific</td><td>10143265</td><td>microscope slides</td></tr><tr><td>Rotor JA-10</td><td>Beckman Coulter&amp;nbsp;</td><td>--</td><td>rotor for Avanti J-26XP centrifuge</td></tr><tr><td>Rotor JLA 8.1</td><td>Beckman Coulter&amp;nbsp;</td><td>--</td><td>rotor for Avanti J-26XP centrifuge</td></tr><tr><td>Rotor JA 25.50</td><td>Beckman Coulter&amp;nbsp;</td><td>--</td><td>rotor for Avanti J-26XP centrifuge</td></tr><tr><td>Tecan infinite M200 multiplate reader</td><td>Tecan Deutschland GmbH</td><td>--</td><td>Multiplate reader for ALP assay</td></tr><tr><td>Thermocycler - Labcycler Gradient</td><td>SensoQuest GmbH</td><td>--</td><td>PCR</td></tr><tr><td>TxRed - microscope filter</td><td>Keyence</td><td></td><td>Filter for fluorescent microscope&amp;nbsp;</td></tr><tr><td>Ultrafiltration regenerated cellulose discs 3 kDa</td><td>Merck KGaA</td><td>PLBC04310</td><td>used with amicon concentrating cell 400ml</td></tr><tr><td>Ultrafiltration regenerated cellulose discs 10 kDa</td><td>Merck KGaA</td><td>PLGC04310</td><td>used with amicon concentrating cell 400ml</td></tr></tbody></table>

site-directed immobilization of bone morphogenetic protein 2 to solid surfaces by click chemistry

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present several limitations that have led to the use of biomaterials in combination with osteogenic growth factors, such as bone morphogenetic proteins (BMPs). Commonly used absorption or encapsulation methods require supra-physiological amounts of BMP2, typically resulting in a so-called initial burst release effect that provokes several severe adverse side effects. A possible strategy to overcome these problems would be to covalently couple the protein to the scaffold. Moreover, coupling should be performed in a site-specific manner in order to guarantee a reproducible product outcome. Therefore, we created a BMP2 variant, in which an artificial amino acid (propargyl-L-lysine) was introduced into the mature part of the BMP2 protein by codon usage expansion (BMP2-K3Plk). BMP2-K3Plk was coupled to functionalized beads through copper catalyzed azide-alkyne cycloaddition (CuAAC). The biological activity of the coupled BMP2-K3Plk was proven in vitro and the osteogenic activity of the BMP2-K3Plk-functionalized beads was proven in cell based assays. The functionalized beads in contact with C2C12 cells were able to induce alkaline phosphatase (ALP) expression in locally restricted proximity of the bead. Thus, by this technique, functionalized scaffolds can be produced that can trigger cell differentiation towards an osteogenic lineage. Additionally, lower BMP2 doses are sufficient due to the controlled orientation of site-directed coupled BMP2. With this method, BMPs are always exposed to their receptors on the cell surface in the appropriate orientation, which is not the case if the factors are coupled via non-site-directed coupling techniques. The product outcome is highly controllable and, thus, results in materials with homogeneous properties, improving their applicability for the repair of critical size bone defects.

