This work was supported by grants from the Mexican Council for Science and Technology (Conacyt, 207268 and 233395 to Michael Schnoor). KFCO is a recipient of a Conacyt stipend (396260) to obtain an MSc degree.

All animal experiments have been approved by the Institutional Animal Care and Use Committee of Cinvestav.
1. Preparation of DSS Drinking Water and the Induction of Colitis
<ol>
	<li>Prepare a 3.5% w/v dextran sulfate sodium (DSS) solution in autoclaved drinking water. DSS dissolves easily and it is not required to filter the final solution. 
	NOTE: 7 days of DSS treatment induces severe colitis. If inducing mild colitis, 3 - 4 days of treatment are recommended. As long as the DSS drinking water stays clear, it is not necessary to change the water. However, if it turns turbid, it must be replaced.</li>
	<li>Record the baseline weight of male mice. Ensure that they are 8 - 12 weeks of age and within a range of 21 - 25 g bodyweight. 
	NOTE: The appropriate DSS concentration must be optimized in each laboratory. Results can greatly vary, depending upon the housing conditions. Concentrations between 2.5 - 5% are usually reported to induce strong colitis in C57Bl/6J WT mice10. DSS from different companies and different lots should be tested, as results may also vary with different sources of DSS.</li>
	<li>Provide water ad libitum and replace it with fresh 3.5% DSS water if necessary.</li>
</ol>
2. Application of Nutritional Supplements by Gavage
<ol>
	<li>Prepare a &#34;feedable&#34; solution of the desired nutritional supplements in an appropriate solvent. For this study, we used a mixture containing 200 mg/kg L-arginine, 83 mg/kg vitamin C, 46 mg/kg vitamin E, 77 mg/kg eicosapentaenoic acid (EPA), and 115 mg/kg docosahexaenoic acid (DHA) in a 1:1 solution of water and safflower oil.</li>
	<li>Fill a 1-mL syringe connected to a gavage needle (15 G x 50 mm) with the nutritional supplement mixture. Wipe the outside of the gavage needle to remove any compound outside of the needle and to ensure proper dose application.</li>
	<li>Restrain the mouse by grasping the base of the tail with one hand and by firmly gripping a skin fold at the back of the neck with the thumb and forefinger of the other hand. Place the tail between the third finger and the base of the thumb of the same hand that holds the neck.</li>
	<li>While maintaining the mouse in an upright position, insert the needle into the left side of the animal&#39;s mouth and carefully follow the roof of the mouth to locate the esophagus. If no resistance is encountered, advance the needle towards the stomach. 
	NOTE: Verify that the animal is breathing properly before proceeding.</li>
	<li>Administer the mixture slowly, remove the tube by slowly pulling out the syringe, and release the mouse. Apply nutritional supplements once daily by gavage during the course of the colitis experiment.</li>
</ol>
3. Determination of the Disease Activity Index
NOTE: The disease activity index is the combination of the scores for weight loss, perianal bleeding, and stool consistency, which are obtained daily13.
<ol>
	<li>Measure the bodyweight daily and assign a score of 0 to 4 according to the weight loss percentage (0: 0%, 1: 1 - 5%, 2: 5 - 10%, 3: 10 - 20%, and 4: &#62; 20%). 
	NOTE: Bodyweight loss is determined by calculating the difference in percent between the basal weight before the induction of DSS-colitis and the actual weight.</li>
	<li>To determine the level of perianal bleeding, collect a fresh stool sample and use the provided applicators to apply a thin smear on a slide from a guaiac fecal occult blood test kit. Use a fresh applicator for each sample.
	<ol>
		<li>Close the cover on the front and open the window on the back of the slide. Apply two drops of the developer solution to the back at the sample location.</li>
		<li>Read the results after 30 s. Any trace of blue color is positive for occult blood. Assign a score of 0 to 4 (0: none, 0.5 - 2.5: positive guaiac fecal occult blood test (depending upon the signal strength), and 3 - 4: gross bleeding). 
		NOTE: If blood in the stool is visible, the guaiac fecal occult blood test does not have to be performed, and a score of 3, 3.5, or 4 is assigned, depending upon the amount of visible blood.</li>
	</ol>
	</li>
	<li>Determine stool consistency by observing a fresh stool sample. Assign a score of 0 to 4 (0: normal/solid, 0.5 - 2.5: pasty stool, and 3 - 4: diarrhea).</li>
</ol>
4. Determining Intestinal Epithelial Permeability In Vivo by Evans Blue Assay
<ol>
	<li>Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.</li>
	<li>Place the anesthetized animals in a supine position and perform a laparotomy to expose the intestines.</li>
	<li>Locate the cecum and make a small incision in the proximal segment of the colon ascendens (ideally, immediately adjacent to the cecum).</li>
	<li>Insert a feeding needle (G22) and secure it with a ligature using a common silk thread. Carefully flush abundant PBS through the tube to rinse out all feces from the colon. Instill Evans blue solution (1.5% w/v in PBS) into the colon until it reaches the anus.</li>
	<li>Incubate the Evans blue for 15 min. Wash out the dye by flushing the tube with abundant PBS until the perianal washout is clear.</li>
	<li>Euthanize the animals by cervical dislocation.</li>
	<li>Excise the colon and rinse it again with abundant PBS. Rinse once with 1 mL of 6 mM N-acetylcysteine in PBS to eliminate any dye sticking to the colonic mucus.</li>
	<li>Cut the colon longitudinally and rinse it once more with PBS and 1 mL of 6 mM N-acetylcysteine.</li>
	<li>Record the weight and length. To extract the Evans blue dye, place the colon in 2 mL of N,N-dimethylformamide overnight at room temperature with gentle agitation. Measure the dye concentration spectrophotometrically at 610 nm.</li>
</ol>
5. Tissue Collection
<ol>
	<li>Anesthetize the animals by injecting them intraperitoneally with a mixture of ketamine (100 mg/kg of bodyweight) and xylazine (13 mg/kg of bodyweight) diluted in saline solution (0.9% NaCl), and assess the depth of anesthesia by monitoring the pinch withdrawal reflex.</li>
	<li>Euthanize the animals by cervical dislocation.</li>
	<li>Place the animals in a supine position and perform a laparotomy to expose the abdominal cavity.</li>
	<li>Using scissors, dissect the entire colon and record its length.</li>
	<li>Flush the colon carefully several times with chilled PBS to remove the feces. Record the tissue weight and prepare for the following experiments, as described in steps 5.6 - 5.8.</li>
	<li>For RNA isolation and myeloperoxidase (MPO) assays, cut off an appropriately-sized tissue sample (100 mg is usually sufficient), place it inside a tube, and snap-freeze it in liquid nitrogen. Store the tissues at -80 &#176;C for future use.</li>
	<li>For immunofluorescence staining and oxidative stress determination (see below), cut a small colon sample (0.5 - 1 cm) and submerse it in small aluminum cups filled with optimal cutting temperature (OCT) compound. Place the cups on dry ice and let them freeze slowly, in order to avoid bubble formation. Frozen tissue samples can be stored at -80 &#176;C for future use.</li>
	<li>For Swiss rolls14, open the colon longitudinally and carefully remove feces using forceps. Roll it up, with the mucosa facing inwards, using fine-tipped forceps or a thin, round wooden stick. Carefully place it inside an embedding cassette and continue with step 6.1. 
	NOTE: DSS induces damage in the colon. However, damage distribution varies from the proximal to the distal colon, with most damage usually seen in the distal colon and rectum. Thus, we recommend analyzing the histology either in the distal colon or in Swiss roles of the entire colon.</li>
</ol>
6. Analysis of Colon Histology by Hematoxylin-eosin Staining
<ol>
	<li>Tissue Preparation
	<ol>
		<li>For the histological analysis, submerge either the Swiss rolls or the small tissue pieces from certain colon regions of control and treated mice in 5 mL of 10% formaldehyde for 48 h at room temperature (RT) to achieve proper fixation. 
		NOTE: All further steps in step 6 are carried out at RT, unless otherwise indicated.</li>
		<li>Wash them with tap water for 18 h.</li>
		<li>Dehydrate them with 15 mL of 70% ethanol for 1 h, 96% for 1 h, and absolute ethanol for 1 h. Repeat each step with fresh alcohol before proceeding to the next concentration.</li>
		<li>Continue the dehydration in a mixture of 7.5 mL of absolute ethanol and 7.5 mL of absolute xylene for 1 h. Repeat once before passing the samples to 15 mL of absolute xylene for 1 h. Repeat this step once with fresh xylene.</li>
	</ol>
	</li>
	<li>Embedding Colon Tissue Samples in Paraffin
	<ol>
