This work was supported by NIH grants HL083958 and HL100398 (A.K.H.) and 2T32HL007411-33 &#34;Program in Cardiovascular Mechanisms: Training in Investigation&#34; (J.B.).

1. Preparation of Cell Culture Media, Solutions, and Reagents.
<ol>
	<li>Prepare 500 ml of Mouse embryonic stem cell (mESC) media by mixing and sterile filtering (0.2 &#956;m pore size) 445 ml Glasgow Minimum Essential Medium (GMEM), 50 ml heat inactivated fetal bovine serum (FBS), 5 ml 100X concentrated L-Glutamine replacement, 5 &#181;l recombinant mouse Leukemia Inhibitory Factor (LIF) at 1 x 107 units per ml, and 1.43 &#181;l &#223;-Mercaptoethanol (final concentration is 50 &#181;M). Store at 4 &#730;C until ready to use.</li>
	<li>Prepare 500 ml of Embryoid Body (EB) differentiation media by mixing and sterile filtering 391 ml Iscove&#39;s Modified Dulbecco Medium (IMDM), 100 ml heat inactivated FBS, 5 ml 100X concentrated L-Glutamine replacement, 5 ml 100X concentrated Non-essential amino acids (NEAA), and 2.86 &#181;l &#223;-Mercaptoethanol (final concentration is 100 &#181;M). Store at 4&#730; C until ready to use.</li>
	<li>Prepare 0.2 % w/v solution of Gelatin by mixing 1 g porcine skin gelatin powder with 500 ml of filtered, distilled H2O. Sterilize by autoclaving. Note that the gelatin may not be completely soluble in water at RT. After autoclaving the gelatin should be completely dissolved. Store at RT until ready to use.</li>
	<li>Prepare Grem2 recombinant protein aliquots by dissolving 50 &#181;g pellet of lyophilized Grem2 in 100 &#181;l phosphate buffered saline (PBS) supplemented with 0.1 % BSA to make a 0.5 &#181;g/&#181;l stock solution. Aliquot 20 &#181;l of this stock solution into five sterile 1.5 ml centrifuge tubes and store at -80&#730; C until ready to use.</li>
	<li>Prepare PBS according to published protocols or purchase as a 10X stock and dilute 1:10 with filtered, distilled H2O to make a 1X working dilution19. Sterilize PBS by autoclaving prior to use. Store at RT until ready to use. In some steps, DPBS without Ca2+ and Mg2+ is used. This is purchased as a 1X solution. Ordering information is included in the table of reagents.</li>
</ol>
2. Preparation of Gelatin Coated 10 cm Tissue Culture Dishes
<ol>
	<li>In a sterilized tissue culture hood add 5 ml of 0.2 % gelatin solution to each 10 cm tissue culture dish for coating. Place dishes in incubator at 37 &#730;C for at least 30 min or up to 4 days.</li>
</ol>
3. Preparation of Gelatin Coated 6-Well Tissue Culture Plates
<ol>
	<li>In a sterilized tissue culture hood add 1 ml of 0.2 % gelatin to each well of a 6-well tissue culture plate. Place plates in incubator at 37 &#730;C for at least 30 min or up to 4 days.</li>
</ol>
4. Embryonic Stem Cell Culture
<ol>
	<li>Thawing mESCs
	<ol>
		<li>Prepare mESC media by warming to RT in a sterilized tissue culture hood. Add 10 ml RT media to a gelatin-coated 10 cm dish.</li>
		<li>Remove 1 vial of mESCs containing approximately 1 x 106 cells from cryostorage. Holding cryovial with tongs, place in a 37 &#730;C water bath. Gently swirl until cell suspension has thawed and only a small ice crystal remains in the center of the vial. Dry off vial with a disposable lint-free wipe and sterilize with 70% EtOH.</li>
		<li>In a sterile tissue culture hood remove thawed cells using a P1000 tip from cryovial and transfer to 10 cm dish prepared in 4.1.1).</li>
		<li>Place 10 cm dish into 37 &#730;C humidified cell culture incubator with 5% CO2 and evenly distribute cells by gently moving the plate front to back, then side to side. Allow cells to attach to plate O/N or at least 6 hr.</li>
		<li>First thing the next morning check cells for attachment using a bright field microscope. Some cell debris and dead cells will be observed in the media. This is normal. Aspirate media from dishes and replace with 10 ml fresh mESC media.</li>
		<li>Continue to change media on cells every day to prevent differentiation.</li>
	</ol>
	</li>
	<li>Passaging mESCs
	<ol>
		<li>Passage cells when 60-70% confluent. Prepare cells for passaging by aspirating media and rinsing with 5 ml sterile 1X DPBS without MgCl2 and CaCl2. Add 2 ml 0.05% trypsin-EDTA solution. Place in incubator at 37 &#730;C for 5 min.</li>
		<li>While cells are incubating, prepare new 10 cm dish by aspirating gelatin solution and adding 10 ml of RT mESC media. After 5 min check the cells for detachment. If cells remain attached, continue to incubate at 37 &#730;C for 2 min at a time until completely detached.</li>
		<li>Quench trypsin-EDTA by adding 3 ml of mESC media. Transfer cell suspension to a 15 ml centrifuge tube and spin at 200 x g for 5 min to pellet. Aspirate media from pellet and re-suspend in 10 ml mESC media.</li>
		<li>Depending on desired split ratio, add 0.5-1.0 ml of cell suspension to each dish prepared in step 4.2.2). Place dish in incubator and evenly distribute cells by gently moving back to front then side to side. Allow cells to attach O/N or for at least 12 hr. 
