S. Zhang is funded by China Scholarship Council. The authors are very grateful to former people working on polyketomycin project in this lab and Prof. Dr. Hans-Peter Fiedler, University of T&#252;bingen, for providing the polyketomycin producer. The research was supported by the DFG (RTG 1976).

1. Identification of a Natural Product with Antibiotic Property
<ol>
	<li>Cultivate a microorganism under different conditions (e.g. time, temperature, pH, media) following the &#34;OSMAC (one strain-many compounds) approach&#34;13. Select one medium in which the production of a compound is observed.</li>
	<li>Cultivate Streptomyces diastatochromogenes T&#252;6028 under the following conditions
	<ol>
		<li>Grow Streptomyces diastatochromogenes T&#252;6026 strain on MS plates (soy flour 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1.5%, tap water 1 L). Inoculate a small loop of the spores of this strain into 20 mL&#160;liquid TSB medium (tryptic soy broth 30 g, tap water 1 L, pH 7.2; preculture medium) in an Erlenmeyer flask with a spiral. Shake the flask on a rotary shaker (28 &#176;C, 180 rpm, 2 days).</li>
		<li>Inoculate main culture in 100 mL&#160;HA medium (glucose 4 g, yeast extract 4 g, malt extract 10 g, tap water 1 L, pH 7.2) with 2 mL&#160;of the preculture. Culture the strain at 28 &#176;C for 6 days on a rotary shaker at 180 rpm.</li>
	</ol>
	</li>
	<li>Preparation of the crude extract
	<ol>
		<li>Harvest cells by centrifugation (10 min, 3,000 x g).</li>
		<li>For next steps handle organic solvents under a fume hood.</li>
		<li>For compound extraction from the mycelium, resuspend cells in a twofold volume of acetone and shake in a tube for 30 min, 180 rpm. Filter the liquid through commercial filter paper and evaporate acetone by rotary evaporator at 40 &#176;C and 550 bar. Dissolve the extract in 20 mL water:ethyl acetate (1:1) and shake it in a separating funnel for 30 min at 180 rpm.</li>
		<li>For compound extraction from the culture medium, adjust the culture broth to pH 4.0 by the addition of 1 M HCl. Add 100 mL&#160;ethyl acetate and shake it in a separating funnel for 30 min, 180 rpm.</li>
		<li>Collect ethyl acetate phase and evaporate by rotary evaporation at 40 &#176;C and 240 bar.</li>
	</ol>
	</li>
	<li>Analysis of the crude extract by HPLC
	<ol>
		<li>Dissolve the extracts in 1 mL&#160;MeOH, filter them through a 0.45 &#181;m pore size filter and run high-performance liquid chromatography (HPLC)14.</li>
		<li>In the case of polyketomycin, equip the HPLC system with a C18 precolumn (4.6 x 20 mm2) and a C18 column (4.6 x 100 mm2). Use a linear gradient of acetonitrile + 0.5% acetic acid ranging from 20% to 95% in H2O + 0.5% acetic acid (flow rate: 0.5 mL&#160;min-1). 
		NOTE: Polyketomycin has a retention time of 25.9 min (see Figure 1A). The UV/vis spectrum has maxima at 242 nm, 282 nm, 446 nm and minima at 262 nm and 359 nm (see Figure 1B). In the negative modus a mass of 863.2 [M-H]- is detectable (see Figure 1C).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 1" src="/files/ftp_upload/54952/54952fig1.jpg" /> 
Figure 1: LC/MS Analysis of Polyketomycin. (A) HPLC chromatogram (&#955; = 430 nm) of the crude extract after cultivation of Streptomyces diastatochromogenes T&#252;6028 for 6 days. Polyketomycin has a retention time of 25.9 min (B) UV/vis spectra of Polyketomycin. (C) Mass spectra of Polyketomycin in the negative modus. Main peak with m/z 863.2 [M-H]-.<a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="5">
	<li>Identification of the antibiotic activity using disc diffusion assay
	<ol>
		<li>Inoculate test strains like Gram-positive bacteria Bacillus subtilis (in LB medium; LB 20 g, tap water 1 L, pH 7.4) and other Streptomyces strains (in TSB medium; tryptic soy broth 30 g, tap water 1 L, pH 7.2), Gram-negative bacteria Escherichia coli (in LB medium) and fungal strains (in media such as YPD medium; yeast extract 10 g, peptone 20 g, glucose 20 g, tap water 1 L, pH 7.4). Take 100 &#181;L&#160;of test strain preculture and spread them onto respective agar plates.</li>
		<li>Dissolve the crude extract or purified compound in 500 &#181;L&#160;of methanol (alternatively water or DMSO) and pipette 20-50 &#181;L&#160;onto sterile paper discs. Dry paper discs for 30 min under the work bench and put them onto the plates with test cultures. Prepare a negative control (solvent) and a positive control (antibiotic, e.g. apramycin [1 mg]).</li>
		<li>Incubate the plates under adequate conditions until the test strains are visibly grown and determine inhibition zone, if apparent. Incubate E. coli and Bacillus sp. at 37 &#176;C for 16 h, Streptomyces sp. at 28 &#176;C for 2-4 days, fungal strain (mainly dependent on exact test strain) at 30 &#176;C for 2 days).</li>
	</ol>
	</li>
</ol>
2. Large Scale Extraction, Purification and Structure Elucidation of the Compound
<ol>
	<li>Cultivate S. diastatochromogenes in 5 L HA medium (glucose 4 g, yeast extract 4 g, malt extract 10 g, tap water 1 L, pH 7.2). Inoculate 2 mL&#160;of the preculture in 30 x 500 mL Erlenmeyer flasks containing 150 mL&#160;HA medium. Incubate the strain at 28 &#176;C for 6 days on a rotary shaker at 180 rpm.</li>
	<li>Harvest cells by centrifugation (10 min, 15,000 x g, RT) and extract compounds using ethyl acetate (see section 1.3).</li>
</ol>
<img alt="Figure 2" src="/files/ftp_upload/54952/54952fig2.jpg" /> 
Figure 2: Workflow for Structure Elucidation. The process comprises (1) cultivation of the strain, (2) extraction, (3) purification by solid phase extraction (SPE), thin layer chromatography (TLC), preparative high-performance liquid chromatography (HPLC), size exclusion chromatography (SEC) and (4) structure elucidation by mass analysis (MS), nuclear magnetic resonance (NMR) and X-ray measurements. <a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<ol start="3">
	<li>Purification of Polyketomycin 
	NOTE: The process of purification and structure elucidation is shown in Figure 2.
	<ol>
		<li>Fractionate crude extract by a C18 solid phase extraction (SPE) column using a 10%-stepwise MeOH gradient ranging from 30% to 100% MeOH in H2O, 100 mL&#160;for each condition.</li>
		<li>Purify the compound-containing fraction further by preparative thin-layer chromatography (TLC)15 using CH2Cl2/MeOH (7:1) as elution system.</li>
		<li>Purify the compound by preparative HPLC16. Equip the HPLC system with a C18 precolumn (5&#160;&#181;m; 9.4 x 20 mm) and a main column (5 &#181;m; 9.4 x 150 mm). Use a gradient of acetonitrile + 0.5% acetic acid ranging from 20% to 95% in H2O + 0.5% acetic acid (flow rate: 2.0&#160;mL/min).</li>
		<li>To remove solvents and other small impurities, perform a last purification step by size exclusion chromatography using a column in MeOH17. Collect the final pure compound and evaporate MeOH by rotary evaporation at 40 &#176;C and 240 bar.</li>
	</ol>
	</li>
	<li>Structure elucidation
	<ol>
		<li>Dissolve the pure compound (more than 2 mg) in 600-700 &#181;L&#160;(dependent on the machine) of DMSO-d6, record 1D NMR (1H, 13C) and 2D NMR (HSQC, HMBC,1H-1H COSY) spectra on a NMR spectrometer18. Express chemical shifts in &#948; values (ppm) by using DMSO-d6.</li>
		<li>Record a high-resolution mass spectrum (HRESI-MS)19 of polyketomycin using a high-resolution mass spectrometer.</li>
		<li>Elucidate the structure by interpretation of the results of NMR and MS data analysis10.</li>
	</ol>
	</li>
</ol>
3. Propose Biosynthetic Model of the New Isolated Compound
<ol>
	<li>Analyze the structure of the isolated compound and predict enzymes, which might be involved in its biosynthesis. Assign them to polyketide (type I, II or III), non-ribosomal peptide synthesis, lantipeptide, terpenoid, or sugar metabolism pathway8.</li>
	<li>Example polyketomycin
	<ol>
		<li>Subdivide the structure into obvious single moieties: tetracyclic moiety, two monosaccharides and the dimethyl salicylic acid.</li>
		<li>Find out, where the moieties might be derived from: The tetracyclic moiety might be derived from a polyketide synthase type II and the dimethyl salicylic acid moiety might be derived by an iterative polyketide synthase type I. The two sugar moieties, which are 6-deoxysugars, might be synthesized from glucose involving a TDP-glucose-4,6-dehydratase during biosynthesis and attached probably by two glycosyltransferases (see Figure 3)8.</li>
		<li>Predict putative genes in the cluster. Think of enzymes which are involved in the synthesis of the single moieties, in connecting the units, as well as in modifying and tailoring the molecule. The biosynthetic gene cluster of Polyketomycin most probably contains genes encoding a polyketide synthase type II (therefore minimum an ACP, KS&#945; und KS&#946; for connecting extender units), an iterative polyketide synthase type I (at least ACP, AT, KS), a TDP-glucose-4,6-dehydratase (necessary for step: glucose &#8594; deoxyglucose) and two glycosyltransferases (attaching two sugar monomers to the aglycone)8.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 3" src="/files/ftp_upload/54952/54952fig3.jpg" /> 
Figure 3: Structure of Polyketomycin Divided into Single Building Blocks. Polyketomycin is composed of a tetracyclic decaketid (PKS type II) and a dimethyl salicylic acid (iterative PKS type I), linked by the two deoxysugar moieties &#946;-D-amicetose and &#945;-L-axenose (NDP-glucose-4,6-dehydratase and two glycosyltransferase required). <a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>&#160;&#160;
4. Genome Sequencing/Mining
<ol>
	<li>Next generation sequencing
	<ol>
		<li>Sequence the genomic DNA by next generation sequencing technologies like Illumina, 454 pyrosequencing or SOLiD20. Align single reads to a reference sequence or assemble de novo. 