		<li>Immerse the samples in 50 mL of liquid paraffin for 17 h. Repeat this step once but for only 3 h.</li>
		<li>Immerse the samples in cubes (plastic, square mold, size: 22 x 22 x 22 mm) in 810 mL of liquid paraffin.</li>
		<li>Allow the paraffin with the colon tissue samples to solidify for 24 h at RT.</li>
	</ol>
	</li>
	<li>Cutting Tissue Cross-sections using a Microtome
	<ol>
		<li>Cut colon samples using a microtome, according to the manufacturer&#39;s instructions, at a thickness of 5 &#181;m.</li>
		<li>Collect the cuts in a water bath (1 L) containing 0.3% gelatin. This prevents the folding of tissue cross-sections. Recover the tissue sections and mount them on glass slides.</li>
	</ol>
	</li>
	<li>Hematoxylin and Eosin Staining of Tissue Cross-sections
	<ol>
		<li>Deparaffinize the samples for 18 h at 60 &#176;C in an incubator. For this purpose, use a glass slide rack with a handle.</li>
		<li>After deparaffinization, immerse the slides in 70 mL of absolute xylene for 5 min. Repeat this step once with fresh xylene.</li>
		<li>Transfer the samples into 70 mL of absolute alcohol for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the colon tissue samples in 70 mL of ethanol 96% for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the tissues in Harris hematoxylin for 7 min.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the samples in acidic alcohol (70 mL of ethanol 70% and 700 &#181;L of 1 M hydrochloric acid) for 7 s.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the tissue samples in 70 mL of lithium carbonate (1 g of lithium carbonate in 100 mL of distillated water) for 7 s.</li>
		<li>Wash the samples in tap water twice for 2 s.</li>
		<li>Incubate the samples in 70 mL of ethanol 80% for 1 min.</li>
		<li>Transfer the samples into 70 mL of Eosin-Y for 15 s.</li>
		<li>Incubate them in 70 mL of 96% ethanol for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the tissue samples in 70 mL of absolute ethanol (ethyl alcohol absolute anhydrous) for 1 min. Repeat this step once with fresh alcohol.</li>
		<li>Incubate the samples in 70 mL of a mixture of 35 mL of absolute alcohol and 35 mL of absolute xylene for 1 min.</li>
		<li>Transfer the samples into 70 mL of absolute xylene for 1 min. Repeat this step for 5 min in 70 mL of fresh absolute xylene.</li>
		<li>Add 80 &#181;L of synthetic resin to the colon tissue samples, cover them with coverslips, and let them dry for 24 h at RT. Finally, analyze the samples using bright-field microscopy8.</li>
	</ol>
	</li>
</ol>
7. Analyzing Junction Composition by Immunofluorescence
<ol>
	<li>Prepare the tissue as described in step 5.7 and cut 8 &#181;m-thick cross-sections using a cryostat.</li>
	<li>Fix and permeabilize colon cross-sections with 96% ethanol at -20 &#176;C for 20 min. 
	NOTE: All subsequent incubations should be carried out at RT, unless otherwise stated, in a humid dark box to prevent drying and fluorochrome fading.</li>
	<li>Air-dry samples, and then rinse them 3 times for 5 min each with 1x PBS</li>
	<li>Incubate the samples with blocking solution (PBS containing 0.01% Tween and 2% BSA) for 2 h.</li>
	<li>Remove the blocking solution and rinse it with PBS-0.01% Tween for 10 min.</li>
	<li>During this time, dilute the primary antibodies to the desired concentrations in PBS-0.01% Tween.</li>
	<li>Remove the washing solution, apply the antibody solution from the previous step, and incubate overnight at 4 &#176;C in a humidified box.</li>
	<li>Remove the antibody solution and wash 3 times with PBS-0.01% Tween for 5 min each and once with deionized water for 10 min, with very gentle agitation.</li>
	<li>While washing, centrifuge fluorochrome&#173;conjugated, species-specific secondary antibodies at 14,000 x g for 20 min at 4 &#176;C.</li>
	<li>Dilute the secondary antibodies without precipitates as indicated by the provider in PBS-0.01% Tween, apply them, and incubate for 1 h at RT.</li>
	<li>Repeat step 7.8 and remove the washing solution as completely as possible.</li>
	<li>Pipette 4 &#181;L of anti-fading agent over each sample on the slide.</li>
	<li>Cover the samples with a coverslip.</li>
	<li>Air dry for 1 h.</li>
	<li>Seal slide with nail polish. Slides can be stored at -20 &#176;C until further analysis.</li>
	<li>Analyze on a confocal laser microscope8.</li>
</ol>
8. Determination of Oxidative Stress by Oxidation of Ethidium
<ol>
	<li>After 7 days of DSS colitis, prepare tissue as described in step 5.7 and cut colon sections in a cryostat at a thickness of 5 &#181;m. Mount cross-sections onto glass slides treated with poly-L-lysine solution and incubate the samples with 5 &#181;M of dihydroethidium (DHE) in water at 37 &#176;C for 30 min in the dark.</li>
	<li>Wash the samples with PBS (pH 7.6) three times for 15 min each with gentle agitation at RT. Air dry the samples and add a drop of mounting medium to protect the fluorescence. Observe the fluorescence of oxidized ethidium on a laser-scanning confocal microscope (40X magnification, 568 nm wavelength).</li>
</ol>
9. Analysis of Leukocyte Recruitment by MPO Assay
<ol>
	<li>After 7 days of DSS colitis, collect colon tissue and homogenize the samples (200 - 400 mg) with 1 mL of hexadecyltrimethylammonium (HTAB) buffer (0.5% HTAB in 50 mM phosphate buffer, pH 6.0) using a homogenizer on ice.</li>
	<li>Rinse the tip of the homogenizer twice with 1 mL of HTAB buffer to include all tissue in the lysate and sonicate it five times at 40% amplitude for 10 s each. Freeze-thaw in liquid nitrogen three times.</li>
	<li>Centrifuge at 14,000 x g for 15 min and collect the supernatant. Prepare 2,2&#39;-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS) solution by mixing ABTS, 5 mL of sodium citrate (1 M in water), 0.1 mL of hydrogen peroxide, and 45 mL of bi-distilled water.</li>
	<li>Mix 0.1 mL of each supernatant with 0.1 mL of ABTS solution in a 96-well flat-bottomed plate. After 10 min, measure the absorbance at 460 nm using a spectrophotometer.</li>
</ol>
10. Evaluating the Expression of Pro-inflammatory Cytokines by PCR
<ol>
	<li>Tissue Homogenization
	<ol>
		<li>Homogenize 50 to 100 mg of colon tissue samples in 1 mL of an acid guanidinium thiocyanate-phenol-chloroform mixture using a power homogenizer.</li>
		<li>Incubate it at room temperature for 15 min.</li>
	</ol>
	</li>
	<li>Phase Separation
	<ol>
		<li>Add 0.2 mL of chloroform and shake vigorously for 30 s.</li>
		<li>Incubate at 4 &#176;C for 30 min.</li>
		<li>Centrifuge at 12,000 x g for 60 min at 4 &#176;C.</li>
		<li>Transfer the upper aqueous phase into a fresh tube (~500 &#181;L).</li>
	</ol>
	</li>
	<li>RNA Precipitation and Resuspension
	<ol>
		<li>Add 0.5 mL of isopropyl alcohol and incubate the samples at 4 &#176;C for 60 min.</li>
		<li>Centrifuge at 12,000 x g for 30 min at 4 &#176;C.</li>
		<li>Remove the supernatant completely.</li>
		<li>Add 1 mL of ethanol 75% and vortex.</li>
		<li>Centrifuge at 12,000 x g for 30 min at 4 &#176;C.</li>
		<li>Remove the supernatant.</li>
		<li>Allow the remaining ethanol to air-dry for 3-5 min. 
		NOTE: It is important not to let the RNA pellet dry completely, as this will greatly decrease its solubility.</li>
		<li>Re-dissolve the pellet in 0.3 mL of diethylpyrocarbonate (DEPC)-treated water. Immediately transcribe the RNA samples into cDNA (more stable, see step 10.5) or store at -80 &#176;C.</li>
	</ol>
	</li>
	<li>RNA Quantification
	<ol>
		<li>Dilute 1 &#181;L of RNA with 99 &#181;L of DEPC-treated water.</li>
		<li>Read the OD at 260 nm and 280 nm using a UV/VIS spectrophotometer to determine sample concentration and purity.</li>
	</ol>
	</li>
	<li>cDNA Synthesis
	<ol>
		<li>Mix RNA samples (1-5 &#181;g) with 1 &#181;L of Oligo(dT)12-18 (0.5 &#181;g/&#181;L) and DEPC-treated water (total volume of 12 &#181;L) in RNase-free sterile tubes.</li>
		<li>Incubate at 70 &#176;C for 10 min.</li>
		<li>Add 2 &#181;L of 10x PCR Buffer, 1 &#181;L of 50 mM MgCl2, 1 &#181;L of 10 mM dNTP mix, and 2 &#181;L of 0.1 M dithiothreitol (DTT).</li>
		<li>Incubate at 4 &#176;C for 5 min.</li>
		<li>Add 1 &#181;L of reverse transcriptase and incubate at 42 &#176;C for 5 min.</li>
		<li>Incubate at 70 &#176;C for 15 min.</li>
		<li>Incubate at 4 &#176;C for 15 min. cDNA can be stored at -20 &#176;C until further use.</li>
	</ol>
	</li>
	<li>PCR
	<ol>
		<li>Mix 2.5 &#181;L of 10x PCR Buffer, 1.5 &#181;L of 25 mM MgCl2, 0.5 &#181;L of 10 mM dNTP mix, 0.25 &#181;L of Taq DNA polymerase, 0.25 &#181;L of each primer (10 &#181;M) and cDNA (100 ng), and sterile water to a total volume of 25 &#181;L.</li>