		NOTE: A split ratio of 1:10 - 1:20 is common for most mESC lines. This ratio may vary depending on the line used, passage number, and desired confluence on the new dish. For a 1:10 split ratio transfer 1 ml of cell suspension into 9 ml mESC media and plate in a freshly prepared gelatin-coated 10 cm dish.</li>
	</ol>
	</li>
</ol>
5. Preparation of Embryoid Bodies
NOTE: All steps except centrifugation are performed in a sterile tissue culture hood.
<ol>
	<li>Preparation of Cell Suspension in EB Media
	<ol>
		<li>Upon 70 % confluency (usually 24-48 hr post-passage), use the cells for EB formation. Prepare cells for EB formation by detaching and pelleting according to sections 4.2.1) - 4.2.3). 
		Note: It is best to passage cells at least one time post-thaw and check for health (e.g., very little cell death, no contamination, proper morphology) and robust growth (e.g., population doublings occurring every 24-48 hr) prior to use for making EBs.</li>
		<li>Re-suspend pellet in 5 ml EB media. Count cells using a hemocytometer or automated cell counter.</li>
		<li>Dilute cell suspension in required volume of EB media to make a final concentration of 25 cells/&#181;l (or 2.5 x 104 cells/ml). Note that each lid of a petri dish holds about 60 EBs and requires about 1.3 ml of cell suspension. At this step, prepare sufficient volume of cell suspension to generate the desired number of EBs. For example, if 240 EBs are required for experiment, prepare 5.2 ml at 2.5 x 104 cells/ml. 
		NOTE: mESCs that are not used for EB formation can be used for future experiments by spinning down, re-suspending in mESC media and plating as described in section 4.2.</li>
	</ol>
	</li>
	<li>Creation of Embryoid Bodies
	<ol>
		<li>Prepare sterile 10 cm bacterial petri-dishes for hanging drop formation by adding 2 ml of 1X PBS to the bottom of each.</li>
		<li>Transfer EB suspension from step 5.1) to a sterile solution basin.</li>
		<li>Remove lid from prepared petri dish and carefully deposit sixty, 20 &#181;l drops of EB suspension onto the inner surface. Accomplish this efficiently using a multi-channel pipet fitted with 6 tips. Each 20 &#181;l drop now has 500 cells.</li>
		<li>Gently replace lid onto bottom half of the bacterial petri-dish, being careful not to dislodge hanging drops. Place dishes into cell culture incubator at 37&#730; C. After 2 days, cells are ready to wash down as described in 5.3).</li>
	</ol>
	</li>
	<li>Wash-down of Embryoid Bodies 
	Note: All wash-down steps are performed in a sterile tissue culture hood.
	<ol>
		<li>After 2 days EB&#39;s are ready for washing down and transfer to 6 cm bacterial petri dishes. Pre-warm 3 ml of EB media per petri dish to RT. Each 6 cm bacterial petri dish can effectively hold 2 lids worth of hanging drops. 
		Note: Be sure to use a non-coated petri dish for this step (see materials table). Do not use a tissue culture dish or any other surface that encourages cell adhesion. EBs should remain suspended in media until ready to be plated as described in section 6.</li>
		<li>Remove 10 cm petri dishes from incubator and place into sterile tissue culture hood. Carefully remove lid with EBs and tilt at a 45 degree angle.</li>
		<li>Using a 5 ml serological pipet containing 3 ml of RT EB media, gently wash EBs into a pool at the bottom of the lid. Carefully inspect the lid for EBs that are stuck to the surface and re-rinse if necessary.</li>
		<li>After washing all EBs transfer to a 6 cm petri dish.</li>
		<li>Repeat steps 5.3.2)-5.3.4) for all EBs. Each 6 cm petri dish should contain EBs from two 10 cm lids. Place all dishes back into incubator at 37 &#730;C for two more days. 