		NOTE: The genome of S. diastatochromogenes T&#252;6028 was sequenced at the Center for Biotechnology (CeBiTec) at the University of Bielefeld. All reads were assembled to a draft genome of 7.9 Mb.</li>
	</ol>
	</li>
	<li>Genome mining
	<ol>
		<li>Search for open reading frames (ORFs) by the usage of for example NCBI Prokaryotic Genome Annotation Pipeline21,22, RAST (rapid annotation using subsystem technology)23,24,25, Prokka (rapid prokaryotic genome annotation)26 or GenDB27. These programs also propose their functions. The analysis of the S. diastatochromogenes T&#252;6028 draft genome sequence led to the identification of more than 7,000 ORFs.</li>
		<li>Run specific BLAST (Basic Local Alignment Search Tool) analysis to get more information like alignments with other similar genes and catalytic domains28,29,30.</li>
		<li>For the identification of the secondary metabolite gene cluster run programs like antiSMASH31,32,33, NaPDoS34 and NRPSpredictor35,36. In the draft genome of Streptomyces diastatochromogenes antiSMASH31,32,33 identified 22 gene clusters.</li>
		<li>Analyze the putative gene clusters for their enzymatic pathway(s) (polyketide synthase (type I, II or III), non-ribosomal peptide synthetase, lanthipeptide, terpenoid, sugar metabolism &#8230;). Search for cluster(s) containing genes which might be involved in the synthesis of the compound (see section 3). In S. diastatochromogenes annotated cluster 2 contains polyketide synthase type II genes, three polyketide synthase type I genes, a TDP-glucose-4,6-dehydratase gene and two glycosyltransferase genes (see Figure 4).</li>
		<li>Focus on single genes within the cluster. For PKS type I and NRPS the specificity of acyltransferases and adenylation domains, and thus the incorporation of single extender units, may be predicted. Also compare the order of the incorporated extender unit with the molecule. antiSMASH31,32,33 also shows similar clusters of already known compounds, with a link to MIBiG database37.</li>
		<li>Compare the structure of the compound with these other compounds and check for similarities.</li>
	</ol>
	</li>
</ol>
<img alt="Figure 4" src="/files/ftp_upload/54952/54952fig4.jpg" /> 
Figure 4: antiSMASH Output of Polyketomycin Biosynthetic Gene Cluster and Overview of Other Clusters in S. diastatochromogenes T&#252;6028. (A) Overview of predicted biosynthetic gene clusters in the genome of S. diastatochromogenes T&#252;6028; (B) Cluster 2 Polyketomycin biosynthetic gene cluster with targeted genes. <a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
5. Verification of the Biosynthetic Gene Cluster
<ol>
	<li>Search for a gene with obvious and important (essential) functions for biosynthesis of the compound. For verification of the polyketomycin gene cluster the gene pokPI, coding for the ketosynthase &#945; from the PKS type II, was selected and inactivated by an out of frame-deletion (see Figure 5B). Alternatively, interrupt the gene by cloning an internal fragment (see&#160;Figure&#160;5C).</li>
</ol>
<img alt="Figure 5" src="/files/ftp_upload/54952/54952fig5.jpg" /> 
Figure 5: Verification of a Gene Cluster by Single Crossover. (A) Native gene leads to the translation of a functional protein; (B) Cloning of the gene with internal deletion into a suicide vector leads to a single crossover resulting in a frame shift in the targeted gene and subsequent translation of non-functional protein; (C) Cloning of an internal fragment of the gene into a suicide vector leads to a truncation of the gene and subsequent translation of a non-functional protein. oriT: origin of transfer; antibioticR: antibiotic resistance. <a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol start="2">
	<li>Cloning of the single-crossover construct
	<ol>
		<li>Amplify a fragment containing pokPI by PCR38 with primers pokPI_for and pokPI_rev.</li>
		<li>Clone PCR product into suicide vector pKC113239 (apramycinR [50 mg/mL]). The suicide vector is not able to replicate in the Streptomyces strain and thus has to integrate into the targeted gene by homologous recombination to provide apramycin-resistance. Transfer the vector into E. coli cloning host by heat shock transformation40.</li>
		<li>Isolate the vector by alkaline lysis41.</li>
		<li>Digest the vector DNA with a single cutter restriction enzyme that cuts within the fragment. The pokPI gene was digested with enzyme KpnI.</li>
		<li>Treat digested vector DNA with large DNA polymerase I (klenow) fragment, which has 5&#39;&#8594;3&#39; polymerase activity and 3&#39;&#8594;5&#39; exonuclease-activity. Blunting of the sticky ends and subsequent religation leads to loss of four bases. Check for loss of these bases by the steps transformation into E. coli XL1 Blue, picking single colonies, isolating their plasmid DNA,41 and analyzing further by restriction digestion and sequencing.</li>
	</ol>
	</li>
	<li>Conjugation of the single-crossover construct into Streptomyces
	<ol>
		<li>Transfer the suicide vector containing the pokPI gene (pKC1132_pokPIdel) with deletion into E. coli ET12567 pUZ800242 (kanamycinR) by heat shock transformation40. Incubate the cells in 100 mL&#160;LB media (kanamycin 50 &#181;g mL-1, apramycin 50 &#181;g mL-1) overnight at 37 &#176;C. Harvest cells by centrifugation (3,000 x g, 10 min, 4 &#176;C) and wash cells twice by resuspending in 50 mL&#160;LB media. Finally, resuspend cells in 2 x 500 &#181;L&#160;of LB media.</li>
		<li>Mix 500 &#181;L&#160;E. coli pUZ8002 pKC1132_pokPIdel with 500 &#181;L&#160;Streptomyces diastatochromogenes culture (alternatively use spores). Spread the mixture on MS plates (soy flour 20 g, D-mannitol 20 g, MgCl2 10 mM, agar 1.5%, tap water 1 L). Incubate the plates for 20 h at 28 &#176;C.</li>
		<li>Overlay each plate with apramycin (1.25 mg) and fosfomycin (5 mg) dissolved in 1 mL&#160;of water and let them dry. Incubate the plates for several days at 28 &#176;C until exconjugants are visible.</li>
	</ol>
	</li>
	<li>Check single-crossover mutants
	<ol>
		<li>Inoculate single exconjugants in 20 mL&#160;TSB medium (apramycin 50 mg mL-1) and incubate them at 28 &#176;C for three days and 180 rpm.</li>
		<li>Isolate genomic DNA43 and check interruption of the pokPI gene by PCR.</li>
		<li>Inoculate single clones with verified gene interruption and Streptomyces wildtype strain in 100 mL&#160;HA medium and incubate them for 6 days at 28 &#176;C and 180 rpm. Extract the crude extract (see section 1.3). Check compound production by HPLC-MS analysis (see section 1.4). The corresponding peak in the HPLC chromatogram and the mass of the compound should not be detectable any more (see Figure 6).</li>
	</ol>
	</li>
</ol>
<img alt="Figure 6" src="/files/ftp_upload/54952/54952fig6.jpg" /> 
Figure 6: HPLC Analysis of S. diastatochromogenes with Inactivated pokPI Gene. HPLC chromatogram (&#955; = 430 nm) of crude extract of S. diastatochromogenes WT (top) and mutant strain with interrupted pokPI-Gen (below). The mutant strain does not produce polyketomycin anymore. <a href="https://cloudfront-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<ol>
	<li>Fleming, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+antibacterial+action+of+cultures+of+a+penicillin,+with+special+reference+to+their+use+in+isolation+of+B.+influenzae.">On the antibacterial action of cultures of a penicillin, with special reference to their use in isolation of B. influenzae.</a> Br J Exp Pathol. 10 (3), 226-236 (1929).</li><li>Lemke, A., Kiderlen, A. F., Kayser, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Amphotericin+B.">Amphotericin B.</a> Appl. Microbiol. Biotechnol. 68 (2), 151-162 (2005).</li><li>Kirkpatrick, P., Raja, A., LaBonte, J., Lebbos, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Daptomycin.">Daptomycin.</a> Nat. Rev. Drug Discov. 2 (12), 943-944 (2003).</li><li>Zakeri, B., Wright, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemical+biology+of+tetracycline+antibiotics.">Chemical biology of tetracycline antibiotics.</a> Biochem. cell Biol. 86 (2), 124-136 (2008).</li><li>Schatz, A., Bugle, E., Waksman, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streptomycin,+a+Substance+Exhibiting+Antibiotic+Activity+Against+Gram-Positive+and+Gram-Negative+Bacteria.">Streptomycin, a Substance Exhibiting Antibiotic Activity Against Gram-Positive and Gram-Negative Bacteria.</a> Exp. Biol. Med. 55 (1), 66-69 (1944).</li><li>Burg, R. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+producing+organism+and+fermentation.">Avermectins, new family of potent anthelmintic agents: producing organism and fermentation.</a> Antimicrob. Agents Chemother. 15 (3), 361-367 (1979).</li><li>Egerton, J. R., Ostlind, D. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Avermectins,+new+family+of+potent+anthelmintic+agents:+efficacy+of+the+B1a+component.">Avermectins, new family of potent anthelmintic agents: efficacy of the B1a component.</a> Antimicrob. Agents Chemother. 15 (3), 372-378 (1979).</li><li>Walsh, C. T., Fischbach, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Natural+products+version+2.0:+connecting+genes+to+molecules.">Natural products version 2.0: connecting genes to molecules.</a> J. Am. Chem. Soc. 132 (8), 2469-2493 (2010).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces+sp.+MK277-AF1.+II.+Structure+determination.">Polyketomycin, a new antibiotic from Streptomyces sp. MK277-AF1. II. Structure determination.</a> J. Antibiot. (Tokyo). 51 (1), 26-32 (1998).</li><li>Paululat, T., Zeeck, A., Gutterer, J. M., Fiedler, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biosynthesis+of+polyketomycin+produced+by+Streptomyces+diastatochromogenes.T&#252;6028.">Biosynthesis of polyketomycin produced by Streptomyces diastatochromogenes.T&#252;6028.</a> J. Antibiot. (Tokyo). 52 (2), 96-101 (1999).</li><li>Momose, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyketomycin,+a+new+antibiotic+from+Streptomyces.