		<li>Run the samples on a 96-well thermal cycler. To prevent amplification of genomic DNA, forward and reverse primers should be located in different exons: IL1&#946;-FW: GCAACTGTTCCTGAACTCAACT and IL1&#946;-RE: TCTTTTGGGGTCCGTCAACT; IL6-FW: CCTTCCTACCCCAATTTCCAA and IL6-RE: AGATGAATTGGATGGTCTTGGTC; KC-FW: TGTCAGTGCCTGCAGACCAT and KC-RE: CCTGAGGGCAACACCTTCA; and Actin-FW: TATCCACCTTCCAGCAGATGT and Actin-RE: AGCTCAGTAACAGTCCGCCTA. Use the following PCR conditions: 95 &#176;C for 5 min followed by 30 cycles at 95 &#176;C for 15 s, 58 &#176;C for 30 s, and 72 &#176;C for 30 s, plus a final extension for 10 min at 72 &#176;C.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Souza, H. S., Fiocchi, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunopathogenesis+of+IBD:+current+state+of+the+art.">Immunopathogenesis of IBD: current state of the art.</a> Nat Rev Gastroenterol Hepatol. 13, 13-27 (2016).</li><li>Xavier, R. J., Podolsky, D. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unravelling+the+pathogenesis+of+inflammatory+bowel+disease.">Unravelling the pathogenesis of inflammatory bowel disease.</a> Nature. 448, 427-434 (2007).</li><li>Neuman, M. G., Nanau, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inflammatory+bowel+disease:+role+of+diet,+microbiota,+life+style.">Inflammatory bowel disease: role of diet, microbiota, life style.</a> Transl Res. 160, 29-44 (2011).</li><li>Lowenberg, M., D'Haens, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Next-Generation+Therapeutics+for+IBD.">Next-Generation Therapeutics for IBD.</a> Current Gastroenterol Rep. 17, 21 (2015).</li><li>Bernstein, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Does+everyone+with+inflammatory+bowel+disease+need+to+be+treated+with+combination+therapy.">Does everyone with inflammatory bowel disease need to be treated with combination therapy.</a> Curr Opin Gastroenterol. , (2016).</li><li>Nanau, R. M., Neuman, M. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutritional+and+probiotic+supplementation+in+colitis+models.">Nutritional and probiotic supplementation in colitis models.</a> Dig Dis Sci. 57, 2786-2810 (2012).</li><li>Yamamoto, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nutrition+and+diet+in+inflammatory+bowel+disease.">Nutrition and diet in inflammatory bowel disease.</a> Curr Opin Gastroenterol. 29, 216-221 (2013).</li><li>Vargas Robles, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+Colitis+Is+Attenuated+by+Cardioprotective+Diet+Supplementation+That+Reduces+Oxidative+Stress,+Inflammation,+and+Mucosal+Damage.">Experimental Colitis Is Attenuated by Cardioprotective Diet Supplementation That Reduces Oxidative Stress, Inflammation, and Mucosal Damage.</a> Ox Med Cell Longev. , 8473242 (2016).</li><li>Vargas-Robles, H., Rios, A., Arellano-Mendoza, M., Escalante, B. A., Schnoor, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antioxidative+diet+supplementation+reverses+high-fat+diet-induced+increases+of+cardiovascular+risk+factors+in+mice.">Antioxidative diet supplementation reverses high-fat diet-induced increases of cardiovascular risk factors in mice.</a> Ox Med Cell Longev. 2015, 467471 (2015).</li><li>Perse, M., Cerar, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulphate+colitis+mouse+model:+traps+and+tricks.">Dextran sodium sulphate colitis mouse model: traps and tricks.</a> J Biomed Biotechnol. 2012, 718617 (2012).</li><li>Chassaing, B., Aitken, J. D., Malleshappa, M., Vijay-Kumar, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sulfate+sodium+(DSS)-induced+colitis+in+mice.">Dextran sulfate sodium (DSS)-induced colitis in mice.</a> Curr. Protoc. Immunol. 104, 25 (2014).</li><li>Laroui, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+(DSS)+induces+colitis+in+mice+by+forming+nano-lipocomplexes+with+medium-chain-length+fatty+acids+in+the+colon.">Dextran sodium sulfate (DSS) induces colitis in mice by forming nano-lipocomplexes with medium-chain-length fatty acids in the colon.</a> PLoS One. 7, 32084 (2009).</li><li>Mennigen, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probiotic+mixture+VSL#3+protects+the+epithelial+barrier+by+maintaining+tight+junction+protein+expression+and+preventing+apoptosis+in+a+murine+model+of+colitis.">Probiotic mixture VSL#3 protects the epithelial barrier by maintaining tight junction protein expression and preventing apoptosis in a murine model of colitis.</a> Am J Physiol Gastrointest Liver Physiol. 296, 1140-1149 (2009).</li><li>Park, C. M., Reid, P. E., Walker, D. C., MacPherson, B. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple,+practical+'swiss+roll'+method+of+preparing+tissues+for+paraffin+or+methacrylate+embedding.">A simple, practical 'swiss roll' method of preparing tissues for paraffin or methacrylate embedding.</a> J Microsc. 145, 115-120 (1987).</li><li>Shen, W., Gaskins, H. R., McIntosh, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Influence+of+dietary+fat+on+intestinal+microbes,+inflammation,+barrier+function+and+metabolic+outcomes.">Influence of dietary fat on intestinal microbes, inflammation, barrier function and metabolic outcomes.</a> J Nutr Biochem. , (2013).</li><li>Bruewer, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interferon-gamma+induces+internalization+of+epithelial+tight+junction+proteins+via+a+macropinocytosis-like+process.">Interferon-gamma induces internalization of epithelial tight junction proteins via a macropinocytosis-like process.</a> FASEB J. 19, 923-933 (2005).</li><li>Fournier, B. M., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+neutrophils+during+intestinal+inflammation.">The role of neutrophils during intestinal inflammation.</a> Muc Immunol. 5, 354-366 (2012).</li><li>Yan, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Temporal+and+spatial+analysis+of+clinical+and+molecular+parameters+in+dextran+sodium+sulfate+induced+colitis.">Temporal and spatial analysis of clinical and molecular parameters in dextran sodium sulfate induced colitis.</a> PLoS One. 4, 6073 (2009).</li><li>Maxwell, J. R., Viney, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Overview+of+mouse+models+of+inflammatory+bowel+disease+and+their+use+in+drug+discovery.">Overview of mouse models of inflammatory bowel disease and their use in drug discovery.</a> Curr Prot Pharmacol, S.J. Enna. , (2009).</li><li>Ostanin, D. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=T+cell+transfer+model+of+chronic+colitis:+concepts,+considerations,+and+tricks+of+the+trade.">T cell transfer model of chronic colitis: concepts, considerations, and tricks of the trade.</a> Am J Physiol Gastrointest Liver Physiol. 296, 135-146 (2009).</li><li>Randhawa, P. K., Singh, K., Singh, N., Jaggi, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+on+chemical-induced+inflammatory+bowel+disease+models+in+rodents.">A review on chemical-induced inflammatory bowel disease models in rodents.</a> Kor J Physiol Pharmacol. 18, 279-288 (2014).</li><li>Whittem, C. G., Williams, A. D., Williams, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+Colitis+modeling+using+Dextran+Sulfate+Sodium+(DSS).">Murine Colitis modeling using Dextran Sulfate Sodium (DSS).</a> JoVE. , (2010).</li><li>Wirtz, S., Neufert, C., Weigmann, B., Neurath, M. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+induced+mouse+models+of+intestinal+inflammation.">Chemically induced mouse models of intestinal inflammation.</a> Nat Prot. 2, 541-546 (2007).</li><li>Naydenov, N. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonmuscle+Myosin+IIA+Regulates+Intestinal+Epithelial+Barrier+in+vivo+and+Plays+a+Protective+Role+During+Experimental+Colitis.">Nonmuscle Myosin IIA Regulates Intestinal Epithelial Barrier in vivo and Plays a Protective Role During Experimental Colitis.</a> Sci Rep. 6, 24161 (2016).</li><li>Sumagin, R., Robin, A. Z., Nusrat, A., Parkos, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transmigrated+neutrophils+in+the+intestinal+lumen+engage+ICAM-1+to+regulate+the+epithelial+barrier+and+neutrophil+recruitment.">Transmigrated neutrophils in the intestinal lumen engage ICAM-1 to regulate the epithelial barrier and neutrophil recruitment.</a> Muc Immunol. 7, 905-915 (2014).</li><li>Laukoetter, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=JAM-A+regulates+permeability+and+inflammation+in+the+intestine+in+vivo.">JAM-A regulates permeability and inflammation in the intestine in vivo.</a> J Exp Med. 204, 3067-3076 (2007).</li><li>Viennois, E., Chen, F., Laroui, H., Baker, M. T., Merlin, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dextran+sodium+sulfate+inhibits+the+activities+of+both+polymerase+and+reverse+transcriptase:+lithium+chloride+purification,+a+rapid+and+efficient+technique+to+purify+RNA.">Dextran sodium sulfate inhibits the activities of both polymerase and reverse transcriptase: lithium chloride purification, a rapid and efficient technique to purify RNA.</a> BMC Res Notes. 6, 360 (2013).</li></ol>