In this article, we describe a method to covalently couple a new BMP2 variant, BMP2-K3Plk, to commercially available azide functionalized agarose beads (Figure 1). The bioactivity of the produced BMP2-K3Plk variant was validated by the induction of alkaline phosphatase (ALP) gene expression in C2C12 cells. The in vitro test shows similar ALP expression levels induced by wild type BMP2 (BMP2-WT) and BMP2-K3Plk (Figure 2).
The redox reactions between copper (II) sulfate (CuSO4) and sodium ascorbate (NaAsc) generate reactive oxygen species that might affect the structural integrity and thus affect the bioactivity of BMP2-K3Plk. To verify the structural integrity of the protein, we performed an overnight incubation with CuSO4 and NaAsc, showing BMP2-WT degradation in a concentration-dependent manner (visualized by SDS-PAGE under reduced conditions (Figure 3A1)) and the formation of multimers or aggregates visible at approximately 40 kDa (under non-reduced conditions) (Figure 3A2). To avoid protein degradation, Tris(3-hydroxypropyltriazolyl-methyl)amine (THPTA) was used as a protective agent (Figure 3B). The use of THPTA prevents BMP2 fragmentation, while the formation of higher molecular weight structures could not be prevented by the addition of THPTA. Further improvements of the reaction addressed the composition of the reaction buffer, the reaction temperature, and reaction time (data not shown). The protocol described here details the final achievements regarding reaction buffer composition, temperature, and reaction time.
To confirm that BMP2-K3Plk retains bioactivity after coupling, we used fluorescently labeled receptor ectodomain protein of the type I receptor (BMPR-IAEC) to demonstrate that the immobilized protein is still able to bind to this receptor. Beads coated with BMP2-K3Plk via CuAAC chemistry yielded fluorescence when incubated with the dye-labeled BMPR-IAEC (Figure 4). In contrast, non-coated beads or beads that were incubated with BMP2-WT showed no fluorescence signal above background levels (data not shown)14.
After confirming receptor binding capabilities of the immobilized ligand in vitro, we also tested whether biological responses can be triggered by the functionalized beads in a cell-based assay. ALP mediated staining occurred only in those cells which were in direct contact with the BMP2-K3Plk-functionalized beads (Figure 5). This confirms that the protein is indeed covalently linked to the beads and not just absorbed, since a more spread-out staining at larger distances to the beads would otherwise have been observed.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56616/56616fig1.jpg" /> 
Figure 1: Depiction of BMP2-K3Plk. (A) Depiction of the BMP2-K3Plk variant with the localization of the introduced amino acid substitution. (B) Coupling scheme: BMP2-K3Plk CuAAC reaction with azide functionalized beads. Reprinted (adapted) with permission from Tabisz et al. (2017): Site-Directed Immobilization of BMP-2: Two Approaches for the Production of Innovative Osteoinductive Scaffolds. Biomacromolecules. 18 (3), 695-708. (Copyright 2017 American Chemical Society) <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56616/56616fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56616/56616fig2.jpg" /> 
Figure 2: Bioactivity of BMP2-variants. Comparison of the bioactivities (ALP assay) of BMP2-K3Plk and wildtype BMP2 (BMP2-WT). The x-axis represents the concentration of BMP2-WT or BMP2-K3Plk used in the assay. The EC50 data represent mean values and standard deviations of 4 individual experiments (N=4). Reprinted (adapted) with permission from Tabisz et al. (2017): Site-Directed Immobilization of BMP-2: Two Approaches for the Production of Innovative Osteoinductive Scaffolds. Biomacromolecules. 18 (3), 695-708. (Copyright 2017 American Chemical Society) <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56616/56616fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56616/56616fig3.jpg" /> 
Figure 3: Effect of the reducing agent on the integrity of the BMP2. (A) BMP2-WT was exposed to different molar ratios of sodium ascorbate (NaAsc) to copper (II) sulfate (CuSO4). The samples were analyzed by SDS-PAGE and Coomassie Brilliant Blue staining under reduced (Figure A1) and non-reduced conditions (Figure A2). In the reduced conditions (A1), the red arrows represent cleaved BMP2-WT. In the non-reduced conditions (A2), the red arrows indicate multimeric BMP2-WT. The bands representing cleaved BMP2 species are indicated by a blue arrow. Legend: NCR - reduced BMP2-WT untreated; NC - BMP2-WT untreated; 1:1 to 20:1 - increasing molar ratios of sodium ascorbate to CuSO4. (B) BMP2-K3Plk was coupled to 3-Azido-7-hydroxycoumarin using CuAAC reaction conditions supplemented with THPTA. Upon coupling 3-Azido-7-hydroxycoumarin becomes a fluorescent dye. Legend: NC - BMP2-WT reacted with 3-Azido-7-hydroxycoumarin; 7:1 to 20:1 increasing molar ratios of THPTA to CuSO4. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56616/56616fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56616/56616fig4.jpg" /> 
Figure 4: Bioactivity of immobilized BMP2-K3Plk in vitro. Representative picture of the interaction of immobilized BMP2-K3Plk with Texas-Red-labelled BMPR-IAEC. Reprinted (adapted) with permission from Tabisz et al. (2017): Site-Directed Immobilization of BMP-2: Two Approaches for the Production of Innovative Osteoinductive Scaffolds. Biomacromolecules. 18 (3), 695-708. (Copyright 2017 American Chemical Society) <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56616/56616fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/56616/56616fig5.jpg" /> 
Figure 5: Bioactivity of immobilized BMP2-K3Plk in a cell-based assay. (A) Representative picture of alkaline phosphatase (ALP) staining upon treatment with beads coupled to BMP2-K3Plk functionalized beads. (B) Alkaline phosphatase (ALP) staining upon treatment with soluble 25 nM BMP2-K3Plk. Reprinted (adapted) with permission from Tabisz et al. (2017): Site-Directed Immobilization of BMP-2: Two Approaches for the Production of Innovative Osteoinductive Scaffolds. Biomacromolecules. 18 (3), 695-708. (Copyright 2017 American Chemical Society) <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56616/56616fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry at JoVE.com