+sp.+MK277-AF1.+I.+Taxonomy,+production,+isolation,+physico-chemical+properties+and+biological+activities.">Polyketomycin, a new antibiotic from Streptomyces. sp. MK277-AF1. I. Taxonomy, production, isolation, physico-chemical properties and biological activities.</a> J. Antibiot. (Tokyo). 51 (1), 21-25 (1998).</li><li>Daum, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Organisation+of+the+biosynthetic+gene+cluster+and+tailoring+enzymes+in+the+biosynthesis+of+the+tetracyclic+quinone+glycoside+antibiotic+polyketomycin.">Organisation of the biosynthetic gene cluster and tailoring enzymes in the biosynthesis of the tetracyclic quinone glycoside antibiotic polyketomycin.</a> Chembiochem. 10 (6), 1073-1083 (2009).</li><li>Bode, H. B., Bethe, B., H&#246;fs, R., Zeeck, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Big+effects+from+small+changes:+possible+ways+to+explore+nature's+chemical+diversity.">Big effects from small changes: possible ways to explore nature's chemical diversity.</a> Chembiochem. 3 (7), 619-627 (2002).</li><li>Wolfender, J. -. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HPLC+in+Natural+Product+Analysis:+The+Detection+Issue.">HPLC in Natural Product Analysis: The Detection Issue.</a> Planta Med. 75 (07), 719-734 (2009).</li><li>Stahl, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Thin-layer chromatography. A laboratory handbook. , (1967).</li><li>Snyder, L. R., Kirkland, J. J., Glajch, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparative+HPLC+Separation.">Preparative HPLC Separation.</a> Pract. HPLC Method Dev. , 616-642 (2012).</li><li>Granath, K. A., Kvist, B. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+weight+distribution+analysis+by+gel+chromatography+on+sephadex.">Molecular weight distribution analysis by gel chromatography on sephadex.</a> J. Chromatogr. A. 28, 69-81 (1967).</li><li>Jackman, L. M., Sternhell, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Application+of+Nuclear+Magnetic+Resonance+Spectroscopy+in+Organic+Chemistry.">Application of Nuclear Magnetic Resonance Spectroscopy in Organic Chemistry.</a> Int. Ser. Org. Chem. , (1969).</li><li>Xian, F., Hendrickson, C. L., Marshall, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+resolution+mass+spectrometry.">High resolution mass spectrometry.</a> Anal. Chem. 84 (2), 708-719 (2012).</li><li>Metzker, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequencing+technologies+-+the+next+generation.">Sequencing technologies - the next generation.</a> Nat. Rev. Genet. 11 (1), 31-46 (2010).</li><li>Tatusova, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokaryotic+Genome+Annotation+Pipeline.">Prokaryotic Genome Annotation Pipeline.</a> NCBI Handb. 2nd Ed. , (2013).</li><li>Angiuoli, S. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Toward+an+online+repository+of+Standard+Operating+Procedures+(SOPs)+for+(meta)genomic+annotation.">Toward an online repository of Standard Operating Procedures (SOPs) for (meta)genomic annotation.</a> OMICS. 12 (2), 137-141 (2008).</li><li>Aziz, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+RAST+Server:+rapid+annotations+using+subsystems+technology.">The RAST Server: rapid annotations using subsystems technology.</a> BMC Genomics. 9, 75 (2008).</li><li>Overbeek, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+SEED+and+the+Rapid+Annotation+of+microbial+genomes+using+Subsystems+Technology+(RAST).">The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST).</a> Nucleic Acids Res. 42, 206-214 (2014).</li><li>Brettin, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RASTtk:+a+modular+and+extensible+implementation+of+the+RAST+algorithm+for+building+custom+annotation+pipelines+and+annotating+batches+of+genomes.">RASTtk: a modular and extensible implementation of the RAST algorithm for building custom annotation pipelines and annotating batches of genomes.</a> Sci. Rep. 5, 8365 (2015).</li><li>Seemann, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prokka:+rapid+prokaryotic+genome+annotation.">Prokka: rapid prokaryotic genome annotation.</a> Bioinformatics. 30 (14), 2068-2069 (2014).</li><li>Meyer, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GenDB--an+open+source+genome+annotation+system+for+prokaryote+genomes.">GenDB--an open source genome annotation system for prokaryote genomes.</a> Nucleic Acids Res. 31 (8), 2187-2195 (2003).</li><li>Altschul, S. F., Gish, W., Miller, W., Myers, E. W., Lipman, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Basic+local+alignment+search+tool.">Basic local alignment search tool.</a> J. Mol. Biol. 215 (3), 403-410 (1990).</li><li>Madden, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+BLAST+Sequence+Analysis+Tool.">The BLAST Sequence Analysis Tool.</a> NCBI Handb. 2nd Ed. , (2003).</li><li>Marchler-Bauer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CDD:+NCBI's+conserved+domain+database.">CDD: NCBI's conserved domain database.</a> Nucleic Acids Res. 43, 222-226 (2014).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH:+rapid+identification,+annotation+and+analysis+of+secondary+metabolite+biosynthesis+gene+clusters+in+bacterial+and+fungal+genome+sequences.">antiSMASH: rapid identification, annotation and analysis of secondary metabolite biosynthesis gene clusters in bacterial and fungal genome sequences.</a> Nucleic Acids Res. 39, 339-346 (2011).</li><li>Blin, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+2.0--a+versatile+platform+for+genome+mining+of+secondary+metabolite+producers.">antiSMASH 2.0--a versatile platform for genome mining of secondary metabolite producers.</a> Nucleic Acids Res. 41, 204-212 (2013).</li><li>Weber, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=antiSMASH+3.0+-+a+comprehensive+resource+for+the+genome+mining+of+biosynthetic+gene+clusters.">antiSMASH 3.0 - a comprehensive resource for the genome mining of biosynthetic gene clusters.</a> Nucleic Acids Res. 43, 237-243 (2015).</li><li>Ziemert, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+natural+product+domain+seeker+NaPDoS:+a+phylogeny+based+bioinformatic+tool+to+classify+secondary+metabolite+gene+diversity.">The natural product domain seeker NaPDoS: a phylogeny based bioinformatic tool to classify secondary metabolite gene diversity.</a> PLoS One. 7 (3), 34064 (2012).</li><li>Rausch, C., Weber, T., Kohlbacher, O., Wohlleben, W., Huson, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+prediction+of+adenylation+domains+in+nonribosomal+peptide+synthetases+(NRPS)+using+transductive+support+vector+machines+(TSVMs).">Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs).</a> Nucleic Acids Res. 33 (18), 5799-5808 (2005).</li><li>R&#246;ttig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=NRPSSpredictor2--a+web+server+for+predicting+NRPS+adenylation+domain+specificity.">NRPSSpredictor2--a web server for predicting NRPS adenylation domain specificity.</a> Nucleic Acids Res. 39, 362-367 (2011).</li><li>Medema, M. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Minimum+Information+about+a+Biosynthetic+Gene+cluster.">Minimum Information about a Biosynthetic Gene cluster.</a> Nat. Chem. Biol. 11 (9), 625-631 (2015).</li><li>Mullis, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specific+enzymatic+amplification+of+DNA+in+vitro:+the+polymerase+chain+reaction.">Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.</a> Cold Spring Harb. Symp. Quant. Biol. 51, 263-273 (1986).</li><li>Bierman, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasmid+cloning+vectors+for+the+conjugal+transfer+of+DNA+from+Escherichia+coli+to+Streptomyces+spp.">Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp.</a> Gene. 116 (1), 43-49 (1992).</li><li>Froger, A., Hall, J. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transformation+of+plasmid+DNA+into+E.+coli.using+the+heat+shock+method.">Transformation of plasmid DNA into E. coli.using the heat shock method.</a> J. Vis. Exp. (6), e253 (2007).</li><li>Bimboim, H. C., Doly, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+rapid+alkaline+extraction+procedure+for+screening+recombinant+plasmid+DNA.">A rapid alkaline extraction procedure for screening recombinant plasmid DNA.</a> Nucleic Acids Res. 7 (6), 1513-1523 (1979).</li><li>MacNeil, D. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+Streptomyces+avermitilis.+genes+required+for+avermectin+biosynthesis+utilizing+a+novel+integration+vector.">Analysis of Streptomyces avermitilis. genes required for avermectin biosynthesis utilizing a novel integration vector.</a> Gene. 111 (1), 61-68 (1992).</li><li>Pospiech, A., Neumann, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+quick-prep+of+genomic+DNA+from+Gram-positive+bacteria.">A versatile quick-prep of genomic DNA from Gram-positive bacteria.</a> Trends Genet. 11 (6), 217-218 (1995).</li><li>Makitrynskyy, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pleiotropic+regulatory+genes+bldA,+adpA+and+absB+are+implicated+in+production+of+phosphoglycolipid+antibiotic+moenomycin.">Pleiotropic regulatory genes bldA, adpA and absB are implicated in production of phosphoglycolipid antibiotic moenomycin.</a> Open Biol. 3 (10), 130121 (2013).</li><li>Kalan, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+cryptic+polyene+biosynthetic+gene+cluster+in+Streptomyces+calvus+is+expressed+upon+complementation+with+a+functional+bldA+gene.">A cryptic polyene biosynthetic gene cluster in Streptomyces calvus is expressed upon complementation with a functional bldA gene.</a> Chem. Biol. 20 (10), 1214-1224 (2013).</li><li>Gessner, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Changing+Biosynthetic+Profiles+by+Expressing+bldA+in+Streptomyces+Strains.">Changing Biosynthetic Profiles by Expressing bldA in Streptomyces Strains.</a> ChemBioChem. 16 (15), 2244-2252 (2015).</li></ol>

