We thank Karyn Esser, Nobuya Koike and Noheon Park for helpful advice. This work was in part supported by NIH/NIGMS (R01GM114424) to S.-H.Y., and the Robert A. Welch Foundation (AU-1731) and NIH/NIA (R01AG045828) to Z.C.

Animal care was performed under Institutional Animal Care and Use Committee (IACUC) guidelines, and the procedures were conducted according to an animal protocol approved by the University of Texas Health Science Center at Houston.
1. Nuclei Isolation from Cross-linked Skeletal Muscle
<ol>
	<li>Weigh and mince hind limb skeletal muscle, isolated from approximately 20-week old C57BL/6 male mice, in ice-cold phosphate buffered saline (PBS) as described in detail previously22. 
	NOTE: We usually obtain 1.0 - 1.5 g of skeletal muscle from one mouse.
	<ol>
		<li>Place minced skeletal muscle tissue in a 50-mL conical tube containing 10 mL PBS on ice.</li>
	</ol>
	</li>
	<li>Centrifuge at 300 x g at 4 &#176;C for 5 min.</li>
	<li>Carefully remove PBS supernatant by aspiration.</li>
	<li>Estimate pellet volume in each 50-mL tube by using reference tubes with 1, 2, 3 and 4 mL of water.</li>
	<li>Add 7 volumes of ice-cold 1% formaldehyde in PBS and homogenize the samples on ice using a probe tissue homogenizer (see Table of Materials). 
	NOTE: Optional: The homogenization procedure can be conducted in a cold room.</li>
	<li>Cross-link the sample by incubating at room temperature for 10 min.</li>
	<li>Quench the cross-linking reaction by the addition of 1 M glycine to a final concentration of 0.125 M and incubate for 5 min at room temperature.</li>
	<li>Centrifuge the samples at 3,000 x g for 5 min at 4 &#176;C. Remove the supernatant via aspiration.</li>
	<li>Rinse with 10 mL of ice-cold base buffer (10 mM HEPES-KOH at pH 7.3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl2, 0.5 mM DTT) containing freshly added protease inhibitors (0.2 mM phenylmethylsulfonyl fluoride (PMSF), and 10 &#181;g/mL leupeptin). Centrifuge at 3,000 g for 5 min at 4 &#176;C and carefully remove the supernatant by aspiration.</li>
	<li>Resuspend the pellet in 6 mL of lysis buffer (10 mM HEPES-KOH at pH 7.3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl2, 0.5 mM DTT, 1% Triton X-100) containing freshly added protease inhibitors (0.2 mM PMSF, and 10 &#181;g/mL leupeptin).</li>
	<li>Transfer the sample to a prechilled 15 mL Dounce homogenizer and incubate for 10 min on ice.Dounce homogenize each sample on ice with 15 slow strokes using loose pestle followed by 15 strokes with tight pestle to release the nuclei.</li>
	<li>Filter the homogenate (6 mL) through cell strainer (pore size: 100 &#181;m) and rinse with 4 mL of lysis buffer. Centrifuge the samples at 1,000 x g for 10 min at 4 &#176;C. Resuspend into 5 mL of ice-cold base buffer and dounce 10 times with tight pestle to release nuclei.
	<ol>
		<li>Remove an aliquot of 20 &#181;L for DNA concentration measurement with a spectrophotometer (OD260/OD280) and microscopic observation with trypan blue if necessary (see below) (Figure 1A).</li>
	</ol>
	</li>
	<li>Filter the suspension through a cell strainer (Pore size: 70 &#181;m), rinse the tube and filter again with 2 mL base buffer as above.</li>
	<li>Repeat the filtration as in step 1.13 with cell strainers of gradually reduced pore size (40 &#181;m, 30 &#181;m, 20 &#181;m and 10 &#181;m). 
	NOTE: In total, strainers of 6 pore sizes were used in steps 1.12-1.14.</li>
	<li>Centrifuge at 1,000 g at 4 &#176;C for 10 min. Remove supernatant and resuspend the pellet in 500 &#181;L base buffer.</li>
	<li>Measure DNA concentration as above. 
	NOTE: Approximately 200 &#181;g of nucleic DNA was obtained from combining both hind limbs from one animal. Optionally, save 20 &#181;L for microscopic observation with trypan blue staining (stock concentration 0.4%, 1:5 dilution); nuclei will stain blue (Figure 1B).</li>
	<li>Centrifuge at 1,000 g at 4 &#176;C for 10 min, and discard the supernatant. Store pellet at -80 &#176;C.</li>
</ol>
2. Sonication
<ol>
	<li>Thaw samples in 500 &#181;L of SDS lysis buffer and resuspend with gentle pipetting.</li>
	<li>Transfer the nuclei DNA suspension to a glass vial on ice.</li>
	<li>Run the sonication with focused bursts of ultrasonic acoustic energy from a dish-shaped transducer. See Table of Materials for equipment details. Use the following setting: cycles per burst: 200; intensity: 5; duty cycle: 20; temperature 4 - 6 &#176;C; 30 s on/off. 