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Biomaterials doped with Bone Morphogenetic Protein 2 (BMP2) have been used as a new therapeutic strategy to heal non-union bone fractures. To overcome side effects resulting from an uncontrollable release of the factor, we propose a new strategy to site-directly immobilize the factor, thus creating materials with improved osteogenic capabilities.

Different therapeutic strategies for the treatment of non-healing long bone defects have been intensively investigated. Currently used treatments present ...

site-directed-immobilization-bone-morphogenetic-protein-2-to-solid

Nanyang Technological University

Research

JoVE Journal

Bioengineering

7.5K Views.  Institutsteil Würzburg. Biomaterialen doped met bot morfogenetische eiwit 2 (BMP2) zijn gebruikt als een nieuwe therapeutische strategie om non-adhesie botbreuken genezen. Om te overwinnen bijwerkingen als gevolg van een oncontroleerbare release van de factor, stellen wij voor een nieuwe strategie aan site-direct immobiliseren de factor, waardoor materialen met verbeterde mogelijkheden voor osteogenic.

Video: Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Microfluidic On-chip Capture-cycloaddition Reaction to Reversibly Immobilize Small Molecules or Multi-component Structures for Biosensor Applications

Methods for rapid surface immobilization of bioactive small molecules with control over orientation and immobilization density are highly desirable for biosensor and microarray applications. In this Study, we use a highly efficient covalent bioorthogonal [4+2] cycloaddition reaction between trans-cyclooctene (TCO) and 1,2,4,5-tetrazine (Tz) to enable the microfluidic immobilization of TCO/Tz-derivatized molecules. We monitor the process in real-time under continuous flow conditions using surface plasmon resonance (SPR). To enable reversible immobilization and extend the experimental range of the sensor surface, we combine a non-covalent antigen-antibody capture component with the cycloaddition reaction. By alternately presenting TCO or Tz moieties to the sensor surface, multiple capture-cycloaddition processes are now possible on one sensor surface for on-chip assembly and interaction studies of a variety of multi-component structures. We illustrate this method with two different immobilization experiments on a biosensor chip; a small molecule, AP1497 that binds FK506-binding protein 12 (FKBP12); and the same small molecule as part of an immobilized and in situ-functionalized nanoparticle.

We present a method for rapid, reversible immobilization of small molecules and functionalized nanoparticle assemblies for Surface Plasmon Resonance (SPR) studies, using sequential on-chip bioorthogonal cycloaddition chemistry and antibody-antigen capture.

Methods  for rapid surface immobilization of bioactive small molecules with control over  orientation and immobilization density are highly desirable for ...

Chemistry

Covalent Binding of BMP-2 on Surfaces Using a Self-assembled Monolayer Approach

Bone morphogenetic protein 2 (BMP-2) is a growth factor embedded in the extracellular matrix of bone tissue. BMP-2 acts as trigger of mesenchymal cell differentiation into osteoblasts, thus stimulating healing and de novo bone formation. The clinical use of recombinant human BMP-2 (rhBMP-2) in conjunction with scaffolds has raised recent controversies, based on the mode of presentation and the amount to be delivered. The protocol presented here provides a simple and efficient way to deliver BMP-2 for in vitro studies on cells. We describe how to form a self-assembled monolayer consisting of a heterobifunctional linker, and show the subsequent binding step to obtain covalent immobilization of rhBMP-2. With this approach it is possible to achieve a sustained presentation of BMP-2 while maintaining the biological activity of the protein. In fact, the surface immobilization of BMP-2 allows targeted investigations by preventing unspecific adsorption, while reducing the amount of growth factor and, most notably, hindering uncontrolled release from the surface. Both short- and long-term signaling events triggered by BMP-2 are taking place when cells are exposed to surfaces presenting covalently immobilized rhBMP-2, making this approach suitable for in vitro studies on cell responses to BMP-2 stimulation.