The authors have nothing to disclose.

In this lab a genomic cosmid library of Streptomyces diastatochromogenes was generated and screened many years ago, resulting in the identification of the polyketomycin gene cluster through an extremely time-consuming process. Characterization of single genes were possible using targeted gene deletions and analysis of the resulting mutants12. Recently, a draft genome sequence of S. diastatochromogenes was obtained allowing the fast identification of the polyketomycin biosynthetic gene cluster. We could easily detect the biosynthetic genes, although the draft genome sequence contains still many contigs. The described process can be achieved within months. However, the procedure comprises many steps. Single steps may fail several times, preventing progression to subsequent steps:
The genus Streptomyces is known for its capacity to produce bioactive compounds. While they carry often more than 20 biosynthetic gene clusters, usually only one or two compounds are produced under laboratory conditions. The application of the OSMAC approach (cultivation of one strain under different conditions) to wake up silent gene clusters may sometimes not be enough. Genetic manipulation of regulatory genes, such as the pleiotropic regulator genes adpA44 and bldA45,46, is also an effective method to activate the production of other secondary metabolites.
For the elucidation of the compound&#39;s structure, e.g. by NMR analysis, usually more than 2 mg of purified compound is necessary. Therefore, fermentation of more than 10 L culture is often required. Without a fermenter that is able to maintain oxygen, pH and temperature conditions, it might be challenging in a small lab to handle this amount of culture and subsequent extraction. During purification, the compound may be changed due to oxidation, radiation or temperature. Also, the more purification steps are used, the higher the chance of degradation.
When analyzing the structure of the natural product, and the clusters in the genome, sometimes it is not that easy to identify the appropriate cluster. Firstly, if there is only a draft genome sequence some part of the cluster may be missing. Secondly, not all genes which are required for the biosynthesis are in the cluster. Thirdly, sometimes a cluster is split into two parts separated from each other by many kilobases. Fourthly, it may be difficult to decide which one is the appropriate gene cluster. In case of large PKS type I or NRPS systems, where it is possible to calculate the number of extender units based on the number of modules, or even identify the single extender units by analysis of the selecting domains, it turns up easily. However, in the case of iteratively working enzymes the prediction of the synthesized compounds is often not possible, especially if the strain has more than 40 gene clusters. Fifthly, nature is highly complex and full of yet unknown compounds. Often the biosynthesis is a mixture of different pathways. If the new compound is not identified yet, or not related to another compound, it may be difficult to identify the cluster, to propose a biosynthesis model and to prove it.
Once the cluster is identified, the single crossover technique is a good and quick method to verify the hypothesis. PCR, cloning into a suicide vector, conjugation, selection of positive clones, and production assay are the only steps required. One disadvantage of this technique is that the integration of the vector into the chromosome is not stable due to further recombination events. Therefore, in order to further analyze single genes, precise gene deletions are required. Also it may be tricky to manipulate Streptomyces strains on the genetic level.
The described procedure can be assigned to any other compound produced by a Streptomyces strain or another microorganism. The knowledge about a biosynthetic gene cluster and its synthesized compound gives us further opportunities to modify already existing molecules with the aim of improving them for the fight against multidrug-resistant pathogens.