The authors have nothing to disclose.

In order to use nutritional supplements in clinical studies, the benefits and safety of such supplements must be carefully evaluated in vivo in animal studies. In the case of colitis, several appropriate animal models that resemble the clinical signs of IBD have been established, including chemical models using DSS, TNBS, or acetic acid; knock-out (KO) models such as IL10-KO; and immune-cell-mediated colitis using adoptive T-cell transfer19-21. The DSS model of colitis is a rapid and reliable method of inducing colitis that resembles many disease symptoms of human IBD and has been used in a plethora of studies investigating the molecular mechanisms of colitis22. Moreover, DSS colitis is reversible and thus also allows for the study of tissue healing after the colitogenic stimulus has been removed. The provided protocol describes in detail the DSS colitis model that has been previously optimized in our laboratory8.
A disadvantage is that the optimization of the DSS concentration must be done in every laboratory, since environmental factors greatly affect disease development and progression23. Additionally, DSS must be in a molecular weight range of 40 - 50 kDa to induce colitis. For the unexperienced researcher, it will be important to develop an eye for an unbiased assessment of the DAI parameters of stool consistency and perianal bleeding. If the assessment is performed by an unexperienced researcher, it is recommendable to have a colleague confirm the assessment, ideally in a blinded fashion.
To analyze the intestinal epithelial permeability for macromolecules, three major methods have been used throughout the literature: the Evans blue dye assay, as described here; the instillation of 4-kDa FITC-dextran in an intestinal loop; and the feeding of 4-kDa FITC-dextran13,24,25. In the latter assay, FITC-dextran is fed by gavage, and the amount of FITC dextran that crossed the epithelium and leaked into the blood stream is measured fluorometrically from serum samples. In this assay, the permeability of the entire gastrointestinal tract is measured, since the tracer passes all the way from the esophagus to the rectum and most of the tracer will pass before reaching the colon. In the loop model, permeability is measured in a confined intestinal region used for the loop (usually the small intestine)25. In contrast, the Evans blue assay has the advantage that only epithelial permeability in the colon is measured, since the tracer is directly instilled into the entire colon. Thus, using this assay, we can conclude that the colonic epithelium is protected by the diet supplement.
It is always important to record the colon weight and length after extraction and before using the tissues for other assays, because some data (e.g., leaked Evans blue in the permeability assay) are expressed per g of tissue. Furthermore, the weight-to-length ratio is an independent read-out of tissue damage26. In general, tissue morphology is analyzed using paraffin-embedded tissues stained with hematoxylin and eosin, as described here. Paraffin embedding has the advantage that the tissue morphology is much better conserved compared to other embedding methods. This allows for the unequivocal identification of different cell types within the mucosa (i.e., immune cells, epithelium, goblet cells, etc.) and the analysis of tissue alterations during colitis, such as edema formation, leukocyte infiltration, and epithelial apical erosions. On the other hand, paraffin has the disadvantage that immunofluorescent staining can only be performed after time-consuming epitope recovery. Therefore, we always prepare different frozen tissue biopsies embedded in OCT compound. Such tissue samples can be easily sectioned using a cryostat and show low levels of autofluorescence. We use ethanol for fixation by dehydration because neither does it interfere with actin filaments (as methanol does), nor does it trigger autofluorescence (as PFA does). Using these techniques, we found that an anti-inflammatory and anti-oxidative diet supplement can improve tissue morphology and junction architecture during colitis (compare Figure 2).
Excessive neutrophil recruitment is a critical event during colitis that is induced by the production of chemoattractants in response to inflammation17. Neutrophil recruitment is a physiological event because neutrophils contribute to the removal of the inflammatory cue and to subsequent wound healing. However, if this innate immune response is not properly controlled and terminated, neutrophils in the mucosa can contribute to tissue damage by releasing proteases and reactive oxygen species. Neutrophils contain MPO, which can be easily measured and quantified using a colorimetric assay, where the amount of MPO is directly proportional to the number of neutrophils. Figure 3A shows that neutrophil recruitment increases during colitis and that dietary intervention can prevent this excessive and uncontrolled immune response. In accordance with the abundant neutrophil presence in the mucosa, oxidative stress increases during colitis (Figure 3B).
Our diet supplementation clearly protects the mucosa from oxidative stress, which is most likely a consequence of reduced neutrophil recruitment. As mentioned, neutrophils are attracted by chemokines and the production of chemokines is induced by pro-inflammatory cytokines that are secreted by various cell types during colitis. Thus, we assumed that reduced neutrophil recruitment is a consequence of reduced cytokine and chemokine production. Figure 3C demonstrates that the pro-inflammatory cytokines IL-1&#946; and IL-6, as well as the chemokine KC, are upregulated during DSS-induced colitis. The diet supplement reversed the levels of IL-6 back to control levels and ameliorated the increased production of IL-1&#946; and KC. Of note, KC is the most important chemoattractant for neutrophils in mice.
Thus, it is tempting to speculate that the observed preservation of tissue morphology is due to reduced neutrophil infiltration, which is, in turn, a consequence of the reduced production of KC. Analyzing RNA production in DSS-treated tissues by RT-PCR is problematic when residual DSS is present in the isolated RNA. This is because DSS inhibits both reverse transcriptases and Taq-polymerases. If no amplification can be achieved, it will be necessary to further purify the RNA samples by LiCl-mediated precipitation, as described elsewhere27.
In summary, we describe in detail different methods for the analysis of tissue damage during DSS colitis and how this damage can be ameliorated by dietary supplements. Knowledge gained from such animal experiments can justify the establishment of patient cohorts to investigate the protective effects of the analyzed supplements in human IBD. Data obtained from clinical studies may then open new avenues to develop alternative treatment strategies for the management of IBD.

Colitis is an inflammatory condition of the colon that can cause diarrhea and abdominal pain. Colitis can be acute, in response to infection or to stress, or it can develop as a chronic disease, such as in ulcerative colitis (UC), which belongs to the group of inflammatory bowel diseases (IBD). Although the clinical signs of UC have been well described, the pathogenesis is still poorly understood1. It is accepted among experts that UC is a multifactorial disease, with genetic mutations and aberrant immune responses playing a major role2. However, environmental factors, such as style of living and nutrition, also contribute to disease development and progression3.
Unfortunately, IBD is not curable, but there are many treatment options that aim to alleviate clinical symptoms. Current treatments include anti-inflammatory drugs, such as sulfasalazine and corticosteroids; immunosuppressants, such as azathioprine; monoclonal antibodies that capture pro-inflammatory cytokines, such as tumor necrosis factor-&#945; (TNF-&#945;), or block adhesion molecules, such as integrins, to reduce excessive leukocyte recruitment; and inhibitors that target kinases that trigger pro-inflammatory pathways, such as Janus kinase (JAK)4. Not all patients respond to all treatments, so therapeutic strategies must be individualized5. Furthermore, most of these therapeutic drugs interfere with the metabolism and immune responses, often causing severe side effects. For this reason, alternative treatment options have been investigated.
Alternative treatments include probiotics and nutritional supplements, which have been applied in animal models and clinical trials with varying levels of success6,7. We recently found that the application of different single nutritional supplements, such as anti-oxidative vitamins or &#969;3-poly-unsaturated fatty acids (PUFAs), is inferior to the application of a combination of such supplements in alleviating colitis and cardiovascular disease symptoms8,9. These studies were performed in mice, so clinical studies must be performed in humans to determine whether these findings will also be applicable to humans. Before clinical studies are initiated, the effectiveness and safety of new treatment options must be evaluated in animal models.
For IBD, the dextran sulfate sodium (DSS) model has been widely used to study the mechanisms of disease development and the beneficial effects of drugs and nutritional supplements6,10. In most studies, only an acute disease over a time period of seven days is induced; nevertheless, the clinical signs observed in these animals closely resemble those observed in IBD patients (i.e., bloody diarrhea, weight loss, epithelial dysfunction, and immune cell infiltration)10. DSS induces erosions in the mucosa, resulting in barrier dysfunction and in increased intestinal epithelial permeability11. The exact mechanism remains unknown. However, a study suggests that DSS interacts with medium chain-length fatty acids to form nano-lipocomplexes that are able to enter epithelial cells and to induce inflammatory signaling pathways12. In this article, we describe in detail how colitis is induced and analyzed in mice, how nutritional supplements are applied by gavage to ensure a constant dosage in each animal, and how the effects of such supplements on various colitis symptoms are examined.