	NOTE: An example for evaluating sonication efficacy is shown in Figure 2.</li>
	<li>Transfer the sonicated chromatin to a 1.5 mL tube. Centrifuge at 12,000 x g for 15 min and transfer the supernatant to a new tube. Transfer 50 &#181;L of sonicated samples (~ 7 - 10 &#181;g/muscle sample) into a new 1.5 mL tube for reverse crosslinking overnight at 65 &#176;C. Freeze the remaining samples at -80 &#176;C.</li>
</ol>
3. Evaluation of Sonication and Quantitation
<ol>
	<li>Add 1.0 &#181;L of RNase A (500 U/mL RNase A: 20,000 U/mL RNase T1) to the saved 50 &#181;L sonicated samples and incubate for 30 min at 37 &#176;C.</li>
	<li>Add 8 &#181;L of protease K (10 mg/mL) and incubate 30 min at 55 &#176;C.</li>
	<li>Harvest the DNA by using a DNA extraction kit.
	<ol>
		<li>Add 5 volumes of binding buffer, apply it to spin column, and centrifuge at 4,000 x g, 10 min.</li>
		<li>Apply the pass-through onto the same column and centrifuge again.</li>
		<li>Wash with washing buffer two times at 13,000 x g, 1 min.</li>
		<li>Centrifuge again at 13,000 x g, 1 min to dry the column.</li>
		<li>Add 50 &#181;L of H2O and centrifuge at 13,000 x g, 1 min to elute DNA.</li>
		<li>Apply the pass-through onto the same column and centrifuge again.</li>
	</ol>
	</li>
	<li>Quantify the amount of DNA with a spectrophotometer (OD260/OD280). Run samples on 0.8% gels to evaluate the size and amount (1 &#181;g) of the sonicated products (Figure 2). 
	NOTE: The average chromatin yield is approximately ~ 20%.</li>
</ol>
4. ChIP
<ol>
	<li>Thaw the previously saved chromatin at -80 &#176;C and aliquot the chromatin to ~ 100 - 120 &#181;g per tube. Dilute 1:10 with radioimmunoprecipitation assay (RIPA) buffer (20mM Tris-HCl (pH 7.4), 150mM NaCl, 1mM EDTA, 1mM NaF, 1mM Na3VO4, 1mM PMSF, 1x Protease inhibitor cocktail (PIC), 0.1% Na-deoxycholate (w/v), 1% Triton X-100).
	<ol>
		<li>If there are multiple samples in each group, combine equal amounts of chromatin DNA to the final amount of ~ 100 - 120 &#181;g/sample. Save 10% as input.</li>
	</ol>
	</li>
	<li>Add 40 &#181;L (50% v/v slurry in RIPA buffer) of BSA-pre-blocked (~ 2 h, 4 &#176;C) Protein A/G agarose (non-Chicken antibody) or IgY beads (Chicken antibody) and incubate on a rotator for 3 h at 4 &#176;C.</li>
	<li>Centrifuge at 1,000 x g, 10 min and carefully transfer the supernatant to new tubes.</li>
	<li>Add antibodies at 1 &#181;g antibody per ~ 25 - 100 &#181;g chromatin DNA.</li>
	<li>Rotate gently at 4 &#176;C overnight at approximately 15 rpm.</li>
	<li>Add 10 &#181;L of BSA-pre-blocked (~2 h, 4 &#176;C) Protein A/G agarose (non-Chicken antibody) or IgY beads (Chicken antibody) mix and rotate in the cold room for 2 h.</li>
	<li>Wash beads as follows. Wash with 1 mL of RIPA buffer for 3 min twice, wash with 1 mL of high salt buffer&#160;(20mM Tris-HCl (pH 7.4), 500mM NaCl, 2mM EDTA, 1mM PMSF, 1% Triton X-100) for 3 min twice, wash with 1 mL of LiCl buffer&#160;(20mM Tris-HCl (pH 7.4), 250mM LiCl, 2mM EDTA, 1mM PMSF, 1% Na-deoxycholate, 0.5% NP40) for 3 min twice.
	<ol>
		<li>Wash with 1 mL of Tris-EDTA (TE) buffer&#160;(10mM Tris-HCl (pH 7.4), 1mM EDTA) for 3 min once. Then elute DNA with elution buffer (20 mM Tris-HCl, 5 mM EDTA and 0.5% SDS).</li>
	</ol>
	</li>
	<li>Centrifuge at 1,000 g, 1 min and carefully remove the supernatant.</li>
	<li>Resuspend the bead with 50 &#181;L of elution buffer.</li>
	<li>Incubate for 10 min at 65 &#176;C.</li>
	<li>Centrifuge at 12,000 g for 5 min.</li>
	<li>Transfer the supernatant to a new tube, add another 50 &#181;L and centrifuge once again at 12,000 g for 5 min. The final elution volume will be 100 &#181;L.</li>
	<li>Reverse crosslinking and DNA elution.
	<ol>
		<li>Incubate the eluted chromatin overnight at 65 &#176;C.</li>
		<li>Add 1.0 &#181;L of RNase A and incubate for 30 min at 37 &#176;C.</li>
		<li>Add 8 &#181;L of protease K (10 mg/mL) and incubate 30 min at 55 &#176;C.</li>
		<li>Harvest the DNA by using a PCR cleanup kit with elution volume at 50 &#181;L according to the manufacturer&#39;s protocol.</li>
	</ol>
	</li>
	<li>Analyze the profiles by Real-time qPCR as previously described25,26. 
	NOTE: The primer sequences are listed in Figure 3 Legend. Data are presented as mean &#177; SEM (Figure 3).</li>
</ol>