Natural products from plants and microorganisms have always been an important source for clinical drug development and research. The first antibiotic Penicillin was discovered in 1928 from a fungus by Alexander Fleming1. Nowadays, many more natural products are used in clinical treatment.
One genus known for its capability of producing various kinds of secondary metabolites with different bioactivities is Streptomyces. Streptomyces are Gram-positive bacteria and belong to the class of Actinobacteria and the order Actinomycetales. Almost two-thirds of the clinically used antibiotics are derived from Actinomycetales, mainly from Streptomyces, like amphotericin2, daptomycin3 or tetracycline4. Two Nobel Prizes have been awarded in the field of Streptomyces antibiotic research. The first one went to Selman Waksman for the discovery of Streptomycin, the first antibiotic effective against tuberculosis.5 In 2015, as part of the Nobel Prize in Physiology and Medicine, the discovery of avermectin from S.&#160;avermitilis was awarded as well. Avermectin is used for the treatment of parasitic diseases6,7.
The traditional approach for the discovery of natural products in microorganisms such as Streptomyces generally involves cultivation of the strain under different growth conditions, as well as extraction and analysis of secondary metabolites. Bioactivity assays (e.g. assays for antibacterial and anticancer activity) are performed to detect the activity of the compound. Finally, the compound of interest is isolated and the chemical structure is elucidated.
The structures of natural products are often composed of single moieties which are forming complex molecules. There are a few, but limited, major biosynthetic pathways leading to building blocks, which are used for the biosynthesis of natural products. The major biosynthetic pathways are the polyketide pathways, pathways leading to terpenoids and alkaloids, pathways using amino acids, and pathways leading to sugar moieties. Each pathway is characterized by a set of specific enzymes8. Based on the structure of the compound, these biosynthetic enzymes can be predicted.
Nowadays, the detailed structural analysis of a compound in combination with next generation sequencing and bioinformatic analysis can help to identify the responsible biosynthetic gene cluster. The cluster information opens up new ways for further natural product research. This includes heterologous expression to increase the yield of the natural product, targeted compound modification by gene deletion or alteration and combinatorial biosynthesis with genes from other pathways.
Polyketomycin was isolated independently from the culture broth of two strains, Streptomyces sp. MK277-AF19 and Streptomyces diastatochromogenes T&#252;602810. The structure was elucidated by NMR and X-ray analysis. Polyketomycin is composed of a tetracyclic decaketid and a dimethyl salicylic acid, linked by the two deoxysugar moieties &#946;-D-amicetose and &#945;-L-axenose. It displays cytotoxic and antibiotic activity, even against Gram-positive multidrug-resistant strains such as MRSA11.
A genomic cosmid library of S. diastatochromogenes T&#252;6028 was generated and screened many years ago. Using specific gene probes the polyketomycin gene cluster with a size of 52.2 kb, containing 41 genes, was identified after several months of intense work12. Recently, a draft genome sequence of S. diastatochromogenes was obtained leading to the fast identification of the polyketomycin biosynthetic gene cluster. In this overview, a method helping to identify a natural product and elucidate its biosynthetic gene cluster will be described, using polyketomycin as an example.
Here we explain the single steps which lead from a natural product to its biosynthetic gene cluster shown for polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. The protocol comprises the identification and purification of a natural product with antibiotic properties. Further structural analysis and comparison with results from genome mining lead to the identification of the biosynthetic gene cluster. This procedure can be applied to any other compound derived from a Streptomyces strain or any other microorganism.