<table><tbody><tr><td>0.3% of gelatin&amp;nbsp;</td><td>Bioxon</td><td>158</td><td></td></tr><tr><td>10% formaldehyde</td><td>J.T. Baker</td><td>2106-03</td><td></td></tr><tr><td>96-well plate with flat bottom</td><td>Corning</td><td>3368</td><td></td></tr><tr><td>Absolute ethanol&amp;nbsp;</td><td>J.T. Baker</td><td>9000-03</td><td></td></tr><tr><td>Absolute xylene</td><td>J.T. Baker</td><td>9490-03</td><td></td></tr><tr><td>ABTS</td><td>Sigma Aldrich</td><td>H5882</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Sigma-Aldrich</td><td>9048-46-8</td><td></td></tr><tr><td>ColoScreen</td><td>Helena Laboratories</td><td>5072</td><td></td></tr><tr><td>Corabion (Kindly provided by Merck, Naucalpan, Mexico)</td><td>Merck</td><td></td><td></td></tr><tr><td>Dextran Sulfate Sodium Salt</td><td>Affymetrix</td><td>9011-18-1</td><td>(M.W. 40,000-50,000)</td></tr><tr><td>Dihydroethidium</td><td>Life Technology</td><td>D11347</td><td></td></tr><tr><td>Eosin-Y&amp;nbsp;</td><td>J.T. Baker</td><td>L087-03</td><td></td></tr><tr><td>Evans blue</td><td>Sigma-Aldrich</td><td>314-13-6</td><td></td></tr><tr><td>Feeding&amp;nbsp; needle</td><td>Cadence Science Inc.</td><td>9921</td><td></td></tr><tr><td>Glass slide rack with handle</td><td>Electron Microscopy</td><td>70312-16</td><td></td></tr><tr><td>Glass Slides</td><td>Corning</td><td>2947</td><td></td></tr><tr><td>Harris hematoxylin&amp;nbsp;</td><td>Sigma-Aldrich</td><td>H3136</td><td></td></tr><tr><td>Hexadecyltrimethyammonium (HTAB)</td><td>Sigma Aldrich</td><td>H6269</td><td></td></tr><tr><td>Histosette (Embedding cassette)</td><td>Simport</td><td>M498.2</td><td></td></tr><tr><td>Hydrochloric acid 1 M</td><td>J.T. Baker</td><td>9535-62</td><td></td></tr><tr><td>Hydrogen peroxide</td><td>Sigma Aldrich</td><td>H3410</td><td></td></tr><tr><td>Ketamine</td><td>PiSA Agropecuaria</td><td>Q-7833-028</td><td></td></tr><tr><td>Liquid paraffin&amp;nbsp;</td><td>Paraplast</td><td>39501-006</td><td></td></tr><tr><td>Lithium carbonate&amp;nbsp;</td><td>Sigma-Aldrich</td><td>2362</td><td></td></tr><tr><td>&lt;em&gt;N,N&lt;/em&gt;-dimethylformamide</td><td>J.T. Baker</td><td>68-12-2</td><td></td></tr><tr><td>&lt;em&gt;N&lt;/em&gt;-acetylcysteine</td><td>Sigma-Aldrich</td><td>A9165</td><td></td></tr><tr><td>Plastic cubes</td><td>Electron Microscopy</td><td>70181</td><td></td></tr><tr><td>Poly-L-Lysine Solution</td><td>Sigma-Aldrich</td><td>25988-63-0</td><td></td></tr><tr><td>Prism 5 statistical software</td><td>GraphPad Software</td><td>Prism 5</td><td></td></tr><tr><td>Saline Solution 0.9% NaCl</td><td>CS PiSA</td><td>Q-7833-009</td><td></td></tr><tr><td>Sodium citrate</td><td>Sigma-Aldrich</td><td>W302600</td><td></td></tr><tr><td>Synthetic resin&amp;nbsp;</td><td>Poly Mont</td><td>7987</td><td></td></tr><tr><td>Taq DNA polymerase</td><td>Invitrogen</td><td>11615-010</td><td></td></tr><tr><td>Tissue-tek. O.C.T Compound</td><td>Sakura Finetek</td><td>4583</td><td></td></tr><tr><td>Tuberculine Syringe</td><td>BD Plastipak</td><td>305945</td><td></td></tr><tr><td>Tween 20</td><td>Sigma-Aldrich</td><td>9005-64-5</td><td></td></tr><tr><td>VECTASHIELD Antifade Mounting Medium with DAPI</td><td>Vector Laboratories</td><td>H-1200</td><td></td></tr><tr><td>Xylazine</td><td>PiSA Agropecuaria</td><td>Q-7833-099</td><td></td></tr></tbody></table>

analyzing beneficial effects of nutritional supplements on intestinal epithelial barrier functions during experimental colitis

Inflammatory bowel diseases (IBD), including Crohn&#39;s disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause severe problems, such as abdominal cramping, bloody diarrhea, and weight loss, in affected individuals. Unfortunately, there is no cure yet, and treatments only aim to alleviate symptoms. Current treatments include anti-inflammatory and immunosuppressive drugs that may cause severe side effects. This warrants the search for alternative treatment options, such as nutritional supplements, that do not cause side effects. Before their application in clinical studies, such compounds must be rigorously tested for effectiveness and security in animal models. A reliable experimental model is the dextran sulfate sodium (DSS) colitis model in mice, which reproduces many of the clinical signs of ulcerative colitis in humans. We recently applied this model to test the beneficial effects of a nutritional supplement containing vitamins C and E, L-arginine, and &#969;3-polyunsaturated fatty acids (PUFA). We analyzed various disease parameters and found that this supplement was able to ameliorate edema formation, tissue damage, leukocyte infiltration, oxidative stress, and the production of pro-inflammatory cytokines, leading to an overall improvement in the disease activity index. In this article, we explain in detail the correct application of nutritional supplements using the DSS colitis model in C57Bl/6 mice, as well as how disease parameters such as histology, oxidative stress, and inflammation are assessed. Analyzing the beneficial effects of different diet supplements may then eventually open new avenues for the development of alternative treatment strategies that alleviate IBD symptoms and/or that prolong the phases of remission without causing severe side effects.