We describe a method for accomplishing efficient immobilization of BMP-2 on surfaces. Our approach is based on the formation of a self-assembled monolayer to achieve the covalent binding of BMP-2 via its free amine residues. This method is a useful tool to study signaling at the cell membrane.

Bone morphogenetic protein 2 (BMP-2) is a growth factor embedded in the extracellular matrix of bone tissue. BMP-2 acts as trigger of mesenchymal cell ...

Chemoselective Modification of Viral Surfaces via Bioorthogonal Click Chemistry

The modification of virus particles has received a significant amount of attention for its tremendous potential for impacting gene therapy, oncolytic applications and vaccine development.1,2,3 Current approaches to modifying viral surfaces, which are mostly genetics-based, often suffer from attenuation of virus production, infectivity and cellular transduction.4,5 Using chemoselective click chemistry, we have developed a straightforward alternative approach which sidesteps these issues while remaining both highly flexible and accessible.1,2
The goal of this protocol is to demonstrate the effectiveness of using bioorthogonal click chemistry to modify the surface of adenovirus type 5 particles. This two-step process can be used both therapeutically1 or analytically,2,6 as it allows for chemoselective ligation of targeting molecules, dyes or other molecules of interest onto proteins pre-labeled with azide tags. The three major advantages of this method are that (1) metabolic labeling demonstrates little to no impact on viral fitness,1,7 (2) a wide array of effector ligands can be utilized, and (3) it is remarkably fast, reliable and easy to access.1,2,7
In the first step of this procedure, adenovirus particles are produced bearing either azidohomoalanine (Aha, a methionine surrogate) or the unnatural sugar O-linked N-azidoacetylglucosamine (O-GlcNAz), both of which contain the azide (-N3) functional group. After purification of the azide-modified virus particles, an alkyne probe containing the fluorescent TAMRA moiety is ligated in a chemoselective manner to the pre-labeled proteins or glycoproteins. Finally, an SDS-PAGE analysis is performed to demonstrate the successful ligation of the probe onto the viral capsid proteins. Aha incorporation is shown to label all viral capsid proteins (Hexon, Penton and Fiber), while O-GlcNAz incorporation results in labeling of Fiber only.
In this evolving field, multiple methods for azide-alkyne ligation have been successfully developed; however only the two we have found to be most convenient are demonstrated herein &#x2013; strain-promoted azide-alkyne cycloaddition (SPAAC) and copper-catalyzed azide-alkyne cycloaddition (CuAAC) under deoxygenated atmosphere.

Adenovirus particles are engineered to contain either the unnatural amino acid analogue azidohomoalanine or the azido sugar O-GlcNAz. The azide group of each is chemoselectively ligated via "click" chemistry reactions as a means of viral surface modification.

The modification of virus particles has received a significant amount of attention for its tremendous potential for impacting gene therapy, oncolytic ...

Immunology and Infection

Fabricating Complex Culture Substrates Using Robotic Microcontact Printing (R-&#181;CP) and Sequential Nucleophilic Substitution

In tissue engineering, it is desirable to exhibit spatial control of tissue morphology and cell fate in culture on the micron scale. Culture substrates presenting grafted poly(ethylene glycol) (PEG) brushes can be used to achieve this task by creating microscale, non-fouling and cell adhesion resistant regions as well as regions where cells participate in biospecific interactions with covalently tethered ligands. To engineer complex tissues using such substrates, it will be necessary to sequentially pattern multiple PEG brushes functionalized to confer differential bioactivities and aligned in microscale orientations that mimic in vivo niches. Microcontact printing (&#956;CP) is a versatile technique to pattern such grafted PEG brushes, but manual &#956;CP cannot be performed with microscale precision. Thus, we combined advanced robotics with soft-lithography techniques and emerging surface chemistry reactions to develop a robotic microcontact printing (R-&#956;CP)-assisted method for fabricating culture substrates with complex, microscale, and highly ordered patterns of PEG brushes presenting orthogonal &#8216;click&#8217; chemistries. Here, we describe in detail the workflow to manufacture such substrates.

Fabricating Complex Culture Substrates Using Robotic Microcontact Printing R- &#181;CP and Sequential Nucleophilic Substitution

Cell culture substrates functionalized with microscale patterns of biological ligands have immense utility in the field of tissue engineering. Here, we demonstrate the versatile and automated manufacture of tissue culture substrates with multiple, micropatterned poly(ethylene glycol) brushes presenting orthogonal chemistries that enable spatially precise and site-specific immobilization of biological ligands.