<table><tbody><tr><td>agar</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>5210.4</td><td></td></tr><tr><td>agarose</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6352.4</td><td></td></tr><tr><td>D-mannitol&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>4175.1</td><td></td></tr><tr><td>glucose&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6780.1</td><td></td></tr><tr><td>LB&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X964.3</td><td></td></tr><tr><td>malt extract&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X976.2</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>2189.1</td><td></td></tr><tr><td>Peptone&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td></td></tr><tr><td>soy flour&amp;nbsp;</td><td>W.Schoenemberger GmbH, Magstadt, Germany</td><td></td><td>Hensec-Vollsoja</td></tr><tr><td>tryptic soy broth</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>X938.3</td><td>Caso-Bouillon</td></tr><tr><td>yeast extract&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>2363.2</td><td></td></tr><tr><td>&lt;strong&gt;Solvents&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Acetic acid</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>3738.5</td><td></td></tr><tr><td>Acetone&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>9372.2</td><td></td></tr><tr><td>Acetonitrile</td><td>Avantor Performance Materials B.V., Deventer, The Netherlands</td><td>JT-9012-03</td><td></td></tr><tr><td>Dichlorofrom&amp;nbsp;</td><td>Fisher Scientific GmbH, Schwerte, Germany</td><td>1530754</td><td></td></tr><tr><td>DMSO (Dimethyl sulfoxide)</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>4720.1</td><td></td></tr><tr><td>DMSO-d&lt;sub&gt;6&lt;/sub&gt; (Dimethyl sulfoxide-d&lt;sub&gt;6&lt;/sub&gt;) 99.9 atom% D</td><td>ARMAR Chemicals, D&amp;ouml;ttingen, Switzerland</td><td>15200.204</td><td></td></tr><tr><td>Ethyl acetate</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6784.4</td><td></td></tr><tr><td>Hydrochloric acid</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>6331.4</td><td></td></tr><tr><td>Methanol</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>7342.1</td><td></td></tr><tr><td>&lt;strong&gt;Enzymes&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>restriction enzymes</td><td>New England Biolabs GmbH, Frankfurt am Main, Germany</td><td></td><td></td></tr><tr><td>polymerase&amp;nbsp;</td><td>New England Biolabs GmbH, Frankfurt am Main, Germany</td><td></td><td></td></tr><tr><td>DNA Polymerase I Large (Klenow) Fragment</td><td>Promega GmbH, Mannheim, Germany</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Antibiotics&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>apramycin</td><td>AppliChem GmbH, Darmstadt, Germany&amp;nbsp;</td><td>A7682.0005</td><td></td></tr><tr><td>fosfomycin</td><td>Sigma-Aldrich Chemie GmbH, Taufkirchen, Germany</td><td>P5396-50G</td><td></td></tr><tr><td>kanamycin</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td>T832.2</td><td></td></tr><tr><td>&lt;strong&gt;Plasmid/Vectors&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pKC1132</td><td>Bierman &lt;em&gt;et al.&lt;/em&gt; 1992</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Primer&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pokPI_for</td><td>TGATGGTGCCGCTGGCCATGG</td><td>Primer to amplify fragment containing pokPI gene</td><td></td></tr><tr><td>pokPI_rev</td><td>AGCGTTCACTGTTCCGCCCGAC</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Bacterial strains&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>&lt;em&gt;Bacillus subtilis&lt;/em&gt; COHN ATCC6051</td><td></td><td>Gram-positive test strain&amp;nbsp;</td><td></td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt; ET12567 pUZ8002&amp;nbsp;</td><td>MacNeil &lt;em&gt;et al.&lt;/em&gt; 1992</td><td>strain for conjugation</td><td></td></tr><tr><td>&lt;em&gt;Escherichia coli&lt;/em&gt; XL1 Blue</td><td>Agilient Technologies, Santa Clara, USA</td><td>Gram-negative test strain + cloning host&amp;nbsp;</td><td></td></tr><tr><td>&lt;em&gt;Streptomyces diastatochromogenes&lt;/em&gt; T&amp;uuml;6028</td><td>Paululat &lt;em&gt;et al.&lt;/em&gt;, 1999</td><td>Polyketomycin producer</td><td></td></tr><tr><td>&lt;strong&gt;Online services&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>antismash (Antibiotics and Secondary Metabolite Analysis Shell)</td><td>http://antismash.secondarymetabolites.org/</td><td>Detection of secondary metabolite gene cluster</td><td></td></tr><tr><td>BLAST (Basic Local Alignment Search Tool)</td><td>http://blast.ncbi.nlm.nih.gov/Blast.cgi</td><td>finds regions of similarity between biological sequences</td><td></td></tr><tr><td>GenDB</td><td>https://www.uni-giessen.de/fbz/fb08/Inst/bioinformatik/software/gendb</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>MiBIG (Minimum Information about a Biosynthetic Gene cluster)</td><td>http://mibig.secondarymetabolites.org/</td><td>Database of biosyntetic gene clusters</td><td></td></tr><tr><td>NaPDoS</td><td>http://napdos.ucsd.edu/</td><td>Detection of seconary metabolite gene cluster</td><td></td></tr><tr><td>NCBI Prokaryotic Genome Annotation Pipeline</td><td>http://www.ncbi.nlm.nih.gov/genome/annotation_prok/</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>NRPSpredictor</td><td>http://nrps.informatik.uni-tuebingen.de/</td><td>Detection of NRPS domains</td><td></td></tr><tr><td>Prokka (rapid prokaryotic genome annotation)</td><td>http://www.vicbioinformatics.com/software.prokka.shtml</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>RAST (rapid annotation using subsystems technology)</td><td>http://rast.nmpdr.org/</td><td>Annotation of ORFs&amp;nbsp;</td><td></td></tr><tr><td>&lt;strong&gt;Other programs&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Chem Station Rev. A.09.03</td><td>Agilent Technologies, Waldbronn, Germany</td><td>Handling program for HPLC&amp;nbsp;</td><td></td></tr><tr><td>Clone Manager Suite 7</td><td>Scientific and Educational Software, Cary, USA</td><td>Designing Cloning Experiment&amp;nbsp;</td><td></td></tr><tr><td>Newbler v2.8</td><td>Roche Diagnostics</td><td>Alignment of sequencing reads</td><td></td></tr><tr><td>&lt;strong&gt;Machines&amp;nbsp;&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Centrifuge Avanti J-6000, Rotor JA-10</td><td>Beckman Coulter GmbH, Krefeld, Germany</td><td></td><td></td></tr><tr><td>HPLC/MS</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Autosampler: G1313A</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Pre-column: XBridge C18 (20 mm x 4.6 mm; Particle size: 3.5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Column:Xbridge C18 (100 mm &amp;times; 4.6 mm; Particle size: 3.5 &amp;mu;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_semi-prep Pre-Column: Zorbax B-C18 (9.4 x 150 mm; Particle size: 5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_semi-prep Column: Zorbax B-C18 (9.4 x 20 mm; Particle size: 5 &amp;micro;m)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Degasser: G1322A&amp;nbsp;</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Quarternary pump: G1311A</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Diode array detector (DAD )G1315B (&amp;lambda; = 254 nm and 400 nm)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>_Quadrupole mass detector (MSD) G1946D(2-3000 m/z)</td><td>Agilent Technologies, Waldbronn, Germany</td><td></td><td></td></tr><tr><td>rotary evaporator</td><td></td><td></td><td></td></tr><tr><td>_heating bath Hei-VAP Value/G3</td><td>Heidolph Instruments GmbH &amp;amp; Co.KG, Schwabach, Germany</td><td></td><td></td></tr><tr><td>_vacuum pump system SC 920 G</td><td>KNF&amp;nbsp;Global Strategies&amp;nbsp;AG, Sursee, Switzerland</td><td></td><td></td></tr><tr><td>&lt;strong&gt;Other material&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Sephadex LH20</td><td>GE Healthcare,&amp;nbsp;</td><td></td><td></td></tr><tr><td>Chromafil PVDF-45/15MS (pore size 0.45 &amp;micro;m; filter &amp;Oslash;15 mm)</td><td>MACHEREY-NAGEL GmbH &amp;amp; Co. KG, D&amp;uuml;ren, Germany</td><td></td><td></td></tr><tr><td>SPE column Oasis HLB 20 35 cc (6g)</td><td>Waters GmbH, Eschborn, Germany&amp;nbsp;</td><td></td><td></td></tr><tr><td>&lt;em&gt;E. coli&amp;nbsp;&lt;/em&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: LB, Composition: LB, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>&lt;em&gt;Bacillus&amp;nbsp;&lt;/em&gt;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: LB, Composition: LB, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>&lt;em&gt;Streptomyces&lt;/em&gt; sp.</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: TSB, Composition: CASO Boullion, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 30 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Yeast extract, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 10 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Peptone, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td>fungus&amp;nbsp;</td><td>Carl Roth GmbH + Co. KG, Karlsruhe, Germany</td><td></td><td>Medium: YPD, Composition: Glucose, Amount to 1 L H&lt;sub&gt;2&lt;/sub&gt;O: 20 g</td></tr><tr><td colspan="4">for agar plates add 2% agar</td></tr></tbody></table>

from a natural product to its biosynthetic gene cluster: a demonstration using polyketomycin from streptomyces diastatochromogenes t&#252;6028

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different conditions often leads to the production of new compounds. Therefore, production cultures of the strains are extracted with ethyl acetate and the crude extracts are analyzed by HPLC. Furthermore, the extracts are tested for their bioactivity by different assays. For structure elucidation the compound of interest is purified by a combination of different chromatography methods.
Genome sequencing coupled with genome mining allows the identification of a natural product biosynthetic gene cluster using different computer programs. To confirm that the correct gene cluster has been identified, gene inactivation experiments have to be performed. The resulting mutants are analyzed for the production of the particular natural product. Once the correct gene cluster has been inactivated, the strain should fail to produce the compound.
The workflow is shown for the antibacterial compound polyketomycin produced by Streptomyces diastatochromogenes T&#252;6028. Around ten years ago, when genome sequencing was still very expensive, the cloning and identification of a gene cluster was a very time-consuming process. Fast genome sequencing combined with genome mining accelerates the trial of cluster identification and opens up new ways to explore biosynthesis and to generate novel natural products by genetic methods. The protocol described in this paper can be assigned to any other compound derived from a Streptomyces strain or another microorganism.