Diet Supplements Can Protect from DSS Colitis
Anti-inflammatory and anti-oxidative diet supplements, such as vitamin C, vitamin E, the nitric oxide (NO)-source L-arginine, and &#969;3-polyunsaturated fatty acids (&#969;3-PUFAs), have been used with varying success in animal models to alleviate signs of inflammatory diseases3,6,15. Malnutrition, oxidative stress, and the production of pro-inflammatory cytokines can trigger both acute and chronic colitis3. In a previous study, we proved that a combination of micronutrients showed protective effects against DSS-induced colitis in vivo. Here, we provide detailed protocols on how these effects were measured8. First, we analyzed the effects of nutritional supplements on disease progression by determining the disease activity index (DAI), consisting of the three parameters of weight loss, stool consistency, and perianal bleeding. Representative results showed that DSS treatment led to a continuously-increasing DAI, as expected, reaching a maximum of 8.2 &#177; 0.46 on day seven (Figure 1A). Anti-inflammatory diet supplementation delayed the onset of colitis, but at later time points, when colitis was very strong, the protective effect was marginal and no longer statistically significant, suggesting that diet supplements are only effective when the colitis is not yet too strong. Importantly, dietary intervention could prevent the DSS-induced increase in intestinal epithelial permeability, which is an important feature of colitis (Figure 1B). DSS colitis led to reduced colon lengths, and this shortening was also ameliorated by the anti-inflammatory and anti-oxidative diet supplement (Figure 1C). Thus, clinical symptoms of colitis can indeed be alleviated by changes in diet composition.
Colon Tissue Damage and Disassembly of TJ and AJ during Colitis Is Attenuated by Anti-inflammatory and Anti-oxidative Diet Supplements
To analyze why colitis progression was less severe in animals receiving a diet supplement, tissue morphology was investigated after hematoxylin/eosin (H/E) staining of paraffin-embedded distal colon tissues. Control samples showed a normal morphology (Figure 2A, upper panel), whereas animals treated with 3.5% DSS showed typical signs of colitis (i.e., leukocyte infiltration, edema formation, crypt dysplasia, and ulcerations; Figure 2A, middle panel). Of note, parallel treatment with diet supplementation clearly alleviated colitis-induced morphological changes, with an overall morphology that was more comparable to the control group (Figure 2A, bottom panel). These observations were very similar to what has been reported for co-treatments with probiotic bacteria13 and clearly show that changes in diet can counteract the development of colitis.
We knew already that colitis-induced intestinal epithelial permeability could be counteracted by diet supplementation. Increased permeability is a hallmark of IBD, and it is in large part caused by the disassembly of the stabilizing adherens junctions (AJ) and tight junctions (TJ). Destabilization of epithelial cell contacts by the internalization of junctional proteins is induced by pro-inflammatory cytokines, which are abundantly produced during colitis16. We found, through the immunofluorescent staining of distal colon tissue, that the TJ molecule zonula occludens-1 (ZO-1) and the AJ molecule E-cadherin were internalized during DSS-induced colitis and that co-localization of these proteins was partly lost at crypt epithelial cell contacts (Figure 2B). Importantly, internalization of E-cadherin and ZO-1 was reduced when DSS-treated mice were co-treated with an anti-inflammatory and anti-oxidative diet supplement (Figure 2B). Overall, crypt and junction structures were more comparable to controls when the diet supplement was applied, suggesting that the observed protective effect was at least in part due to the preservation of tissue architecture.
Dietary Intervention Can Counteract Inflammatory Neutrophil Recruitment, Oxidative Stress, and the Production of Pro-inflammatory Cytokines
Another hallmark of IBD is uncontrolled neutrophil infiltration. Recruited neutrophils contribute to tissue damage by producing and releasing reactive oxygen species (ROS) and proteases17. Using an MPO activity assay, we found strong neutrophil recruitment in the colon in response to DSS, which was counteracted by diet supplementation (Figure 3A).
Oxidative stress is another important feature of colitis, caused by the release of ROS from recruited neutrophils. Thus, we analyzed the production of ROS in colon cross-sections. Figure 3B demonstrates that DSS treatment strongly increased oxidative stress. Of note, changes in diet completely prevented DSS-induced oxidative stress (Figure 3B), which is most likely a consequence of reduced neutrophil recruitment (Figure 3A).
Pro-inflammatory cytokines and chemokines are strongly produced by various cell types during colitis18. Such inflammatory mediators contribute to neutrophil recruitment and junction protein internalization-features that we already knew could be attenuated by changes in diet. Analysis of mRNA expression by RT-PCR revealed that DSS increased the expression of IL1&#946;, IL-6, and keratinocyte-derived chemokine (KC), as expected (Figure 3C), and that anti-inflammatory diet supplementation diminished this DSS-induced increase (Figure 3C). These data imply that diet supplements can indeed serve to counteract clinical signs of IBD.
<img alt="Figure 1" src="/files/ftp_upload/55095/55095fig1.jpg" /> 
Figure 1. Nutritional Supplements Can Alleviate Disease Activity Index, Intestinal Epithelial Permeability, and Colon Shortening. (A) The disease activity index (DAI, values from 0 - 12) consists of the three parameters of weight loss, stool consistency, and perianal bleeding and was recorded daily in the experimental groups of control (ctrl), colitis, and colitis + nutritional supplement (colitis+suppl.). The control group did not show any signs of colitis, resulting in a DAI of 0 throughout the experimental period. n = 5 per group. (B) Intestinal epithelial permeability was measured by Evans blue leakage in the abovementioned experimental groups and was expressed as the absorption at 620 nm per g of tissue. n = 8 per group. All data are shown as the mean &#177; the standard deviation of the mean (SDM). *p&#60; 0.05; **p&#60; 0.01; ***p&#60; 0.001. Statistics were calculated by one-way ANOVA. (C) Representative images of whole colons of the respective experimental groups after 7 days of treatment. The scale on the left is in cm. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55095/55095fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/55095/55095fig2.jpg" /> 
Figure 2. Tissue Morphology and Junction Architecture Are Better Preserved during Colitis when Applying Nutritional Supplements. (A) 5-&#181;m paraffin cross-section of tissue biopsies from the distal colons of the respective experimental groups were stained with hematoxylin/eosin and analyzed for typical signs of colitis, such as edema formation (arrows), leukocyte infiltration (arrowheads), and ulceration (*). Overall tissue morphology of the colitis+suppl. group more resembles that of the control than the colitis group, proving an overall protective effect against DSS colitis. Images are representative of 3 independent tissue preparations per group. Images were taken using a 10X objective. Bar = 100 &#181;m. (B) 8 &#956;m colon cryo-sections of the respective groups were stained with antibodies against ZO-1 (green) and E-cadherin (red). Co-localization (yellow in the merged images; arrows) of E-cadherin and ZO-1 at crypt epithelial cell contacts, which is lost during colitis, is mostly preserved in the colitis + suppl. group. Images are representative of 3 independent tissue preparations. Bar = 50 &#181;m. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55095/55095fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/55095/55095fig3.jpg" /> 
Figure 3. Neutrophil Recruitment, Oxidative Stress, and the Production of Pro-inflammatory Cytokines can be Reduced by Nutritional Supplements. (A) Myeloperoxidase (MPO) activity was measured to analyze the amount of leukocyte recruitment into colon tissues in the experimental groups: control (ctrl), colitis, and colitis + nutritional supplement (colitis+suppl.). n = 5 per group; *p&#60; 0.05. Data are shown as the mean &#177; SDM. Statistics were calculated by one-way ANOVA. (B) The fluorescence of oxidized ethidium, depicted in red as the measure of oxidative stress in 8-&#181;m cryo-sections of colon tissues, was recorded by laser confocal microscopy. Images are representative of 3 independent tissue preparations. Bar = 100 &#181;m. (C) The production of the pro-inflammatory cytokines IL1&#946; and IL-6 and the chemokine KC was determined by semi-quantitative RT-PCR in a 1.5% agarose gel (black and white were reverted for the sake of clarity). &#946;-actin served as the housekeeping gene. Representative images of three independent cDNA preparations are shown. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/55095/55095fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis at JoVE.com

Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

Current treatments of inflammatory bowel diseases (IBD) aim at alleviating disease symptoms but may cause severe side effects. Thus, alternative strategies are being investigated in animal colitis models. Here, we explain how the beneficial effects of diet supplements on clinical IBD signs are analyzed in such a colitis model.

Inflammatory bowel diseases (IBD), including Crohn&#39;s disease and ulcerative colitis, are chronic relapsing disorders of the intestines. They cause ...

analyzing-beneficial-effects-nutritional-supplements-on-intestinal

Nanyang Technological University

Research

Education

JoVE Core

JoVE Journal

Pharmacology

Medicine

Unit 1

Drugs for Chronic Bowel Disorders

SCIENTISTS IN ACTION

12.2K Views.  Center for Research and Advanced Studies of the National Polytechnic Institute.  Huidige behandelingen van inflammatoire darmziekten (IBD) zijn gericht op het verlichten van de ziektesymptomen, maar kan ernstige bijwerkingen veroorzaken. Zo worden alternatieve strategieën onderzocht in dierlijke modellen colitis. Hier leggen we uit hoe de gunstige effecten van voedingssupplementen op de klinische IBD borden worden geanalyseerd in een dergelijk colitis model. 

Video: Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

DNBS/TNBS Colitis Models: Providing Insights Into Inflammatory Bowel Disease and Effects of Dietary Fat

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently host immune responses to microbial and environmental agents. Dinitrobenzene sulfonic acid (DNBS)-induced colitis allows one to study the pathogenesis of IBD associated environmental triggers such as stress and diet, the effects of potential therapies, and the mechanisms underlying intestinal inflammation and mucosal injury. In this paper, we investigated the effects of dietary n-3 and n-6 fatty acids on the colonic mucosal inflammatory response to DNBS-induced colitis in rats. All rats were fed identical diets with the exception of different types of fatty acids [safflower oil (SO), canola oil (CO), or fish oil (FO)] for three&#160;weeks prior to exposure to intrarectal DNBS. Control rats given intrarectal ethanol continued gaining weight over the 5 day study, whereas, DNBS-treated rats fed lipid diets all lost weight with FO and CO fed rats demonstrating significant weight loss by 48&#160;hr and rats fed SO by 72&#160;hr. Weight gain resumed after 72&#160;hr post DNBS, and by 5 days post DNBS, the FO group had a higher body weight than SO or CO groups. Colonic sections collected 5&#160;days post DNBS-treatment showed focal ulceration, crypt destruction, goblet cell depletion, and mucosal infiltration of both acute and chronic inflammatory cells that differed in severity among diet groups. The SO fed group showed the most severe damage followed by the CO, and FO fed groups that showed the mildest degree of tissue injury. Similarly, colonic myeloperoxidase (MPO) activity, a marker of neutrophil activity was significantly higher in SO followed by CO fed rats, with FO fed rats having significantly lower MPO activity. These results demonstrate the use of DNBS-induced colitis, as outlined in this protocol, to determine the impact of diet in the pathogenesis of IBD.