<ol>
	<li>Bouzakri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA-based+gene+silencing+reveals+specialized+roles+of+IRS-1/Akt2+and+IRS-2/Akt1+in+glucose+and+lipid+metabolism+in+human+skeletal+muscle.">siRNA-based gene silencing reveals specialized roles of IRS-1/Akt2 and IRS-2/Akt1 in glucose and lipid metabolism in human skeletal muscle.</a> Cell Metab. 4 (1), 89-96 (2006).</li><li>Boucher, J., Kleinridders, A., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+receptor+signaling+in+normal+and+insulin-resistant+states.">Insulin receptor signaling in normal and insulin-resistant states.</a> Cold Spring Harb Perspect Biol. 6 (1), (2014).</li><li>Green, C. B., Takahashi, J. S., Bass, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+meter+of+metabolism.">The meter of metabolism.</a> Cell. 134 (5), 728-742 (2008).</li><li>Liu, A. C., Lewis, W. G., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+circadian+signaling+networks+and+therapeutic+targets.">Mammalian circadian signaling networks and therapeutic targets.</a> Nat Chem Biol. 3 (10), 630-639 (2007).</li><li>Harfmann, B. D., Schroder, E. A., Esser, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circadian+rhythms,+the+molecular+clock,+and+skeletal+muscle.">Circadian rhythms, the molecular clock, and skeletal muscle.</a> J Biol Rhythms. 30 (2), 84-94 (2015).</li><li>Nohara, K., Yoo, S. H., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulating+the+circadian+and+sleep+cycles+to+protect+against+metabolic+disease.">Manipulating the circadian and sleep cycles to protect against metabolic disease.</a> Front Endocrinol (Lausanne). 6, 35 (2015).</li><li>Harfmann, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle-specific+loss+of+Bmal1+leads+to+disrupted+tissue+glucose+metabolism+and+systemic+glucose+homeostasis.">Muscle-specific loss of Bmal1 leads to disrupted tissue glucose metabolism and systemic glucose homeostasis.</a> Skelet Muscle. 6, 12 (2016).</li><li>Pedersen, B. K., Febbraio, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscles,+exercise+and+obesity:+skeletal+muscle+as+a+secretory+organ.">Muscles, exercise and obesity: skeletal muscle as a secretory organ.</a> Nat Rev Endocrinol. 8 (8), 457-465 (2012).</li><li>Solomon, M. J., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde-mediated+DNA-protein+crosslinking:+a+probe+for+in+vivo+chromatin+structures.">Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures.</a> Proc Natl Acad Sci U S A. 82 (19), 6470-6474 (1985).</li><li>Jackson, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+histone+organization+in+the+nucleosome+using+formaldehyde+as+a+reversible+cross-linking+agent.">Studies on histone organization in the nucleosome using formaldehyde as a reversible cross-linking agent.</a> Cell. 15 (3), 945-954 (1978).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Takahashi, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+RNA-seq+methods+to+study+circadian+control+of+transcription+in+mammals.">ChIP-seq and RNA-seq methods to study circadian control of transcription in mammals.</a> Methods Enzymol. 551, 285-321 (2015).</li><li>Kuo, M. H., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+cross-linking+and+immunoprecipitation+for+studying+dynamic+Protein:DNA+associations+in+a+chromatin+environment.">In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment.</a> Methods. 19 (3), 425-433 (1999).</li><li>Chen, Z., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Core+promoter+elements+and+TAFs+contribute+to+the+diversity+of+transcriptional+activation+in+vertebrates.">Core promoter elements and TAFs contribute to the diversity of transcriptional activation in vertebrates.</a> Mol Cell Biol. 23 (20), 7350-7362 (2003).</li><li>Menet, J. S., Abruzzi, K. C., Desrochers, J., Rodriguez, J., Rosbash, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+PER+repression+mechanisms+in+the+Drosophila+circadian+clock:+from+on-DNA+to+off-DNA.">Dynamic PER repression mechanisms in the Drosophila circadian clock: from on-DNA to off-DNA.</a> Genes Dev. 24 (4), 358-367 (2010).</li><li>Miki, T., Matsumoto, T., Zhao, Z., Lee, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p53+regulates+Period2+expression+and+the+circadian+clock.">p53 regulates Period2 expression and the circadian clock.</a> Nat Commun. 4, 2444 (2013).</li><li>Furey, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+beyond:+new+and+improved+methodologies+to+detect+and+characterize+protein-DNA+interactions.">ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions.</a> Nat Rev Genet. 13 (12), 840-852 (2012).</li><li>Koike, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+and+chromatin+landscape+of+the+core+circadian+clock+in+mammals.">Transcriptional architecture and chromatin landscape of the core circadian clock in mammals.</a> Science. 338 (6105), 349-354 (2012).</li><li>Zhou, J., Yu, W., Hardin, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPping+away+at+the+Drosophila+clock.">ChIPping away at the Drosophila clock.</a> Methods Enzymol. 551, 323-347 (2015).</li><li>Takahashi, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+of+the+mammalian+circadian+clock.">Transcriptional architecture of the mammalian circadian clock.</a> Nat Rev Genet. , (2016).</li><li>Edelman, J. C., Edelman, P. M., Kniggee, K. M., Schwartz, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+skeletal+muscle+nuclei.">Isolation of skeletal muscle nuclei.</a> J Cell Biol. 27 (2), 365-377 (1965).</li><li>Ohkawa, Y., Mallappa, C., Vallaster, C. S., Imbalzano, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+nuclei+from+skeletal+muscle+satellite+cells+and+myofibers+for+use+in+chromatin+immunoprecipitation+assays.">Isolation of nuclei from skeletal muscle satellite cells and myofibers for use in chromatin immunoprecipitation assays.</a> Methods Mol Biol. 798, 517-530 (2012).</li><li>Wilkie, G. S., Schirmer, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+nuclei+and+preparation+of+nuclear+envelopes+from+skeletal+muscle.">Purification of nuclei and preparation of nuclear envelopes from skeletal muscle.</a> Methods Mol Biol. 463, 23-41 (2008).</li><li>Hahn, C. G., Covault, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+transcriptionally+active+nuclei+from+striated+muscle+using+Percoll+density+gradients.">Isolation of transcriptionally active nuclei from striated muscle using Percoll density gradients.</a> Anal Biochem. 190 (2), 193-197 (1990).</li><li>Jeong, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+attenuation+of+proteasomal+and+autophagic+BMAL1+degradation+in+Clock+Delta19/++mice+contributes+to+improved+glucose+homeostasis.">Dual attenuation of proteasomal and autophagic BMAL1 degradation in Clock Delta19/+ mice contributes to improved glucose homeostasis.</a> Scientific reports. 5, 12801 (2015).</li><li>Nohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonia-lowering+activities+and+carbamoyl+phosphate+synthetase+1+(Cps1)+induction+mechanism+of+a+natural+flavonoid.">Ammonia-lowering activities and carbamoyl phosphate synthetase 1 (Cps1) induction mechanism of a natural flavonoid.</a> Nutrition &amp; metabolism. 12, 23 (2015).</li><li>Zhang, L., Rubins, N. E., Ahima, R. S., Greenbaum, L. E., Kaestner, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Foxa2+integrates+the+transcriptional+response+of+the+hepatocyte+to+fasting.">Foxa2 integrates the transcriptional response of the hepatocyte to fasting.</a> Cell Metab. 2 (2), 141-148 (2005).</li><li>Gade, P., Kalvakolanu, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+assay+as+a+tool+for+analyzing+transcription+factor+activity.">Chromatin immunoprecipitation assay as a tool for analyzing transcription factor activity.</a> Methods Mol Biol. 809, 85-104 (2012).</li><li>Kondratov, R. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMAL1-dependent+circadian+oscillation+of+nuclear+CLOCK:+posttranslational+events+induced+by+dimerization+of+transcriptional+activators+of+the+mammalian+clock+system.">BMAL1-dependent circadian oscillation of nuclear CLOCK: posttranslational events induced by dimerization of transcriptional activators of the mammalian clock system.</a> Genes Dev. 17 (15), 1921-1932 (2003).</li><li>Ripperger, J. A., Schibler, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhythmic+CLOCK-BMAL1+binding+to+multiple+E-box+motifs+drives+circadian+Dbp+transcription+and+chromatin+transitions.">Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions.</a> Nat Genet. 38 (3), 369-374 (2006).</li><li>Laplante, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DEPTOR+cell-autonomously+promotes+adipogenesis,+and+its+expression+is+associated+with+obesity.">DEPTOR cell-autonomously promotes adipogenesis, and its expression is associated with obesity.</a> Cell Metab. 16 (2), 202-212 (2012).</li><li>Blechman, J., Amir-Zilberstein, L., Gutnick, A., Ben-Dor, S., Levkowitz, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+metabolic+regulator+PGC-1alpha+directly+controls+the+expression+of+the+hypothalamic+neuropeptide+oxytocin.">The metabolic regulator PGC-1alpha directly controls the expression of the hypothalamic neuropeptide oxytocin.</a> J Neurosci. 31 (42), 14835-14840 (2011).</li></ol>