In this overview we describe the single steps from identification of an antibiotic leading to its biosynthetic gene cluster. Many years ago we cloned a cosmid library, packaged them into phages, transduced E. coli host cells, and had to screen thousands of colonies to identify the clones having overlapping regions of polyketomycin cluster. Sequencing of the cosmids was also a difficult and expensive process12.
In order to conduct further studies on the strain we sequenced the whole genome of Streptomyces diastatochromogenes T&#252;6028. With the draft genome sequence we easily identified the biosynthetic gene cluster of polyketomycin and other clusters encoding promising compounds. Figure 7 compares the &#34;old&#34; method of identifying the biosynthetic cluster by cloning of a cosmid library and elaborative screening, and the &#34;new&#34; method by whole genome sequencing with subsequent genome mining on a rough time scale. The new sequencing technologies and new genome mining programs speed up the whole process.
<img alt="Figure 7" src="/files/ftp_upload/54952/54952fig7.jpg" /> 
Figure 7: Comparison of the &#34;Old&#34; and &#34;New&#34; Method of Assigning a Biosynthetic Gene Cluster. The &#34;old&#34; method comprises cloning of a cosmid library with selection of positive clones and sequencing of the respective cosmid(s) (above); The &#34;new&#34; method includes whole genome sequencing and -mining to identify all secondary metabolite gene clusters located on the genome of the strain (below). Duration of single steps are shown on a rough time scale. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/54952/54952fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes TÃ¼6028 at JoVE.com

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes T&#252;6028

Here we present a detailed protocol of (A) the identification of a natural product with antibiotic activity, (B) the purification of the compound, (C) the first model of its biosynthesis, (D) genome sequencing/-mining and the (E) verification of the biosynthetic gene cluster.

Streptomyces strains are known for their capability to produce a lot of different compounds with various bioactivities. Cultivation under different ...

from-natural-product-to-its-biosynthetic-gene-cluster-demonstration

Nanyang Technological University

Research

JoVE Journal

Genetics

17.1K Views.  Albert-Ludwigs-Universität Freiburg, Germany.  Hier presenteren we een gedetailleerd protocol van (A) de identificatie van een natuurlijk product met antibiotische werking, (B) de zuivering van de verbinding, (C), het eerste model van zijn biosynthese, (D) genome sequencing / -mining en de ( E) verificatie van de biosynthetische gencluster. 

Video: From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028

A Customizable Approach for the Enzymatic Production and Purification of Diterpenoid Natural Products

Diterpenoids form a diverse class of small molecule natural products that are widely distributed across the kingdoms of life and have critical biological functions in developmental processes, interorganismal interactions, and environmental adaptation. Due to these various bioactivities, many diterpenoids are also of economic importance as pharmaceuticals, food additives, biofuels, and other bioproducts. Advanced genomics and biochemical approaches have enabled a rapid increase in the knowledge of diterpenoid-metabolic genes, enzymes, and pathways. However, the structural complexity of diterpenoids and the narrow taxonomic distribution of individual compounds in often only a single species remain constraining factors for their efficient production. Availability of a broader range of metabolic enzymes now provide resources for producing diterpenoids in sufficient titers and purity to facilitate a deeper investigation of this important metabolite group. Drawing on established tools for microbial and plant-based enzyme co-expression, we present an easily operated and customizable protocol for the enzymatic production of diterpenoids in either Escherichia coli or Nicotiana benthamiana, and the purification of desired products via silica chromatography and semi-preparative HPLC. Using the group of maize (Zea mays) dolabralexin diterpenoids as an example, we highlight how modular combinations of diterpene synthase (diTPS) and cytochrome P450 monooxygenase (P450) enzymes can be used to generate different diterpenoid scaffolds. Purified compounds can be used in various downstream applications, such as metabolite structural analyses, enzyme structure-function studies, and in vitro and in planta bioactivity experiments.

Here we present easy to use protocols for producing and purifying diterpenoid metabolites through the combinatorial expression of biosynthetic enzymes in Escherichia coli or Nicotiana benthamiana, followed by chromatographic product purification. The resulting metabolites are suitable for various studies including molecular structure characterization, enzyme functional studies, and bioactivity assays.

Diterpenoids form a diverse class of small molecule natural products that are widely distributed across the kingdoms of life and have critical biological ...

Biochemistry

Mass Spectrometry-Guided Genome Mining as a Tool to Uncover Novel Natural Products

The chemical space covered by natural products is immense and widely unrecognized. Therefore, convenient methodologies to perform wide-ranging evaluation of their functions in nature and potential human benefits (e.g., for drug discovery applications) are desired. This protocol describes the combination of genome mining (GM) and molecular networking (MN), two contemporary approaches that match gene cluster-encoded annotations in whole genome sequencing with chemical structure signatures from crude metabolic extracts. This is the first step towards the discovery of new natural entities. These concepts, when applied together, are defined here as MS-guided genome mining. In this method, the main components are previously designated (using MN), and structurally related new candidates are associated with genome sequence annotations (using GM). Combining GM and MN is a profitable strategy to target new molecule backbones or harvest metabolic profiles in order to identify analogues from already known compounds.

A mass spectrometry-guided genome mining protocol is established and described here. It is based on genome sequence information and LC-MS/MS analysis and aims to facilitate identification of molecules from complex microbial and plant extracts.

The chemical space covered by natural products is immense and widely unrecognized. Therefore, convenient methodologies to perform wide-ranging evaluation ...

Chemistry

Identification of Plasmodesmal Localization Sequences in Proteins In Planta

Plasmodesmata (Pd) are cell-to-cell connections that function as gateways through which small and large molecules are transported between plant cells. Whereas Pd transport of small molecules, such as ions and water, is presumed to occur passively, cell-to-cell transport of biological macromolecules, such proteins, most likely occurs via an active mechanism that involves specific targeting signals on the transported molecule. The scarcity of identified plasmodesmata (Pd) localization signals (PLSs) has severely restricted the understanding of protein-sorting pathways involved in plant cell-to-cell macromolecular transport and communication. From a wealth of plant endogenous and viral proteins known to traffic through Pd, only three PLSs have been reported to date, all of them from endogenous plant proteins. Thus, it is important to develop a reliable and systematic experimental strategy to identify a functional PLS sequence, that is both necessary and sufficient for Pd targeting, directly in the living plant cells. Here, we describe one such strategy using as a paradigm the cell-to-cell movement protein (MP) of the Tobacco mosaic virus (TMV). These experiments, that identified and characterized the first plant viral PLS, can be adapted for discovery of PLS sequences in most Pd-targeted proteins.

Identification of Plasmodesmal Localization Sequences in Proteins In Planta

Plant intercellular connections, the plasmodesmata (Pd), play central roles in plant physiology and plant-virus interactions. Critical to Pd transport are sorting signals that direct proteins to Pd. However, our knowledge about these sequences is still in its infancy. We describe a strategy to identify Pd localization signals in Pd-targeted proteins.

Plasmodesmata (Pd) are cell-to-cell connections that function as gateways through which small and large molecules are transported between plant cells. ...

Immunology and Infection

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of antibiotics and other secondary metabolites. Streptomyces coelicolor is a well-characterized, non-pathogenic species that is amenable to a variety of analyses in the lab. The phenotyping methods described here use S. coelicolor as a model streptomycete; however, the methods are applicable to all members of this large genus as well as some closely related actinomycetes. Phenotyping is necessary to characterize new species of Streptomyces identified in the environment, and it is also a vital first step in characterizing newly isolated mutant strains of Streptomyces. Proficiency in phenotyping is important for the many new researchers who are entering the field of Streptomyces research, which includes the study of bacterial development, cell division, chromosome segregation, and second messenger signaling. The recent crowdsourcing of antibiotic discovery through the isolation of new soil microbes has resulted in an increased need for training in phenotyping for instructors new to the field of Streptomyces research and their college or high school students. This manuscript describes methods for bacterial strain propagation, storage, and characterization through visual and microscopic examination. After reading this article, new researchers (microbiology education laboratories and citizen scientists) should be able to manipulate Streptomyces strains and begin visual characterization experiments.

Visual and Microscopic Evaluation of Streptomyces Developmental Mutants

Here we present protocols for novice researchers to initiate phenotyping for the pharmacologically important bacterial genus Streptomyces.

Streptomycetes are filamentous soil bacteria belonging to the phylum Actinobacteria that are found throughout the world and produce a wide array of ...