In tissue engineering, it is desirable to exhibit spatial control of tissue morphology and cell fate in culture on the micron scale. Culture substrates ...

Distinctive Capillary Action by Micro-channels in Bone-like Templates can Enhance Recruitment of Cells for Restoration of Large Bony Defect

Without an active, thriving cell population that is well-distributed and stably anchored to the inserted template, exceptional bone regeneration does not occur. With conventional templates, the absence of internal micro-channels results in the lack of cell infiltration, distribution, and inhabitance deep inside the templates. Hence, a highly porous and uniformly interconnected trabecular-bone-like template with micro-channels (biogenic microenvironment template; BMT) has been developed to address these obstacles. The novel BMT was created by innovative concepts (capillary action) and fabricated with a sponge-template coating technique. The BMT consists of several structural components: inter-connected primary-pores (300-400 &#181;m) that mimic pores in trabecular bone, micro-channels (25-70 &#181;m) within each trabecula, and nanopores (100-400 nm) on the surface to allow cells to anchor. Moreover, the BMT has been documented by mechanical test study to have similar mechanical strength properties to those of human trabecular bone (~3.8 MPa)12.
The BMT exhibited high absorption, retention, and habitation of cells throughout the bridge-shaped (&#928;) templates (3 cm height and 4 cm length). The cells that were initially seeded into one end of the templates immediately mobilized to the other end (10 cm distance) by capillary action of the BMT on the cell media. After 4 hr, the cells homogenously occupied the entire BMT and exhibited normal cellular behavior. The capillary action accounted for the infiltration of the cells suspended in the media and the distribution (active migration) throughout the BMT. Having observed these capabilities of the BMT, we project that BMTs will absorb bone marrow cells, growth factors, and nutrients from the periphery under physiological conditions.
The BMT may resolve current limitations via rapid infiltration, homogenous distribution and inhabitance of cells in large, volumetric templates to repair massive skeletal defects.

A step-by-step generic process to create a bone-like template with engineered micro-channels is presented. High absorption and retention capabilities of the template are demonstrated by capillary action via micro-channels.

Without an active, thriving cell population that is well-distributed and stably anchored to the inserted template, exceptional bone regeneration does not ...

Automated System for Single Molecule Fluorescence Measurements of Surface-immobilized Biomolecules

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, such as nucleic acids and proteins. Single molecule FRET (sm-FRET) measurements on immobilized molecules permit long observations of the system -effectively until both dyes photobleach- resulting in time-traces that report on biomolecular dynamics with a broad range of timescales from milliseconds to minutes. To facilitate the acquisition of large number of traces for statistical analyses, the process must be automated and the sample environment should be tightly controlled over the entire measurement time (~12 hours). This is accomplished using an automated scanning confocal microscope that allows the interrogation of thousands of single molecules overnight, and a microfluidic cell that permits the controlled exchange of buffer, with restricted oxygen content and maintains a constant temperature throughout the entire measuring period. Here we show how to assemble the microfluidic device and how to activate its surface for DNA immobilization. Then we explain how to prepare a buffer to maximize the photostability and lifetime of the fluorophores. Finally, we show the steps involved in preparing the setup for the automated acquisition of time-resolved single molecule FRET traces of DNA molecules.

In this article we describe how we obtain FRET traces from individual DNA molecules immobilized to a surface using an automated scanning confocal microscope.

Fluorescence Resonance Energy Transfer (FRET) microscopy has been widely used to study the structure and dynamics of molecules of biological interest, ...

Biology

Polyelectrolyte Complex for Heparin Binding Domain Osteogenic Growth Factor Delivery

During reconstructive bone surgeries, supraphysiological amounts of growth factors are empirically loaded onto scaffolds to promote successful bone fusion. Large doses of highly potent biological agents are required due to growth factor instability as a result of rapid enzymatic degradation as well as carrier inefficiencies in localizing sufficient amounts of growth factor at implant sites. Hence, strategies that prolong the stability of growth factors such as BMP-2/NELL-1, and control their release could actually lower their efficacious dose and thus reduce the need for larger doses during future bone regeneration surgeries. This in turn will reduce side effects and growth factor costs. Self-assembled PECs have been fabricated to provide better control of BMP-2/NELL-1 delivery via heparin binding and further potentiate growth factor bioactivity by enhancing in vivo stability. Here we illustrate the simplicity of PEC fabrication which aids in the delivery of a variety of growth factors during reconstructive bone surgeries.