		NOTE: EBs that are too close together in suspension may stick together and form large aggregates. This can negatively impact cardiac differentiation efficiency as well as significantly reduce the numbers of available EBs. To prevent aggregation, EBs should be checked each day and separated by gently moving back and forth, then side to side. The use of bacterial dishes in the early differentiation steps is necessary to prevent EB attachment to the dish and allow EBs to grow in suspension.</li>
	</ol>
	</li>
</ol>
6. Plating and Treatment of EBs With Grem2
<ol>
	<li>Prepare Grem2 treatment medium by adding sufficient volume of stock (0.5 &#181;g/&#181;l) Grem2 to RT EB medium for a final dilution of 1-5 &#181;g/ml. 
	NOTE: The effective concentration for treatment of EBs varies depending on the cell line and specific activity of the current lot of Grem2. It is recommended that prior to use the dose is titrated to find maximal effectiveness. For the CGR8 mESC line we routinely use 3-5 &#181;g/ml of Grem2. Effective concentrations of Grem2 for atrial myocyte generation will produce rapidly contracting cells between days 7-8 that are widespread throughout each well. If contracting phenotype is not observed in treated cultures it is recommended that the Grem2 dose be titrated within the range indicated.</li>
	<li>Prepare 6-well tissue culture plates by aspirating gelatin coating solution from each well and adding 2 ml of RT Grem2 treatment media. Remove EBs from incubator and place into sterile tissue culture hood.</li>
	<li>Using a P1000 set to 100 &#181;l transfer 30 EBs from 6 cm petri dishes to each well. Place EBs into incubator and evenly disperse by gently moving plate back to front then side to side.
	<ol>
		<li>After EBs have attached to gelatin coated wells, replace Grem2 media every two days until day 10. After day 10, discontinue the Grem2 treatment and add fresh EB media every two days to maintain healthy cells. 
		NOTE: After attaching, EBs will flatten out along the surface of the coated plate.</li>
	</ol>
	</li>
</ol>
7. Cell Dissociation for RT-qPCR Analysis
<ol>
	<li>Cell Dissociation with Trypsin-EDTA
	<ol>
		<li>Aspirate media from each well and rinse twice with 1 ml per well of sterile DPBS minus Ca2+ and Mg2+.</li>
		<li>Add 0.5 ml 0.25% sterile Trypsin-EDTA solution to each well from which cells will be collected.</li>
		<li>Place plate in incubator at 37 &#730;C for 5 min.</li>
		<li>After 5 min check cells for dissociation. If cells still remain attached to bottom of the well tap gently to loosen. If tapping does not loosen cells, place back into incubator and monitor every 2 min until cells are completely detached.</li>
		<li>Neutralize Trypsin-EDTA solution by adding 0.5 ml EB media to each well.</li>
		<li>Transfer entire 1 ml of cell suspension to a 1.5 ml micro centrifuge tube.</li>
		<li>&#160;Pellet cells by spinning in a table-top centrifuge for 5 min at 300 x g.</li>
		<li>Aspirate media from pellet and move on to lysis immediately or store pellet at -70 &#730;C until ready for lysis. Long-term storage of pellets is not recommended as this can lead to degradation of RNA.</li>
	</ol>
	</li>
	<li>Cell Lysis and Molecular Analysis
	<ol>
		<li>At this point cells are ready for RNA isolation using a commercial column extraction kit or using RNA extraction reagent according to the protocols supplied by the manufacturers (see table of materials). Once isolated, reverse transcribed RNA and use cDNA for RT-qPCR analysis using standard techniques20, 21. 
		NOTE: Primers used by this lab for RT-qPCR are listed in Table 1. Atrial identity is confirmed using a combination of RT-qPCR to look at expression of atrial and ventricular genes and electrophysiology to record action potential duration (see section 8). A selection of genes is included in this protocol as an example of reliable atrial and ventricular markers. Further information about atrial and ventricular gene expression in the context of pluripotent stem cell differentiation is found in reference 14.</li>
	</ol>
	</li>
</ol>
8. Electrophysiological Analysis
<ol>
	<li>Cell Dissociation with Collagenase
	<ol>
		<li>Aspirate media from each well and rinse twice with 1 ml per well of sterile PBS.</li>
		<li>Add 0.5 ml of 1 mg/ml collagenase solution to each well.</li>
		<li>Place plate in incubator at 37 &#730;C for 10 min.</li>
		<li>After 5 min check cells for dissociation. If cells still remain attached to each other or the bottom of the well tap gently to loosen. Further dissociate the cells by gentle trituration with a P1000. 