The authors have nothing to disclose.

Here we describe a robust method where cross-linked skeletal muscle tissues were used to isolate high-quality nuclei. Sequential filtration was carried out to effectively separate nuclei from debris, and ultrasonic acoustic energy from dish-shaped transducer sheared the chromatin for ChIP analysis. The results showed circadian time-specific binding of BMAL1 to target promoters.
ChIP can be employed to capture real-time protein occupancy on genomic DNA when cross-linking takes place. To take advantage of this potential, we aimed to develop a method to allow cross-linking of skeletal muscle at the time of tissue dissection and to streamline the nuclei isolation without gradient ultracentrifugation. Due to the difficulty of homogenizing fiber-rich skeletal muscle compared with soft tissues such as liver, we minced muscle tissue in ice-cold PBS and then homogenized the sample in a formaldehyde buffer. After quenching, tissue suspension was centrifuged and rinsed with ice-cold base buffer to rinse out any remaining formaldehyde. Nuclei were released by Dounce homogenization, and the homogenates were sequentially filtered to gradually remove cell debris and myofibrils. We devised the series of filtration to minimize filter clogging which could adversely impact yield. Only very short myofibrils remained when the sequential filtration was completed.
The sonication and ChIP procedures were adapted from a previous report12 with modifications including sonication timing and SDS buffer amount. The dish-shaped sonicator allows exposure to centralized ultrasonic wave for samples in glass vials in a cold water bath. Compared with probe sonicators, this sonicator controls the sample temperature to avoid overheating, and also prevents sample cross-contamination. If probe sonicators are used, optimal sonication conditions need to be determined empirically. We also reduced the amount of SDS buffer since the yield of muscle chromatin is lower than that in liver12. Several protocols28,31,32 include incubation on ice or at room temperature prior to sonication. However, in our experience, pre-incubation on ice did not improve the sonication efficiency. In fact, in some instances the sonication was compromised. It is possible that residual myofibrils entangled the chromatin DNA during incubation and attenuated sonication efficacy. With immediate sonication after nuclei suspension in SDS lysis buffer, we succeeded in obtaining progressive chromatin fragmentation with increasing sonication cycles (Figure 2).
We validated the quality of chromatin with ChIP qPCR. As shown in Figure 3, the BMAL1 promoter occupancy was robust at ZT6 and minimal at ZT18, consistent with previously shown BMAL1 circadian promoter binding18. This functional assay confirmed the quality of nuclei and chromatin. In recent years, rapid development in NGS opened up a new horizon for ChIP application where ChIP-seq can quantitatively interrogate genomic binding with high sensitivity17. Particularly for ChIP-seq, high-quality nuclei and chromatin are required to consistently capture protein-DNA interaction. The procedure described herein may constitute a valuable resource for ChIP-seq studies using skeletal muscle. Of note, ChIP-seq library preparation requires additional measures to improve signal resolution, such as PAGE-based size selection18.
In conclusion, we developed a filtration-based protocol to prepare high-quality nuclei from cross-linked skeletal muscle. We remove the need for ultracentrifugation, making it easily applicable. In addition to ChIP for genes of interest, the nuclei and chromatin prepared as described can be broadly applicable to ChIP-seq studies.

Skeletal muscle plays important roles in physiology and behavior. The multi-nucleated muscle fiber consists of myofibrils where actin and myosin form functional units called sarcomeres to generate contractile force. Skeletal muscle is also the largest metabolic organ in the body, accounting for &#62;80% postprandial glucose intake and regulating insulin response and metabolic homeostasis1,2. Muscle physiology and metabolism are closely regulated by the circadian clock, an intrinsic biological timer3,4,5,6. For example, the skeletal muscle-specific deletion of Bmal1, one of the core circadian clock components, resulted in insulin resistance and diminished glucose uptake in skeletal muscle, and the animals were found to develop type 2 diabetes7. In addition, skeletal muscle is also increasingly being appreciated as an endocrine organ8, secreting myokines to regulate systemic metabolism and physiology. Mechanistic studies are required to fully understand these regulatory functions in skeletal muscle.
ChIP is a powerful approach to delineate promoter recruitment of DNA binding proteins. ChIP was initially developed to identify nucleosome organization on chromatin DNA9,10. A variety of methods have since been reported to cross-link proteins and chromatin DNA using formaldehyde, dimethyl sulfate or ultraviolet irradiation (UV)11,12. Formaldehyde cross-linking is the most commonly used, preserving chromatin structure and DNA-protein interactions9,13,14. Cross-linked chromatin is shredded by sonication and immunoprecipitated with antibody against the particular DNA binding protein of interest15,16. In recent years, ChIP-sequencing (ChIP-seq), a method combining ChIP with NGS, has been developed to interrogate genome-wide transcription factor binding17, and in some cases to monitor dynamic changes over a time course18,19,20. For example, circadian ChIP-seq studies have revealed a highly orchestrated sequence of genomic binding of circadian clock components and histone markers, which drives temporally precise gene expression throughout the ~ 24 h circadian cycle18.
Most available ChIP protocols are designed for soft tissues (e.g. liver, brain, etc.), and very few have been published for hard tissues including skeletal muscle. It is technically challenging to homogenize fiber-rich skeletal muscle and isolate high-quality nuclei21, especially for ChIP experiments which require cross-linking. In a recent muscle ChIP study22, satellite cells were separated from myofibers, and nuclei were prepared from both cell types through a prolonged procedure involving tissue digestion. The entire process took approximately three hours to complete before formaldehyde cross-linking was performed on isolated nuclei. While this procedure avoided cross-linking muscle fiber, which makes muscle tissue even more refractory to efficient homogenization, and was able to produce high-quality nuclei, the significant time-lag from tissue collection to nuclei cross-linking incurs the risk of altered DNA-protein interaction. In contrast, most studies performed cross-linking immediately after experimental treatment or tissue collection in order to preserve the real-time DNA-protein binding12. A second drawback of nuclei isolation before cross-linking is that it precludes time-sensitive applications such as circadian sample collection which typically occurs at 3 - 4 h intervals. Without cross-linking the nuclei, the isolation needs to proceed immediately after dissection, whereas cross-linked samples can be processed together after the entire time course is completed, thus ensuring greater experimental consistency.
Other protocols for nuclei isolation from uncrosslinked skeletal muscle have also been reported. Two studies described the use of gradient ultracentrifugation to separate nuclei from remaining myofibrils and cell debris23,24. While sucrose or colloidal gradient ultracentrifugation is effective with uncrosslinked muscle tissues, our experiments revealed that after crosslinking, gradient ultracentrifugation failed to separate nuclei from cell debris on the gradient.
We therefore developed a procedure to isolate high-quality nuclei using cross-linked mouse skeletal muscle tissues. Rather than gradient ultracentrifugation, we devised a serial filtration method to effectively separate nuclei from debris. Following ultrasonication, the chromatin samples were successfully applied for ChIP studies which showed a circadian pattern of BMAL1 protein binding to target promoters. Our method can be broadly applicable to various mechanistic studies of muscle tissues.