DNBS/TNBS induced colitis offers an alternative and inexpensive method to study the pathobiology of inflammatory bowel disease. The protocol discussed in this paper outlines the successful application of DNBS to induce colitis in mice and rats and allows one to thoroughly study host-mediated intestinal responses.

Inflammatory Bowel Diseases (IBD), including Crohn&#39;s Disease and Ulcerative Colitis, have long been associated with a genetic basis, and more recently ...

Ex Vivo Intestinal Sacs to Assess Mucosal Permeability in Models of Gastrointestinal Disease

The epithelial barrier is the first innate defense of the gastrointestinal tract and selectively regulates transport from the lumen to the underlying tissue compartments, restricting the transport of smaller molecules across the epithelium and almost completely prohibiting epithelial macromolecular transport. This selectivity is determined by the mucous gel layer, which limits the transport of lipophilic molecules and both the apical receptors and tight junctional protein complexes of the epithelium. In vitro cell culture models of the epithelium are convenient, but as a model, they lack the complexity of interactions between the microbiota, mucous-gel, epithelium and immune system. On the other hand, in vivo assessment of intestinal absorption or permeability may be performed, but these assays measure overall gastrointestinal absorption, with no indication of site specificity. Ex vivo permeability assays using &#34;intestinal sacs&#34; are a rapid and sensitive method of measuring either overall intestinal integrity or comparative transport of a specific molecule, with the added advantage of intestinal site specificity. Here we describe the preparation of intestinal sacs for permeability studies and the calculation of the apparent permeability (Papp) of a molecule across the intestinal barrier. This technique may be used as a method of assessing drug absorption, or to examine regional epithelial barrier dysfunction in animal models of gastrointestinal disease.

Ex Vivo Intestinal Sacs to Assess Mucosal Permeability in Models of Gastrointestinal Disease

This protocol describes the use of excised intestinal tissue preparations or "intestinal sacs" as an ex vivo model of intestinal barrier function. This model may be used to assess integrity of both the epithelial barrier and the mucous gel layer at specific intestinal sites in animal models of digestive disease.

The epithelial barrier is the first innate defense of the gastrointestinal tract and selectively regulates transport from the lumen to the underlying ...

An Intravital Microscopy-Based Approach to Assess Intestinal Permeability and Epithelial Cell Shedding Performance

Intravital microscopy of the gut using confocal imaging allows real time observation of epithelial cell shedding and barrier leakage in living animals. Therefore, the intestinal mucosa of anesthetized mice is topically stained with unspecific staining (acriflavine) and a fluorescent tracer (rhodamine-B dextran), mounted on a saline solution-rinsed plate and directly imaged using a confocal microscope. This technique can complement other non-invasive techniques to identify leakage of intestinal permeability, such as transmucosal passage of orally administered tracers. Besides this, the approach presented here allows the direct observation of cell shedding events at real-time. In combination with appropriate fluorescent reporter mice, this approach is suitable for shedding light into cellular and molecular mechanisms controlling intestinal epithelial cell extrusion, as well as to other biological processes. In the last decades, interesting studies using intravital microscopy have contributed to knowledge on endothelial permeability, immune cell gut homing, immune-epithelial communication and invasion of luminal components, among others. Together, the protocol presented here would not only help increase the understanding of mechanisms controlling epithelial cell extrusion, but could also be the basis for the developmental of other approaches to be used as instruments to visualize other highly dynamic cellular process, even in other tissues. Among technical limitations, optical properties of the specific tissue, as well as the selected imaging technology and microscope configuration, would in turn, determine the imaging working distance, and resolution of acquired images.

Taking advantage of intravital microscopy, the method presented here enables real-time visualization of intestinal epithelial cell shedding in living animals. Therefore, topically stained intestinal mucosa (acriflavine and rhodamineB-dextran) of anesthetized mice is imaged up to single-cell resolution using confocal microscopy.

Intravital microscopy of the gut using confocal imaging allows real time observation of epithelial cell shedding and barrier leakage in living animals. ...

Immunology and Infection

Functional Assessment of Intestinal Permeability and Neutrophil Transepithelial Migration in Mice using a Standardized Intestinal Loop Model

The intestinal mucosa is lined by a single layer of epithelial cells that forms a dynamic barrier allowing paracellular transport of nutrients and water while preventing passage of luminal bacteria and exogenous substances. A breach of this layer results in increased permeability to luminal contents and recruitment of immune cells, both of which are hallmarks of pathologic states in the gut including inflammatory bowel disease (IBD). 
Mechanisms regulating epithelial barrier function and transepithelial migration (TEpM) of polymorphonuclear neutrophils (PMN) are incompletely understood due to the lack of experimental in vivo methods allowing quantitative analyses. Here, we describe a robust murine experimental model that employs an exteriorized intestinal segment of either ileum or proximal colon. The exteriorized intestinal loop (iLoop) is fully vascularized and offers physiological advantages over ex vivo chamber-based approaches commonly used to study permeability and PMN migration across epithelial cell monolayers.
We demonstrate two applications of this model in detail: (1) quantitative measurement of intestinal permeability through detection of fluorescence-labeled dextrans in serum after intraluminal injection, (2) quantitative assessment of migrated PMN across the intestinal epithelium into the gut lumen after intraluminal introduction of chemoattractants. We demonstrate feasibility of this model and provide results utilizing the iLoop in mice lacking the epithelial tight junction-associated protein JAM-A compared to controls. JAM-A has been shown to regulate epithelial barrier function as well as PMN TEpM during inflammatory responses. Our results using the iLoop confirm previous studies and highlight the importance of JAM-A in regulation of intestinal permeability and PMN TEpM in vivo during homeostasis and disease. 
The iLoop model provides a highly standardized method for reproducible in vivo studies of intestinal homeostasis and inflammation and will significantly enhance understanding of intestinal barrier function and mucosal inflammation in diseases such as IBD.

Dysregulated intestinal epithelial barrier function and immune responses are hallmarks of inflammatory bowel disease that remain poorly investigated due to a lack of physiological models. Here, we describe a mouse intestinal loop model that employs a well-vascularized and exteriorized bowel segment to study mucosal permeability and leukocyte recruitment in vivo.

The intestinal mucosa is lined by a single layer of epithelial cells that forms a dynamic barrier allowing paracellular transport of nutrients and water ...

Systematic Scoring Analysis for Intestinal Inflammation in a Murine Dextran Sodium Sulfate-Induced Colitis Model

Murine colitis models are tools that are extensively employed in studies focused on understanding the pathobiology of inflammatory intestinal disorders. However, robust standards for objective and reproducible quantification of disease severity remain to be defined. Most colitis analysis methods rely on limited histological scoring of small segments of intestine, leading to partial or biased analyses. Here, we combine high-resolution image acquisition and longitudinal analysis of the entire colon to quantify intestinal injury and ulceration in the dextran sodium sulfate (DSS) induced model of murine colitis. This protocol allows for the generation of objective and reproducible results without extensive user training. Here, we provide comprehensive details on sample preparation and image analysis using examples of data from DSS induced colitis. This method can be easily adapted to other models of murine colitis that have significant inflammation associated with mucosal injury. We demonstrate that the fraction of inflamed/injured and eroded/ulcerated mucosa relative to the complete length of the colon closely parallels clinical findings such as weight loss amid DSS-induced disease progression. This histological protocol provides a reliable time and cost-effective aid to standardize analyses of disease activity in an unbiased way in DSS colitis experiments.

Systematic scoring of intestinal inflammation using a free computer-assisted system is a powerful tool to quantitatively compare histopathological changes in colitis models characterized by the presence of ulcers and inflammatory changes. Histological colitis score evaluation strengthens clinical observations and facilitates data interpretation.

Murine colitis models are tools that are extensively employed in studies focused on understanding the pathobiology of inflammatory intestinal disorders. ...