		NOTE: To facilitate patch clamp recordings cells should be triturated until a single-cell suspension is achieved.</li>
		<li>Add 0.5 ml EB media to each well and mix by pipetting.</li>
		<li>Transfer entire 1 ml of cell suspension to a 1.5 ml micro centrifuge tube.</li>
		<li>Pellet cells by spinning in a table-top centrifuge for 5 min at 300 x g.</li>
		<li>Aspirate media from cell pellets.</li>
		<li>Re-suspend cells in 500 &#181;l PBS with 10% FBS, being sure to triturate into a single cell suspension.</li>
	</ol>
	</li>
	<li>Electrophysiological Characterization. 
	NOTE: Many excellent protocols have been published in this journal on using single cell patch clamp to measure cell membrane potentials. For detailed information on how to perform single cell patch clamp the novice reader is referred to these protocols21-24. The following contains specific information for this protocol that will help the experienced electrophysiologist prepare and handle mESC derived CMs for subtype characterization.
	<ol>
		<li>Prepare intracellular recording solution composed of the following: 10 mM HEPES buffer, 5 mM MgATP, 2 mM EGTA, 110 mM potassium glutamate, 10 mM KCl, and 10 mM NaCl. Adjust solution to a pH of 7.2 using NaOH.</li>
		<li>Prepare extracellular recording (bath) solution composed of the following: 2 mM HEPES, 10 mM glucose, 1 mM MgCl2, 2 mM CaCl2, 5.4 mM KCl, and 137 mM NaCl. Adjust solution to a pH of 7.4 using NaOH.</li>
		<li>Prepare a glass pipet that measures 2-5 M&#937; resistance when backfilled with recording solution using standard borosilicate glass with filament.</li>
		<li>Transfer 100 &#181;l of suspended cells into recording chamber containing extracellular recording solution using a P200. 
		NOTE: Cells may be patched in suspension or, to facilitate handling and use for drug treatment and/or perfusion assays, may be seeded onto a gelatin coated coverslip as outlined in 8.2.5).</li>
		<li>Prepare gelatin coated glass coverslips by placing a 10 mm diameter glass coverslip into each well of a 6-well plate and covering with gelatin solution as described in section 3.1) of this protocol.
		<ol>
			<li>After at least 30 min&#160;aspirate gelatin solution and add 100 &#181;l of suspended cells directly to coverslip and place entire 6-well plate into incubator for at least 2 hr or until cells have attached. After cells have attached, remove cover slip and place in recording chamber with extracellular recording solution. 
			NOTE: If using the &#945;MHC-DsRed fluorescent cardiac reporter mESC line, CMs may be identified by their red fluorescent&#160;nuclei. If not using a cardiac reporter line, spontaneously contracting cells can be observed and isolated for measurements. Pluripotent stem cell derived CMs are usually smaller and more rounded, lacking the characteristic rectangular morphology of fully formed adult cardiac myocytes.</li>
		</ol>
		</li>
		<li>Make all recordings at 37 &#730;C. Patch single cells using whole cell clamp in current-clamp mode with a borosilicate glass pipet of 2-5 M&#937; resistance. Use gentle negative pressure to achieve gigaohm seal prior to gaining whole cell access. Apply rapid negative pressure to rupture membrane and gain whole cell access prior to recording membrane potentials.</li>
		<li>Evoke action potentials using 4&#160;msec depolarizing current injections. 
		NOTE: For PSC-derived CMs the amount of current required to reproducibly trigger action potentials may vary. In order to find optimal threshold current, start at a relatively low current and increase triggering current amplitude in a stepwise fashion until reproducible action potentials are obtained. 