<table><tbody><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Formaldehyde solution</td><td>Sigma Aldrich</td><td>F8775&amp;nbsp;</td><td></td></tr><tr><td>Glycine</td><td>Fisher Scientific</td><td>BP381-5</td><td></td></tr><tr><td>Trypan Blue solution (0.4%)</td><td>Fisher Scientific</td><td>15250061</td><td></td></tr><tr><td>RNase A</td><td>Sigma Aldrich</td><td>10109142001</td><td></td></tr><tr><td>Protease K</td><td>Sigma Aldrich</td><td>3115887001</td><td></td></tr><tr><td>Chicken Anti-BMAL1 antibody</td><td></td><td></td><td>Generated in chicken (Cocalico Biologicals) against antigen aa 318 - 579, and IgY was affinity purified using the same antigen.&amp;nbsp;</td></tr><tr><td>Chicken IgY Precipitating Resin</td><td>GenScript</td><td>L00405</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>KINEMATICA&amp;nbsp;Polytron PT2100 Benchtop Homogenizer</td><td>Fisher Scientific</td><td>08-451-178</td><td></td></tr><tr><td>15 mL Dounce tissue grinder</td><td>Whearton</td><td>357544</td><td></td></tr><tr><td>Falcon Cell Strainers 100 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-19</td><td></td></tr><tr><td>Falcon Cell Strainers 70 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-1</td><td></td></tr><tr><td>Falcon Cell Strainers 40 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-2</td><td></td></tr><tr><td>pluriStrainer 30 &amp;micro;m</td><td>PluriSelect</td><td>43-50030-03</td><td></td></tr><tr><td>pluriStrainer 20 &amp;micro;m</td><td>PluriSelect</td><td>43-50020-03</td><td></td></tr><tr><td>pluriStrainer 10 &amp;micro;m</td><td>PluriSelect</td><td>43-50010-03</td><td></td></tr><tr><td>Covaris S2 Focused-ultrasonicator</td><td>Covaris</td><td>Model S2</td><td></td></tr><tr><td>Labquake&amp;nbsp;</td><td>Thermo Scientific</td><td>C415110</td><td></td></tr><tr><td>CCD Microscope Camera</td><td>&amp;nbsp;Leica Microsystems</td><td>DFC3000 G</td><td></td></tr><tr><td>&lt;strong&gt;Reagent Kit&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DNA extraction kit</td><td>Thermo Scientific</td><td>K0691</td><td></td></tr><tr><td>&lt;strong&gt;Buffers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>All buffer components are discribed in the protocol. Each component was purchased from Sigma Aldrich</td><td></td><td></td><td></td></tr></tbody></table>

a filtration-based method of preparing high-quality nuclei from cross-linked skeletal muscle for chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a challenge for ChIP due to technical difficulty in isolation of high-quality nuclei with minimal contamination of myofibrils. Previous protocols have attempted to purify nuclei before cross-linking, which incurs the risk of altered DNA-protein interaction during the prolonged nuclei preparation process. In the current protocol, we first cross-linked the skeletal muscle tissue collected from mice, and the tissues were minced and sonicated. Since we found that ultracentrifugation was not able to separate nuclei from myofibrils using cross-linked muscle tissue, we devised a sequential filtration procedure to obtain high-quality nuclei devoid of significant myofibril contamination. We subsequently prepared chromatin by using an ultrasonicator, and ChIP assays with anti-BMAL1 antibody revealed robust circadian binding pattern of BMAL1 to target gene promoters. This filtration protocol constitutes an easily applicable method to isolate high-quality nuclei from cross-linked skeletal muscle tissue, allowing consistent sample processing for circadian and other time-sensitive studies. In combination with next-generation sequencing (NGS), our method can be deployed for various mechanistic and genomic studies focusing on skeletal muscle function.