Investigating Intestinal Barrier Breakdown in Living Organoids

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was not possible in classical cell culture monolayers. Moreover, monolayer cell cultures are good in vitro model systems but do not represent the complex cellular differentiation processes and functions that rely on 3D structure. This has so far only been possible in animal experiments, which are laborious, time consuming, and hard to assess by optical techniques. Here we describe an assay to quantitatively determine the barrier integrity over time in living small intestinal mouse organoids. To validate our model, we applied interferon gamma (IFN-&#947;) as a positive control for barrier destruction and organoids derived from IFN-&#947; receptor 2 knock out mice as a negative control. The assay allowed us to determine the impact of IFN-&#947; on the intestinal barrier integrity and the IFN-&#947; induced degradation of the tight junction proteins claudin-2, -7, and -15. This assay could also be used to investigate the impact of chemical compounds, proteins, toxins, bacteria, or patient-derived probes on the intestinal barrier integrity.

Here we describe a technique to quantify the barrier integrity of small intestinal organoids. The fact that the method is based on living organoids enables the sequential investigation of different barrier integrity modulating substances or combinations thereof in a time-resolved manner.

Organoids and three-dimensional (3D) cell cultures allow the investigation of complex biological mechanisms and regulations in vitro, which previously was ...

Evaluation and Quantification of Micro Epithelial Gaps in the Colonic Mucosa using Immunofluorescence Staining

Epithelial cells lining the intestinal mucosa create a physical barrier that separates the luminal content from the interstitium. Epithelial barrier impairment has been associated with the development of various pathologies such as inflammatory bowel diseases (IBD). In the inflamed mucosa, superficial erosions or micro-erosions that corrupt epithelial monolayers correspond to sites of high permeability. Several mechanisms have been implicated in the formation of micro-erosions including cell shedding and apoptosis. These micro-erosions often represent microscopic epithelial gaps randomly distributed in the colon. Visualization and quantification of those epithelial gaps has emerged as an important tool to investigate intestinal epithelial barrier function. Here, we describe a new method to visualize the specific location of where transcellular and paracellular permeability is enhanced in the inflamed colonic mucosa. In this assay, we apply a 10 kDa fluorescent dye conjugated to a lysine fixable dextran to visualize high permeability regions (HPR) in the colonic mucosa. Additional use of cell death markers revealed that HPR encompass apoptotic foci where epithelial extrusion/shedding occurs. The protocol described here provides a simple but effective approach to visualize and quantify micro-erosions in the intestine, which is a very useful tool in disease models, in which the intestinal epithelial barrier is compromised.

Here, we describe a new method to visualize the specific location of where transcellular and paracellular permeability is enhanced in the inflamed colonic mucosa. In this assay, we apply a 10 kDa fluorescent dye conjugated to a lysine fixable dextran to visualize high permeability regions (HPR) in the colonic mucosa.

Epithelial cells lining the intestinal mucosa create a physical barrier that separates the luminal content from the interstitium. Epithelial barrier ...

Biology

Investigating the Alleviating Effects of Bacillus cereus Administration on Colitis through Gut Microbiota Modulation

Gut microbiota dysbiosis is thought to exert a role in the progression of colitis. However, the precise standards for probiotic administration in alleviating colitis remain undefined. Most analysis methods rely on limited diversity and abundance of gut microorganisms. Therefore, observational studies cannot establish causation. In this study, we applied antibiotic-induced pseudo-germ-free mice to investigate the role of gut microbiota in regulating the probiotic effects of Bacillus&#160;cereus (B. cereus)&#160;on dextran sulfate sodium (DSS)-induced colitis in mice. This process allows for evaluating the bidirectional regulating effect of B. cereus&#160;supplementation on health and provides stable and reproducible results. Here, the detailed protocols for B. cereus cultivation, gavage operation, stool collection, and antibiotic clearance treatment on colitis mice are provided. The optimization methods are also applicable for other chronic inflammatory-associated disorders. The results showed that B. cereus administration decreased body weight loss, colon length shortening, disease activity index, and histopathological scores. However, treatment with antibiotics suppressed the positive effect of B. cereus on colitis. These results indicate that gut microbiota are needed for the alleviating effects of B. cereus on colitis. Therefore, exploring the beneficial effects of probiotics in this research is a promising approach for developing novel treatment strategies for alleviating the symptoms of chronic inflammatory-associated disorders.

Investigating the Alleviating Effects of Bacillus cereus Administration on Colitis through Gut Microbiota Modulation

Here, we present a protocol to establish the antibiotic-induced pseudo-germ-free dextran sulfate sodium-induced colitis mouse model to investigate the role of gut microbiota in regulating the positive effects of Bacillus cereus on colitis.

Gut microbiota dysbiosis is thought to exert a role in the progression of colitis. However, the precise standards for probiotic administration in ...

Assessment of Gut Barrier Integrity in Mice Using Fluorescein-Isothiocyanate-Labeled Dextran

Gut barrier integrity is a hallmark of intestinal health. While gut barrier integrity can be assessed using indirect markers such as the measurement of plasma inflammatory markers and bacterial translocation to the spleen and lymph nodes, the gold standard directly quantifies the ability of selected molecules to traverse the gut mucosal layer toward systemic circulation. This article uses a non-invasive, cost-effective, and low-burden technique to quantify and follow in real time the intestinal permeability in mice using fluorescein-isothiocyanate-labeled dextran (FITC-dextran). Prior to oral supplementation with FITC-dextran, the mice are fasted. They are then gavaged with FITC-dextran diluted in phosphate-buffered saline (PBS). One hour after the gavage, the mice are subjected to general anesthesia using isoflurane, and the in vivo fluorescence is visualized in an imaging chamber. This technique aims to assess residual fluorescence in the abdominal cavity and the hepatic uptake, which is suggestive of portal migration of the fluorescent probe. Blood and stool samples are collected 4 h after oral gavage, and the mice are sacrificed. Plasma and fecal samples diluted in PBS are then plated, and the fluorescence is recorded. The concentration of FITC-dextran is then calculated using a standard curve. In previous research, in vivo imaging has shown that fluorescence rapidly spreads to the liver in mice with a weaker gut barrier induced by a low-fiber diet, while in mice supplemented with fiber to strengthen the gut barrier, the fluorescent signal is retained mostly in the gastrointestinal tract. In addition, in this study, control mice had elevated plasma fluorescence and reduced fluorescence in the stool, while inversely, inulin-supplemented mice had higher levels of fluorescence signals in the gut and low levels in the plasma. In summary, this protocol provides qualitative and quantitative measurements of intestinal permeability as a marker for gut health.

In the present study, fluorescein-isothiocyanate-labeled (FITC) dextran is administered to mice via oral gavage to evaluate intestinal permeability both in vivo and in plasma and fecal samples. As gut barrier function is affected in many disease processes, this direct and quantitative assay can be used in diverse research areas.

Gut barrier integrity is a hallmark of intestinal health. While gut barrier integrity can be assessed using indirect markers such as the measurement of ...

Epithelial Effects of Intestinal Inflammation on Established Murine Colonoids

Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic cell layer provides the first line of defense between microbial and immune populations and helps to modulate the intestinal immune response. Disruption of the epithelial barrier is a hallmark of inflammatory bowel disease (IBD) and is of interest for therapeutic targeting. The 3-dimensional colonoid culture system is an extremely useful in vitro model for studying intestinal stem cell dynamics and epithelial cell physiology in IBD pathogenesis. Ideally, establishing colonoids from the inflamed epithelial tissue of animals would be most beneficial in assessing the genetic and molecular influences on disease. However, we have shown that in vivo epithelial changes are not necessarily retained in colonoids established from mice with acute inflammation. To address this limitation, we have developed a protocol to treat colonoids with a cocktail of inflammatory mediators that are typically elevated during IBD. While this system can be applied ubiquitously to various culture conditions, this protocol emphasizes treatment on both differentiated colonoids and 2-dimensional monolayers derived from established colonoids. In a traditional culture setting, colonoids are enriched with intestinal stem cells, providing an ideal environment to study the stem cell niche. However, this system does not allow for an analysis of the features of intestinal physiology, such as barrier function. Further, traditional colonoids do not offer the opportunity to study the cellular response of terminally differentiated epithelial cells to proinflammatory stimuli. The methods presented here provide an alternative experimental framework to address these limitations. The 2-dimensional monolayer culture system also offers an opportunity for therapeutic drug screening ex vivo. This polarized layer of cells can be treated with inflammatory mediators on the basal side of the cell and concomitantly with putative therapeutics apically to determine their utility in IBD treatment.

Author Spotlight: Studying the Epithelial Effects of Intestinal Inflammation In Vitro on Established Murine Colonoids  

We describe a protocol detailing the isolation of murine colonic crypts for the development of 3-dimensional colonoids. The established colonoids can then be terminally differentiated to reflect the cellular composition of the host epithelium prior to receiving an inflammatory challenge or being directed to establish an epithelial monolayer.

The intestinal epithelium plays an essential role in human health, providing a barrier between the host and the external environment. This highly dynamic ...

Analyzing Beneficial Effects of Nutritional Supplements on Intestinal Epithelial Barrier Functions During Experimental Colitis

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video