		NOTE: Action potential durations for Grem2-induced atrial myocytes are usually in the range of 20-40 ms and lack a plateau phase (Figure 6B).</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Loya, K., Eggenschwiler, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hepatic+differentiation+of+pluripotent+stem+cells.">Hepatic differentiation of pluripotent stem cells.</a> Biological Chemistry. 390 (10), 1047-1055 (2009).</li><li>Narazaki, G., Uosaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+and+systematic+differentiation+of+cardiovascular+cells+from+mouse+induced+pluripotent+stem+cells.">Directed and systematic differentiation of cardiovascular cells from mouse induced pluripotent stem cells.</a> Circulation. 118 (5), 498-506 (2008).</li><li>Zhang, Y., Pak, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+single-step+induction+of+functional+neurons+from+human+pluripotent+stem+cells.">Rapid single-step induction of functional neurons from human pluripotent stem cells.</a> Neuron. 78 (5), 785-798 (2013).</li><li>Park, I. H., Arora, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Disease-specific+induced+pluripotent+stem+cells.">Disease-specific induced pluripotent stem cells.</a> Cell. 134 (5), 877-886 (2008).</li><li>Golos, T. G., Giakoumopoulos, M., Garthwaite, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cells+as+models+of+trophoblast+differentiation:+progress,+opportunities,+and+limitations.">Embryonic stem cells as models of trophoblast differentiation: progress, opportunities, and limitations.</a> Reproduction. 140 (1), 3-9 (2010).</li><li>Boheler, K. R., Czyz, J., Tweedie, D., Yang, H. T., Anisimov, S. V., Wobus, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+pluripotent+embryonic+stem+cells+Into+cardiomyocytes.">Differentiation of pluripotent embryonic stem cells Into cardiomyocytes.</a> Circulation Research. 91 (3), 189-201 (2002).</li><li>Burridge, P. W., Anderson, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+human+embryonic+stem+cell+embryoid+body+homogeneity+and+cardiomyocyte+differentiation+from+a+novel+V-96+plate+aggregation+system+highlights+interline+variability.">Improved human embryonic stem cell embryoid body homogeneity and cardiomyocyte differentiation from a novel V-96 plate aggregation system highlights interline variability.</a> Stem Cells. 25 (4), 929-938 (2007).</li><li>Cai, C. L., Liang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isl1+Identifies+a+cardiac+progenitor+population+that+proliferates+prior+to+differentiation+and+contributes+a+majority+of+cells+to+the+heart.">Isl1 Identifies a cardiac progenitor population that proliferates prior to differentiation and contributes a majority of cells to the heart.</a> Developmental Cell. 5 (6), 877-889 (2003).</li><li>Fujiwara, M., Yan, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+and+enhancement+of+cardiac+cell+differentiation+from+mouse+and+human+induced+pluripotent+stem+cells+with+Cyclosporin-A.">Induction and enhancement of cardiac cell differentiation from mouse and human induced pluripotent stem cells with Cyclosporin-A.</a> PLoS ONE. 6 (2), e16734 (2011).</li><li>Rai, M., Walthall, J. M., Hu, J., Hatzopoulos, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Continuous+antagonism+by+Dkk1+counter+activates+canonical+wnt+signaling+and+promotes+cardiomyocyte+differentiation+of+embryonic+stem+cells.">Continuous antagonism by Dkk1 counter activates canonical wnt signaling and promotes cardiomyocyte differentiation of embryonic stem cells.</a> Stem Cells and Development. (1), 54-66 (2012).</li><li>Burridge, P. W., Matsa, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemically+defined+generation+of+human+cardiomyocytes.">Chemically defined generation of human cardiomyocytes.</a> Nature Methods. 11 (8), 855-860 (2014).</li><li>Lian, X., Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directed+cardiomyocyte+differentiation+from+human+pluripotent+stem+cells+by+modulating+Wnt/&#946;-catenin+signaling+under+fully+defined+conditions.">Directed cardiomyocyte differentiation from human pluripotent stem cells by modulating Wnt/&#946;-catenin signaling under fully defined conditions.</a> Nature Protocols. 8 (1), 162-175 (2013).</li><li>Zhang, J., Klos, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extracellular+matrix+promotes+highly+efficient+cardiac+differentiation+of+human+pluripotent+stem+cells:+the+matrix+sandwich+method.">Extracellular matrix promotes highly efficient cardiac differentiation of human pluripotent stem cells: the matrix sandwich method.</a> Circulation Research. 111 (9), 1125-1136 (2012).</li><li>Tanwar, V., Bylund, J. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gremlin+2+promotes+differentiation+of+embryonic+stem+cells+to+atrial+fate+by+activation+of+the+JNK+signaling+pathway.">Gremlin 2 promotes differentiation of embryonic stem cells to atrial fate by activation of the JNK signaling pathway.</a> Stem Cells. 32 (7), 1774-1788 (2014).</li><li>Kattman, S. J., Witty, A. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Stage-specific+optimization+of+activin/nodal+and+BMP+signaling+promotes+cardiac+differentiation+of+mouse+and+human+pluripotent+stem+cell+lines.">Stage-specific optimization of activin/nodal and BMP signaling promotes cardiac differentiation of mouse and human pluripotent stem cell lines.</a> Cell Stem Cell. 8 (2), 228-240 (2011).</li><li>M&#252;ller, I. I., Melville, D. B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+modeling+in+zebrafish+demonstrates+that+the+atrial-fibrillation-associated+gene+GREM2+regulates+cardiac+laterality,+cardiomyocyte+differentiation+and+atrial+rhythm.">Functional modeling in zebrafish demonstrates that the atrial-fibrillation-associated gene GREM2 regulates cardiac laterality, cardiomyocyte differentiation and atrial rhythm.</a> Disease Models &amp; Mechanisms. 6 (2), 332-341 (2013).</li><li>Kattamuri, C., Luedeke, D. M., Thompson, T. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+and+purification+of+recombinant+protein+related+to+DAN+and+cerberus+(PRDC).">Expression and purification of recombinant protein related to DAN and cerberus (PRDC).</a> Protein Expression and Purification. 82 (2), 389-395 (2012).</li><li>Schulz, H., Kolde, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+FunGenES+Database:+A+genomics+resource+for+mouse+embryonic+stem+cell+differentiation.">The FunGenES Database: A genomics resource for mouse embryonic stem cell differentiation.</a> PLoS ONE. 4 (9), e6804 (2009).</li><li>. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phosphate-buffered+saline+(PBS).">Phosphate-buffered saline (PBS).</a> Cold Spring Harbor Protocols. , (2006).</li><li>Livak, K. J., Schmittgen, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+Real-Time+quantitative+PCR+and+the+2&#8722;&#916;&#916;CT+method.">Analysis of relative gene expression data using Real-Time quantitative PCR and the 2&#8722;&#916;&#916;CT method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Beck, H., Semisch, M., Culmsee, C., Plesnila, N., Hatzopoulos, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Egr-1+regulates+expression+of+the+glial+scar+component+phosphacan+in+astrocytes+after+experimental+stroke.">Egr-1 regulates expression of the glial scar component phosphacan in astrocytes after experimental stroke.</a> American Journal of Pathology. 173 (1), 77-92 (2008).</li><li>Graham, E. L., Balla, C., Franchino, H., Melman, Y., del Monte, F., Das, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation,+culture,+and+functional+characterization+of+adult+mouse+cardiomyoctyes.">Isolation, culture, and functional characterization of adult mouse cardiomyoctyes.</a> Journal of Visualized Experiments. (79), (2013).</li><li>Brown, A. L., Johnson, B. E., Goodman, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Patch+clamp+recording+of+ion+channels+expressed+in+Xenopus+oocytes.">Patch clamp recording of ion channels expressed in Xenopus oocytes.</a> Journal of Visualized Experiments. (20), (2008).</li><li>Brown, A. L., Johnson, B. E., Goodman, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Making+patch-pipettes+and+sharp+electrodes+with+a+programmable+puller.">Making patch-pipettes and sharp electrodes with a programmable puller.</a> Journal of Visualized Experiments. (20), (2008).</li><li>Sachinidis, A., Fleischmann, B. K., Kolossov, E., Wartenberg, M., Sauer, H., Hescheler, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac+specific+differentiation+of+mouse+embryonic+stem+cells.">Cardiac specific differentiation of mouse embryonic stem cells.</a> Cardiovascular Research. 58 (2), 278-291 (2003).</li><li>Keller, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+differentiation+of+embryonic+stem+cells.">In vitro differentiation of embryonic stem cells.</a> Current Opinion in Cell Biology. 7 (6), 862-869 (1995).</li><li>H&#246;pfl, G., Gassmann, M., Desbaillets, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiating+embryonic+stem+cells+into+embryoid+bodies.+Volume+2:+molecular+embryo+analysis,+live+imaging,+transgenesis,+and+cloning.">Differentiating embryonic stem cells into embryoid bodies. Volume 2: molecular embryo analysis, live imaging, transgenesis, and cloning.</a> Methods in Molecular Biology. , 254-279 (2004).</li><li>Ao, A., Williams, C. H., Hao, J., Hong, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+mouse+embryonic+stem+cell+based+assay+for+quantifying+cardiogenic+Induction+Efficiency.">Modified mouse embryonic stem cell based assay for quantifying cardiogenic Induction Efficiency.</a> Journal of Visualized Experiments. (50), (2011).</li><li>Antonchuk, J., Gassmann, M., Desbaillets, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formation+of+embryoid+bodies+from+human+pluripotent+stem+cells+using+AggreWell&#8482;+plates.">Formation of embryoid bodies from human pluripotent stem cells using AggreWell&#8482; plates.</a> Basic Cell Culture Protocols. 946, 523-533 (2013).</li><li>Horii, T., Nagao, Y., Tokunaga, T., Imai, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serum-free+culture+of+murine+primordial+germ+cells+and+embryonic+germ+cells.">Serum-free culture of murine primordial germ cells and embryonic germ cells.</a> Theriogenology. 59 (5-6), 1257-1264 (2003).</li></ol>

The authors of this manuscript have no competing financial interests.