Here we performed formaldehyde cross-linking immediately after tissue collection to preserve real-time DNA-protein interaction. However, we found that sucrose or colloidal gradient, commonly used for nuclei isolation23,24, was not effective in separating nuclei from myofibrils (data not shown). The reason may be that cross-linking conferred similar gravity for nuclei and myofibrils. Therefore, we developed a serial filtration process to effectively remove large myofibrils and other debris from the nuclei fraction. After 100 &#181;m filtration, there were still large tissue debris and myofibrils (Figure 1A). In comparison, at the end of the sequential filtration, the majority of large tissue debris, intact cells and large myofibrils were successfully removed (Figure 1B).
Those nuclei were used for dish-shaped ultrasonication. Nuclei stored at -80 &#176;C were suspended in SDS lysis buffer and immediately subjected to sonication. Although incubation of nuclei in SDS lysis buffer on ice or room temperature may improve sonication for some tissue such as liver27 or mouse embryonic fibroblast (MEF)28, in our experience it interfered with sonication of skeletal muscle nuclei and resulted in broad smearing, indicating ineffective sonication. Using the current protocol with immediate sonication after suspension in SDS lysis buffer we observed efficient sonication with chromatin gradually shredded in a cycle-dependent manner and eventually producing ~ 500 bp DNA fragments (Figure 2). Pre-incubation in the lysis buffer detectably compromised the sonication efficiency.
To confirm the quality of chromatin preparation for ChIP, we examined DNA binding of the circadian transcription factor BMAL1, which showed binding peak and trough at Zeitgeber time (ZT)6 and ZT18, respectively18,29. Skeletal muscle samples from C57B/6J mice were collected at ZT6 and ZT18, and chromatin samples were prepared as above. Briefly, after sonication, shredded chromatin samples were pre-cleared with IgY beads that have been pre-blocked with BSA followed by incubation with anti-BMAL1 antibody at 4 &#176;C overnight. After elution and purification of chromatin, we performed RT-qPCR to detect BMAL1 binding on E-Box elements of two target genes, Nr1d1 and Dbp30. We detected robust binding of BMAL1 to the E-box elements at ZT6 and minimal binding at ZT18 (Nr1d1: 0.452 &#177; 0.022 vs. 0.039 &#177; 0.002, Dbp -0.4: 0.627 &#177; 0.013 vs. 0.062 &#177; 0.009, Dbp +0.8: 0.176 &#177; 0.013 vs. 0.008 &#177; 0.001, Dbp +2.4: 0.466 &#177; 0.010 vs. 0.122 &#177; 0.014; all values are mean &#177; SEM) (Figure 3), validating the protocol for time-sensitive transcription factor binding analysis in skeletal muscle.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56013/56013fig1.jpg" /> 
Figure 1: Sequential Filtration Effectively Removed Tissue Debris. (A) Representative images showing samples after 100 &#181;m filtration. Large tissue and fiber debris are observed. (B) Representative images showing samples after serial filtration. Large fiber debris were cleared. Only isolated nuclei and small myofibril fragments are observed. Pictures were taken by using a light microscope at 10X, 20X and 40X magnifications. Scale bars are shown on the right hand side panels. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56013/56013fig2.jpg" /> 
Figure 2: Progressive Chromatin Shredding Through 10 Cycles of Sonication. Ten cycles of sonication with digested chromatin DNA to ~ 500 bp, as revealed in a 0.8 % agarose gel, run at 150 V for 60 min. The right panel indicates a lower sonication efficiency after pre-incubation in ice-cold SDS lysis buffer for 1 h. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56013/56013fig3.jpg" /> 
Figure 3: Representative qPCR Results for BMAL1 ChIP with Mouse Skeletal Muscle Samples Collected at ZT6 and ZT18. Data are presented as mean &#177; SEM. Dbp -0.4, +0.8 and +2.4 indicate locations of the E-Box elements on the Dbp gene. NC: negative control with IgY. The temporal pattern of BMAL1 binding is consistent with previous results showing BMAL1 binding peak at around ZT618. The forward and reverse primers are as follows. Rev-erba: 5&#39;-GTAGACTACAAATCCCAACAATCCTG, and 5&#39;-TGGAGCAGGTACCATGTGATTC; Dbp -0.4: 5&#39;-ACACCCGCATCCGATAGC, and 5&#39;-CCACTTCGGGCCAATGAG; Dbp +0.8: 5&#39;- ATGCTCACACGGTGCAGACA, and 5&#39;- CTGCTCAGGCACATTCCTCAT; Dbp +2.4: 5&#39;- TGGGACGCCTGGGTACAC, and 5&#39;- GGGAATGTGCAGCACTGGTT. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation at JoVE.com

A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

We present a filtration-based protocol to isolate high-quality nuclei from cross-linked mouse skeletal muscle wherein we removed the need for ultracentrifugation, making it easily applicable. We show that chromatin prepared from the nuclei is suitable for chromatin immunoprecipitation and likely chromatin immunoprecipitation sequencing studies.

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a ...

a-filtration-based-method-preparing-high-quality-nuclei-from-cross

Nanyang Technological University

Research

JoVE Journal

Biochemistry

8.8K Views.  University of Texas Health Science Center at Houston.  Wij presenteren een protocol op basis van filtratie om hoogwaardige kernen te isoleren van de cross-linked museskeletspier waarbij we de behoefte aan ultracentrifugatie hebben verwijderd, waardoor het gemakkelijk toepasbaar is. We laten zien dat chromatine bereid uit de kernen geschikt is voor chromatine immunoprecipitatie en waarschijnlijk chromatin immunoprecipitatie sequencing studies. 

Video: A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a high content of structural proteins. Dissected limb muscles from adult mice are physically disrupted by mechanical homogenisation, or a combination of mincing and douncing, in a hypotonic buffer before formaldehyde fixation of the cell lysate. The fixed nuclei are purified by further cycles of mechanical homogenisation or douncing and sequential filtrations to remove cell debris. The purified nuclei can be sonicated immediately or at a later stage after freezing. The chromatin can be efficiently sonicated and is suitable for chromatin immunoprecipitation experiments, as illustrated by the profiles obtained for transcription factors, RNA polymerase II, and covalent histone modifications. The binding events detected using chromatin prepared by this protocol are predominantly those taking place in the muscle fiber nuclei despite the presence of chromatin from other fiber-associated satellite and endothelial cells. This protocol is therefore adapted to study gene regulation in the adult mouse skeletal muscle.

A novel protocol for the preparation of chromatin from adult mouse skeletal muscle adapted to the study of gene regulation in muscle fibers by chromatin immunoprecipitation is presented.

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a ...

Quantitative Analysis of Chromatin Proteomes in Disease

In the nucleus reside the proteomes whose functions are most intimately linked with gene regulation. Adult mammalian cardiomyocyte nuclei are unique due to the high percentage of binucleated cells,1 the predominantly heterochromatic state of the DNA, and the non-dividing nature of the cardiomyocyte which renders adult nuclei in a permanent state of interphase.2 Transcriptional regulation during development and disease have been well studied in this organ,3-5 but what remains relatively unexplored is the role played by the nuclear proteins responsible for DNA packaging and expression, and how these proteins control changes in transcriptional programs that occur during disease.6 In the developed world, heart disease is the number one cause of mortality for both men and women.7 Insight on how nuclear proteins cooperate to regulate the progression of this disease is critical for advancing the current treatment options.
Mass spectrometry is the ideal tool for addressing these questions as it allows for an unbiased annotation of the nuclear proteome and relative quantification for how the abundance of these proteins changes with disease. While there have been several proteomic studies for mammalian nuclear protein complexes,8-13 until recently14 there has been only one study examining the cardiac nuclear proteome, and it considered the entire nucleus, rather than exploring the proteome at the level of nuclear sub compartments.15 In large part, this shortage of work is due to the difficulty of isolating cardiac nuclei. Cardiac nuclei occur within a rigid and dense actin-myosin apparatus to which they are connected via multiple extensions from the endoplasmic reticulum, to the extent that myocyte contraction alters their overall shape.16 Additionally, cardiomyocytes are 40% mitochondria by volume17 which necessitates enrichment of the nucleus apart from the other organelles. Here we describe a protocol for cardiac nuclear enrichment and further fractionation into biologically-relevant compartments. Furthermore, we detail methods for label-free quantitative mass spectrometric dissection of these fractions-techniques amenable to in vivo experimentation in various animal models and organ systems where metabolic labeling is not feasible.