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

Bioengineering

A High-Yield Streptomyces Transcription-Translation Toolkit for Synthetic Biology and Natural Product Applications

Streptomyces spp. are a major source of clinical antibiotics and industrial chemicals. Streptomyces venezuelae ATCC 10712 is a fast-growing strain and a natural producer of chloramphenicol, jadomycin, and pikromycin, which makes it an attractive candidate&#160;as a next-generation synthetic biology chassis. Therefore, genetic tools that accelerate the development of S. venezuelae ATCC 10712, as well as other Streptomyces spp. models, are highly desirable for natural product engineering and discovery. To this end, a dedicated S. venezuelae ATCC 10712 cell-free system is provided in this protocol to enable high-yield heterologous expression of high G+C (%) genes. This protocol is suitable for small-scale (10-100 &#956;L) batch reactions in either 96-well or 384-well plate format, while reactions are potentially scalable. The cell-free system is robust and can achieve high yields (~5-10 &#956;M) for a range of recombinant proteins in a minimal setup. This work also incorporates a broad plasmid toolset for real-time measurement of mRNA and protein synthesis, as well as in-gel fluorescence staining of tagged proteins. This protocol can also be integrated with high-throughput&#160;gene expression characterization workflows or the study of enzyme pathways from high G+C (%) genes present in Actinomycetes genomes.

A High-Yield Streptomyces Transcription-Translation Toolkit for Synthetic Biology and Natural Product Applications

This protocol details an enhanced method for synthesizing high yields of recombinant proteins from a Streptomyces venezuelae cell-free transcription-translation (TX-TL) system.

Streptomyces spp. are a major source of clinical antibiotics and industrial chemicals. Streptomyces venezuelae ATCC 10712 is a fast-growing strain and a ...

The Logic, Experimental Steps, and Potential of Heterologous Natural Product Biosynthesis Featuring the Complex Antibiotic Erythromycin A Produced Through E. coli

The heterologous production of complex natural products is an approach designed to address current limitations and future possibilities. It is particularly useful for those compounds which possess therapeutic value but cannot be sufficiently produced or would benefit from an improved form of production. The experimental procedures involved can be subdivided into three components: 1) genetic transfer; 2) heterologous reconstitution; and 3) product analysis. Each experimental component is under continual optimization to meet the challenges and anticipate the opportunities associated with this emerging approach.
Heterologous biosynthesis begins with the identification of a genetic sequence responsible for a valuable natural product. Transferring this sequence to a heterologous host is complicated by the biosynthetic pathway complexity responsible for product formation. The antibiotic erythromycin A is a good example. Twenty genes (totaling &gt;50 kb) are required for eventual biosynthesis. In addition, three of these genes encode megasynthases, multi-domain enzymes each ~300 kDa in size. This genetic material must be designed and transferred to E. coli for reconstituted biosynthesis. The use of PCR isolation, operon construction, multi-cystronic plasmids, and electro-transformation will be described in transferring the erythromycin A genetic cluster to E. coli.
Once transferred, the E. coli cell must support eventual biosynthesis. This process is also challenging given the substantial differences between E. coli and most original hosts responsible for complex natural product formation. The cell must provide necessary substrates to support biosynthesis and coordinately express the transferred genetic cluster to produce active enzymes. In the case of erythromycin A, the E. coli cell had to be engineered to provide the two precursors (propionyl-CoA and (2S)-methylmalonyl-CoA) required for biosynthesis. In addition, gene sequence modifications, plasmid copy number, chaperonin co-expression, post-translational enzymatic modification, and process temperature were also required to allow final erythromycin A formation.
Finally, successful production must be assessed. For the erythromycin A case, we will present two methods. The first is liquid chromatography-mass spectrometry (LC-MS) to confirm and quantify production. The bioactivity of erythromycin A will also be confirmed through use of a bioassay in which the antibiotic activity is tested against Bacillus subtilis. The assessment assays establish erythromycin A biosynthesis from E. coli and set the stage for future engineering efforts to improve or diversify production and for the production of new complex natural compounds using this approach.

The Logic, Experimental Steps, and Potential of Heterologous Natural Product Biosynthesis Featuring the Complex Antibiotic Erythromycin A Produced Through E. coli

The heterologous biosynthesis of erythromycin A through E. coli includes the following experimental steps: 1) genetic transfer; 2) heterologous reconstitution; and 3) product analysis. Each step will be explained in the context of the motivation, potential, and challenges in producing therapeutic natural products using E. coli as a surrogate host.

The heterologous production of complex natural products is an approach designed to address current limitations and future possibilities.  It is ...

Biology

Designing Tetracycline-Controlled Synthetic Circuits for Leishmaniasis Therapy

Immunometabolic Circuits in Infection for Advancing Host Directed Therapies

Immuno-metabolism is a pivotal determinant in the progression of leishmaniasis. Synthetic biology-based approach has garnered significant attention as a step toward therapeutic intervention targeting host-associated factors that drive leishmaniasis. Synthetic biology entails the engineering of genetic components in an orthogonal and modular manner to precisely modulate biological systems, imparting novel functions to cells. In the presented study, elucidation of a systematic pipeline for the development of an inducible tetracycline-controlled (TetON)-based synthetic circuit was aimed at delivering succinate dehydrogenase as a therapeutic agent to facilitate the elimination of intracellular Leishmania parasites. The outlined protocol describes the designing of a synthetic circuit and its subsequent validation. The proposed strategy also concentrates on the incorporation of synthetic circuits in the plasmid backbone as a delivery vehicle. Additionally, delivery machinery employing polyplexes-based nano-particles for the delivery of synthetic circuits was used in murine macrophage cell lines without compromising the cellular morphology. Standardization of the method was conducted for selecting transfected cells and determining optimal induction concentration for synthetic circuit expression. Observations reveal a distinct reduction in intracellular parasite burden in transfected cells compared to infected cells. Pro-inflammatory cytokines were expressed post-infection in synthetic circuit transfected and induced cells as a mechanism to promote parasite elimination. This underscores the synthetic biology-based method as a potent approach in leishmaniasis by targeting host factors associated with disease progression.

Here, a protocol for designing, constructing, and delivering tetracycline-controlled based inducible synthetic circuit is presented. The effect of the synthetic circuits on parasite elimination and cytokine expression can be studied by channelizing the presented pipeline. This protocol is relevant for researchers studying synthetic circuit-based therapeutics in infectious diseases.

Immuno-metabolism is a pivotal determinant in the progression of leishmaniasis. Synthetic biology-based approach has garnered significant attention as a ...

Single&#45;Copy Gene Expression for Characterizing Multidrug Efflux Systems

Characterizing Multidrug Efflux Systems in Acinetobacter baumannii Using an Efflux&#45;Deficient Bacterial Strain and a Single&#45;Copy Gene Expression System

Acinetobacter baumannii is recognized as a challenging Gram-negative pathogen due to its widespread resistance to antibiotics. It is crucial to comprehend the mechanisms behind this resistance to design new and effective therapeutic options. Unfortunately, our ability to investigate these mechanisms in A. baumannii is hindered by the paucity of suitable genetic manipulation tools. Here, we describe methods for utilizing a chromosomal mini-Tn7-based system to achieve single-copy gene expression in an A. baumannii strain that lacks functional RND-type efflux mechanisms. Single-copy insertion and inducible efflux pump expression are quite advantageous, as the presence of RND efflux operons on high-copy number plasmids is often poorly tolerated by bacterial cells. Moreover, incorporating recombinant mini-Tn7 expression vectors into the chromosome of a surrogate A. baumannii host with increased efflux sensitivity helps circumvent interference from other efflux pumps. This system is valuable not only for investigating uncharacterized bacterial efflux pumps but also for assessing the effectiveness of potential inhibitors targeting these pumps.

Author Spotlight: Advancing Antibiotic Resistance Research Using an Efflux&#45;Deficient Bacterial Strain and a Single&#45;Copy Gene Expression System

We describe a facile procedure for the single-copy chromosomal complementation of an efflux pump gene using a mini-Tn7-based expression system into an engineered efflux-deficient strain of Acinetobacter baumannii. This precise genetic tool allows for controlled gene expression, which is key for the characterization of efflux pumps in multidrug resistant pathogens.

Acinetobacter baumannii is recognized as a challenging Gram-negative pathogen due to its widespread resistance to antibiotics. It is crucial to comprehend ...

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

From a Natural Product to Its Biosynthetic Gene Cluster: A Demonstration Using Polyketomycin from Streptomyces diastatochromogenes Tü6028

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video