This protocol routinely produces cultures with a high percentage of CMs that are characteristic of the atrial lineage. As with any differentiation protocol, the quality of the mESCs prior to differentiation should be given particular attention. mESCs should be routinely monitored for proper morphology (Figure 1A). Any spontaneous differentiation that occurs prior to formation of EBs will severely limit the efficiency of cardiogenesis and should be removed before passaging (Figure 1B). EB size also affects cardiogenesis. Starting cell numbers between 200 and 1,000 per EB have been tested and 500 cells per EB routinely produces the highest numbers of CMs. Cells that are passaged the day prior to EB formation also tend to differentiate more efficiently.
The &#34;hanging drop&#34; method is used to generate EBs in this protocol25. Other methods for making EBs used for cardiac differentiation have been reported26-29. The &#34;hanging drop&#34; method is simple and inexpensive, readily adopted in any laboratory with common cell culture equipment and materials, and can be conducted by anyone with cell culture experience. It is also versatile, producing EBs that may be easily manipulated, transferred, plated, or collected for RNA analyses according to the needs of the investigators. It is also scalable, producing small or large numbers of EBs as needed.
The protocol dictates the plating of EBs onto gelatin coated plates at Day 4 of differentiation. This step converts differentiating EBs into the more typical monolayer format common to tissue culture. In some cases it may be more convenient and or necessary to leave the EBs in suspension rather than plating. If suspension EBs are preferred for downstream applications the cells may be left in suspension throughout the differentiation process instead of being plated at day 4. When treating with Grem2, the EBs are placed into 1.5 ml centrifuge tubes and allowed to settle by gravity. The media is then carefully removed with a P1000, leaving a small amount behind to prevent aspiration of the EBs, and 1.5 ml Grem2 media is added to the tube. This suspension is then transferred to a 6 cm petri dish and placed back at 37&#730;C. The media is changed using the micro centrifuge tube method indicated above every two days.
Differentiation day 4 was chosen for treatment of cells with Grem2 based on expression analysis of genes generally associated with major developmental events. Addition of Grem2 after peak expression of the gastrulation marker genes T Brachyury and Cerberus like 1 and at the onset of expression of cardiac progenitor cell markers such as Nkx2-5 is critical for both cardiogenesis and atrial specification. Because peak expression of these genes may vary slightly among cell lines it is recommended to monitor expression of these genes during differentiation to determine optimal timing for Grem2 addition. Of the lines tested for this protocol, most responded to treatment with Grem2 between days 4 and 5 of differentiation.
As with any recombinant protein, the activity of Grem2 varies from lot to lot. It is therefore recommended that Grem2 from the same lot is used for each set of experiments to maintain consistency. When a new lot is purchased, effectiveness may be assessed by titrating the dose in the range of 1-5 &#181;g/ml. This protocol yields CMs from the atrial lineage of sufficient number for&#160;analysis and culture. Cells produced using this protocol may be analyzed via flow cytometry, electrophysiology, RT-qPCR, or re-cultured for use in live cell assays. To facilitate the identification and isolation of CMs after culture the &#945;MHC-DsRed-Nuc reporter line was developed and is routinely used by our laboratory.
This protocol uses serum to maintain healthy cell cultures throughout the differentiation process. While this protocol routinely produces robust, atrial-like cardiac differentiation, use of serum introduces an undefined element to the differentiation process. This may limit usefulness of the protocol in cases where a more defined media is required. If a more defined media preparation is required, serum may be replaced by KnockOut Serum Replacement30. When switching to a defined culture media it is recommended that timing and concentration of Grem2 treatment be re-optimized as already described in this section.
RT-qPCR is used to quantify the expression of genes specific to atrial and ventricular myocytes. Grem2 treatment leads to an induction of atrial specific genes while down regulating or not affecting the expression of ventricular genes. This result is typical for Grem2-induced CMs. A suggested set of genes for assessing atrial identity is included in this protocol. An expanded set of genes and a discussion of their relevance can be found in works referenced by this protocol14,16. As the field continues to evolve and our understanding of cardiac differentiation improves it is recommended that this list of atrial and ventricular identity markers is assessed and revised as needed.
Generating homogeneous cultures of CMs will facilitate clinical research efforts focused on diseases known to affect specific cardiac subtypes and provide a model system for basic research focused on understanding the mechanisms of chamber specification in vertebrate hearts.

Pluripotent stem cells are a powerful tool for generating and studying cells from a host of difficult to access tissues for basic research and pre-clinical studies, especially in humans1-5. Proper modulation of developmental signaling pathways can direct the differentiation of pluripotent stem cells to the desired phenotypic fate. Many protocols have been developed to generate cardiomyocytes (CMs) from pluripotent stem cells6-14. These protocols generally involve modulation of TFG&#946; superfamily (Activin, BMP, and TGF&#946;) and Wnt pathways through timed addition of exogenous growth factors and/or small molecules10,12-15. These protocols are generally effective at increasing the percentage of cells that become CMs, but lack specificity, generating a mixed population of cells representing atrial, ventricular, and nodal/conduction system lineages. In order to study specific cardiac subtypes a more directed differentiation approach is required.