Self-assembled polyelectrolyte complexes (PEC) fabricated from heparin and protamine were deposited on alginate beads to entrap and regulate the release of osteogenic growth factors. This delivery strategy enables a 20-fold reduction of BMP-2 dose in spinal fusion applications. This article illustrates the benefits and fabrication of PECs.

During reconstructive bone surgeries, supraphysiological amounts of growth factors are empirically loaded onto scaffolds to promote successful bone ...

Patterning Bioactive Proteins or Peptides on Hydrogel Using Photochemistry for Biological Applications

There are many biological stimuli that can influence cell behavior and stem cell differentiation. General cell culture approaches rely on soluble factors within the medium to control cell behavior. However, soluble additions cannot mimic certain signaling motifs, such as matrix-bound growth factors, cell-cell signaling, and spatial biochemical cues, which are common influences on cells. Furthermore, biophysical properties of the matrix, such as substrate stiffness, play important roles in cell fate, which is not easily manipulated using conventional cell culturing practices. In this method, we describe a straightforward protocol to provide patterned bioactive proteins on synthetic polyethylene glycol (PEG) hydrogels using photochemistry. This platform allows for the independent control of substrate stiffness and spatial biochemical cues. These hydrogels can achieve a large range of physiologically relevant stiffness values. Additionally, the surfaces of these hydrogels can be photopatterned with bioactive peptides or proteins via thiol-ene click chemistry reactions. These methods have been optimized to retain protein function after surface immobilization. This is a versatile protocol that can be applied to any protein or peptide of interest to create a variety of patterns. Finally, cells seeded onto the surfaces of these bioactive hydrogels can be monitored over time as they respond to spatially specific signals.

In this method, we use photopolymerization and click chemistry techniques to create protein or peptide patterns on the surface of polyethylene glycol (PEG) hydrogels, providing immobilized bioactive signals for the study of cellular responses in vitro.

There are many biological stimuli that can influence cell behavior and stem cell differentiation. General cell culture approaches rely on soluble factors ...

Peptides from Phage Display Library Modulate Gene Expression in Mesenchymal Cells and Potentiate Osteogenesis in Unicortical Bone Defects

Two novel synthetic peptides accelerate bone formation and can be delivered using a collagen matrix. The aim of this study was to investigate the effects on bone repair in a unicortical defect model. Treatment of mesenchymal cells produced an increase in alkaline phosphatase activity, showed nodule formation by the cells, and increased the expression of genes for runx2, osterix, bone sialoprotein, and osteocalcin. A collagen sponge soaked with peptide promoted repair of bone defects, whereas the control was less effective. The results from this study demonstrated that mesenchymal cells treated with peptide in vitro differentiate towards osteogenesis, and, that peptides delivered in vivo using a collagen sponge promote the repair of unicortical defects.

A phage display library was used to identify peptide sequences that target bone. The objective was to investigate the effect of these peptides on mesenchymal cell differentiation and to determine their effect on bone regeneration.

Two novel synthetic peptides accelerate bone formation and can be delivered using a collagen matrix. The aim of this study was to investigate the effects ...

Functional Surface-immobilization of Genes Using Multistep Strand Displacement Lithography

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic bioreactor system. In contrast to other approaches towards artificial cellular systems, such a setup allows for a continuous supply with gene expression reagents and simultaneous draining of waste products. This facilitates the implementation of cell-free gene expression processes over extended periods of time, which is important for the realization of dynamic gene regulatory feedback systems. Here we provide a detailed protocol for the fabrication of genetic biochips using a simple-to-use lithographic technique based on DNA strand displacement reactions, which exclusively uses commercially available components. We also provide a protocol on the integration of compartmentalized genes with a polydimethylsiloxane (PDMS)-based microfluidic system. Furthermore, we show that the system is compatible with total internal reflection fluorescence (TIRF) microscopy, which can be used for the direct observation of molecular interactions between DNA and molecules contained in the expression mix.

We describe a simple lithographic procedure for the immobilization of gene-length DNA molecules on a surface, which can be used to perform cell-free gene expression experiments on biochips.

Immobilization of genes on lithographically structured surfaces allows the study of compartmentalized gene expression processes in an open microfluidic ...

Site-Directed Immobilization of Bone Morphogenetic Protein 2 to Solid Surfaces by Click Chemistry

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video