Advances in mass spectrometry have allowed the high throughput analysis of protein expression and modification in a host of tissues. Combined with subcellular fractionation and disease models, quantitative mass spectrometry and bioinformatics can reveal new properties in biological systems. The method described herein analyzes chromatin-associated proteins in the setting of heart disease and is readily applicable to other in vivo models of human disease.

In the nucleus reside the proteomes whose functions are most intimately linked with gene regulation. Adult mammalian cardiomyocyte nuclei are unique due ...

Medicine

Efficient Chromatin Immunoprecipitation using Limiting Amounts of Biomass

Chromatin immunoprecipitation (ChIP) is a widely-used method for determining the interactions of different proteins with DNA in chromatin of living cells. Examples include sequence-specific DNA binding transcription factors, histones and their different modification states, enzymes such as RNA polymerases and ancillary factors, and DNA repair components. Despite its ubiquity, there is a lack of up-to-date, detailed methodologies for both bench preparation of material and for accurate analysis allowing quantitative metrics of interaction. Due to this lack of information, and also because, like any immunoprecipitation, conditions must be re-optimized for new sets of experimental conditions, the ChIP assay is susceptible to inaccurate or poorly quantitative results.
Our protocol is ultimately derived from seminal work on transcription factor:DNA interactions1,2 , but incorporates a number of improvements to sensitivity and reproducibility for difficult-to-obtain cell types. The protocol has been used successfully3,4 , both using qPCR to quantify DNA enrichment, or using a semi-quantitative variant of the below protocol.
This quantitative analysis of PCR-amplified material is performed computationally, and represents a limiting factor in the assay. Important controls and other considerations include the use of an isotype-matched antibody, as well as evaluation of a control region of genomic DNA, such as an intergenic region predicted not to be bound by the protein under study (or anticipated not to show changes under the experimental conditions). In addition, a standard curve of input material for every ChIP sample is used to derive absolute levels of enrichment in the experimental material. Use of standard curves helps to take into account differences between primer sets, regardless of how carefully they are designed, and also efficiency differences throughout the range of template concentrations for a single primer set. Our protocol is different from others that are available5-8 in that we extensively cover the later, analysis phase.

We describe a robust method for chromatin immunoprecipitation using primary T cells. The method is founded on standard approaches, but uses a specific set of conditions and reagents that improve efficiency for limited a quantities of cells. Importantly, a detailed description of the data analysis phase is presented.

Chromatin immunoprecipitation (ChIP) is a  widely-used method for determining the interactions of different proteins with  DNA in chromatin of living ...

Biology

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing (ChIP-seq)

ChIP-sequencing (ChIP-seq) methods directly offer whole-genome coverage, where combining chromatin immunoprecipitation (ChIP) and massively parallel sequencing can be utilized to identify the repertoire of mammalian DNA sequences bound by transcription factors in vivo. "Next-generation" genome sequencing technologies provide 1-2 orders of magnitude increase in the amount of sequence that can be cost-effectively generated over older technologies thus allowing for ChIP-seq methods to directly provide whole-genome coverage for effective profiling of mammalian protein-DNA interactions.
For successful ChIP-seq approaches, one must generate high quality ChIP DNA template to obtain the best sequencing outcomes. The description is based around experience with the protein product of the gene most strongly implicated in the pathogenesis of type 2 diabetes, namely the transcription factor transcription factor 7-like 2 (TCF7L2). This factor has also been implicated in various cancers.
Outlined is how to generate high quality ChIP DNA template derived from the colorectal carcinoma cell line, HCT116, in order to build a high-resolution map through sequencing to determine the genes bound by TCF7L2, giving further insight in to its key role in the pathogenesis of complex traits.

Generation of High Quality Chromatin Immunoprecipitation DNA Template for High-throughput Sequencing ChIP-seq

The combination of chromatin immunoprecipitation and ultra-high-throughput sequencing (ChIP-seq) can identify and map protein-DNA interactions in a given tissue or cell line. Outlined is how to generate a high quality ChIP template for subsequent sequencing, using experience with the transcription factor TCF7L2 as an example.

ChIP-sequencing (ChIP-seq) methods directly  offer whole-genome coverage, where combining chromatin immunoprecipitation  (ChIP) and massively parallel ...

The ChroP Approach Combines ChIP and Mass Spectrometry to Dissect Locus-specific Proteomic Landscapes of Chromatin

Chromatin is a highly dynamic nucleoprotein complex made of DNA and proteins that controls various DNA-dependent processes. Chromatin structure and function at specific regions is regulated by the local enrichment of histone post-translational modifications (hPTMs) and variants, chromatin-binding proteins, including transcription factors, and DNA methylation. The proteomic characterization of chromatin composition at distinct functional regions has been so far hampered by the lack of efficient protocols to enrich such domains at the appropriate purity and amount for the subsequent in-depth analysis by Mass Spectrometry (MS). We describe here a newly designed chromatin proteomics strategy, named ChroP (Chromatin Proteomics), whereby a preparative chromatin immunoprecipitation is used to isolate distinct chromatin regions whose features, in terms of hPTMs, variants and co-associated non-histonic proteins, are analyzed by MS. We illustrate here the setting up of ChroP for the enrichment and analysis of transcriptionally silent heterochromatic regions, marked by the presence of tri-methylation of lysine 9 on histone H3. The results achieved demonstrate the potential of ChroP in thoroughly characterizing the heterochromatin proteome and prove it as a powerful analytical strategy for understanding how the distinct protein determinants of chromatin interact and synergize to establish locus-specific structural and functional configurations.

By combining native and crosslinking chromatin immunoprecipitation with high-resolution Mass Spectrometry, ChroP approach enables to dissect the composite proteomic architecture of histone modifications, variants and non-histonic proteins synergizing at functionally distinct chromatin domains.

Chromatin is a highly dynamic nucleoprotein complex made of DNA and proteins that controls various DNA-dependent processes. Chromatin structure and ...

Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex&#39;s chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes.

This protocol describes a procedure for generating and purifying wild type and mutant versions of the human INO80 chromatin remodeling complex. Epitope tagged versions of INO80 subunits are stably expressed in HEK293 cells, and complete complexes and complexes lacking specific sets of subunits are purified by immunoaffinity chromatography.

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 ...

Identification of MyoD Interactome Using Tandem Affinity Purification Coupled to Mass Spectrometry

Skeletal muscle terminal differentiation starts with the commitment of pluripotent mesodermal precursor cells to myoblasts. These cells have still the ability to proliferate or they can differentiate and fuse into multinucleated myotubes, which maturate further to form myofibers. Skeletal muscle terminal differentiation is orchestrated by the coordinated action of various transcription factors, in particular the members of the Muscle Regulatory Factors or MRFs (MyoD, Myogenin, Myf5, and MRF4), also called the myogenic bHLH transcription factors family. These factors cooperate with chromatin-remodeling complexes within elaborate transcriptional regulatory network to achieve skeletal myogenesis. In this, MyoD is considered the master myogenic transcription factor in triggering muscle terminal differentiation. This notion is strengthened by the ability of MyoD to convert non-muscle cells into skeletal muscle cells. Here we describe an approach used to identify MyoD protein partners in an exhaustive manner in order to elucidate the different factors involved in skeletal muscle terminal differentiation. The long-term aim is to understand the epigenetic mechanisms involved in the regulation of skeletal muscle genes, i.e., MyoD targets. MyoD partners are identified by using Tandem Affinity Purification (TAP-Tag) from a heterologous system coupled to mass spectrometry (MS) characterization, followed by validation of the role of relevant partners during skeletal muscle terminal differentiation. Aberrant forms of myogenic factors, or their aberrant regulation, are associated with a number of muscle disorders: congenital myasthenia, myotonic dystrophy, rhabdomyosarcoma and defects in muscle regeneration. As such, myogenic factors provide a pool of potential therapeutic targets in muscle disorders, both with regard to mechanisms that cause disease itself and regenerative mechanisms that can improve disease treatment. Thus, the detailed understanding of the intermolecular interactions and the genetic programs controlled by the myogenic factors is essential for the rational design of efficient therapies.

MyoD is a myogenic transcription factor with a strong capacity to induce myogenic transdifferentiation of many fully differentiated non-muscle cell lines. The epigenetic mechanisms involved in this transdifferentiation are largely unknown. Here we describe a double-affinity purification method followed by mass spectrometry to exhaustively characterize MyoD partners.

Skeletal muscle terminal differentiation starts with the commitment of pluripotent mesodermal precursor cells to myoblasts. These cells have still the ...

The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5&#39; DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

Here, we present a protocol to achieve near base pair resolution of protein-DNA interactions. This is obtained by exonuclease treatment of DNA fragments selectively enriched by chromatin immunoprecipitation (ChIP-exo) followed by high throughput sequencing.

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA ...

Chromatin Extraction from Frozen Chimeric Liver Tissue for Chromatin Immunoprecipitation Analysis

Crosslinking Chromatin Immunoprecipitation (X-ChIP) is a widely used technique to assess levels of histone marks and occupancy of transcription factors on host and/or pathogen chromatin. Chromatin preparation from tissues creates additional challenges that need to be overcome to obtain reproducible and reliable protocols comparable to those used for cell culture. Tissue disruption and fixation are critical steps to achieve efficient shearing of chromatin. Coexistence of different cell types and clusters may also require different shearing times to reach optimal fragment size and hinders shearing reproducibility. The purpose of this method is to achieve reliable and reproducible host chromatin preparations from frozen tissue (liver) suitable for both ChIP-qPCR and next generation sequencing (NGS) applications. We observed that the combination of liquid nitrogen tissue pulverization followed by homogenization leads to increased reproducibility compared to homogenization only, since it provides a suspension consisting mostly of dissociated single cells that can be efficiently sheared. Moreover, the fixation step should be performed under mild rotation to provide homogeneous crosslinking. The fixed material is then suitable for buffer-based nuclei isolation, to reduce contamination of cytoplasmic protein and pathogen DNAs and RNAs (when applicable), avoiding time-consuming centrifugation gradients. Subsequent sonication will complete nuclear lysis and shear the chromatin, producing a specific size range according to the chosen shearing conditions. The size range should fall between 100 and 300 nt for NGS applications, while it could be higher (300-700 nt) for ChIP-qPCR analysis. Such protocol adaptations can greatly improve chromatin analyses from frozen tissue specimens.

This protocol focuses on chromatin preparation from snap frozen tissues and it is suitable for Crosslinking Chromatin Immunoprecipitation (X-ChIP) followed by either quantitative PCR analysis (X-ChIP-qPCR) or next generation sequencing approaches (X-ChIP-seq).

Crosslinking Chromatin Immunoprecipitation (X-ChIP) is a widely used technique to assess levels of histone marks and occupancy of transcription factors on ...

High-Quality Sample Preparation for Multiome 10X Genomics Analysis

High-Quality Brain and Bone Marrow Nuclei Preparation for Single Nuclei Multiome Assays

Single-cell analysis has become the approach of choice for unraveling the complexity of biological processes that require assessing the variability of individual cellular responses to treatment or infection with single-cell resolution. 
Many techniques for single-cell molecular profiling have been developed over the past 10 years, and several dedicated technologies have been commercialized. The 10X Genomics droplet-based single-cell profiling is a widespread technology that offers ready-to-use reagents for transcriptomic and multi-omic single-cell profiling. The technology includes workflows for single-cell and single-nuclei RNA sequencing (scRNA-Seq and snRNA-Seq, respectively), scATAC-Seq, single-cell immune profiling (BCR/TCR sequencing), and multiome. The latter combines transcriptional (scRNA-Seq) and epigenetic information (scATAC-Seq) coming from the same cell. 
The quality (viability, integrity, purity) of single-cell or single-nuclei suspensions isolated from tissues and analyzed by any of these approaches is critical for generating high-quality data. Therefore, the sample preparation protocols should be adapted to the particularities of each biological tissue and ensure the generation of high-quality cell and nuclei suspensions.
This article describes two protocols for preparing brain and bone marrow samples for the downstream multiome 10X Genomics pipeline. The protocols are performed stepwise and cover tissue dissociation, cell sorting, nuclei isolation, and quality control of prepared nuclei suspension that is used as starting material for cell partitioning and barcoding, library preparation, and sequencing. These standardized protocols produce high-quality nuclei libraries and robust and reliable data.

Author Spotlight: Advancing Biomedical Research Through Single Cell Analysis 

The success of single-cell/single-nuclei transcriptomics and multi-omics largely depends on the quality of cells/nuclei. Therefore, isolating cells/nuclei from tissue and their purification must be highly standardized. This protocol describes the preparation of nuclei from the brain and bone marrow for downstream single-nuclei multiome assay.

Single-cell analysis has become the approach of choice for unraveling the complexity of biological processes that require assessing the variability of ...

A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video