Gremlin2 (Grem2, also called Protein Related to Dan and Cerberus or PRDC for short) is a secreted BMP antagonist that is necessary&#160;for proper cardiac differentiation and atrial chamber formation during cardiac development in zebrafish16. Treating differentiating embryonic stem cells with Grem2 at differentiation day 4, just after peak expression of mesodermal markers T-Brachyury and Cerberus like 1, increases the yield of CMs and generates a pool of cells predominantly of the atrial lineage14.
Recombinant Grem2 is used to treat the differentiating cells and can be made using standard protein production techniques17 or can be purchased commercially. It is highly soluble in aqueous solutions and may be added exogenously to cultures at the desired time point.
Differentiation can be tracked using RT-qPCR to quantify expression of markers representative of cardiovascular progenitors, cardiac progenitors, and committed CMs. Immunofluorescence can also be used to identify and visualize spatial distribution of cardiac cell types.
Applications that require pure populations are more readily carried out when using a reporter system to identify and isolate CMs. For this purpose, we have introduced the &#945;MHC-DsRedNuc construct into the mouse CGR8 ES cell line14. CGR8 cells grow and remain pluripotent without feeder cells, facilitating expansion and differentiation assays18. The ES cell line contains a DSRed fluorescent protein coding sequence with a nuclear localization signal under the cardiac-specific alpha Myosin Heavy Chain (&#945;Mhc or Myh6) gene promoter. Using these cells, CMs can be easily identified and isolated for quantification,&#160;cell sorting,&#160;electrophysiology, drug screens, and studying mechanisms of atrial differentiation.

<table><tbody><tr><td>GMEM</td><td>Life Technologies</td><td>11710</td><td></td></tr><tr><td>FBS</td><td>Life Technologies</td><td>10082</td><td></td></tr><tr><td>Glutamax</td><td>Life Technologies</td><td>35050</td><td></td></tr><tr><td>LIF</td><td>EMD Millipore</td><td>ESG1107</td><td></td></tr><tr><td>&amp;szlig;-Mercaptoethanol</td><td>Sigma</td><td>M3148</td><td></td></tr><tr><td>IMDM</td><td>Sigma</td><td>I3390</td><td></td></tr><tr><td>Non-Essential Amino Acids</td><td>Sigma</td><td>M7145</td><td></td></tr><tr><td>10 cm Tissue Culture Plates</td><td>Sarstedt</td><td>83.3902</td><td></td></tr><tr><td>10 cm Bacterial Petri Dishes</td><td>VWR</td><td>25384-342</td><td></td></tr><tr><td>6 cm Bacterial Petri Dishes</td><td>VWR</td><td>25384-092</td><td></td></tr><tr><td>6-well tissue culture plates</td><td>Sarstedt</td><td>83.3920</td><td></td></tr><tr><td>Gremlin 2 recombinant protein</td><td>R&amp;amp;D Systems</td><td>2069-PR-050</td><td></td></tr><tr><td>Sterile filter units</td><td>Thermo Fisher</td><td>09-741-02</td><td></td></tr><tr><td>Gelatin (from porcine skin)</td><td>Sigma</td><td>G1890</td><td></td></tr><tr><td>10X PBS, Sterile</td><td>Sigma</td><td>P5493</td><td></td></tr><tr><td>BSA&amp;nbsp;</td><td>Sigma</td><td>5470</td><td></td></tr><tr><td>0.05% Trypsin-EDTA solution</td><td>Life Technologies</td><td>25300054</td><td></td></tr><tr><td>DPBS, no Calcium, no Magnesium</td><td>Life Technologies</td><td>14200</td><td></td></tr></tbody></table>

differentiation of atrial cardiomyocytes from pluripotent stem cells using the bmp antagonist grem2

Protocols for generating populations of cardiomyocytes from pluripotent stem cells have been developed, but these generally yield cells of mixed phenotypes. Researchers interested in pursuing studies involving specific myocyte subtypes require a more directed differentiation approach. By treating mouse embryonic stem (ES) cells with Grem2, a secreted BMP antagonist that is necessary for atrial chamber formation in vivo, a large number of cardiac cells with an atrial phenotype can be generated. Use of the engineered Myh6-DSRed-Nuc pluripotent stem cell line allows for identification, selection, and purification of cardiomyocytes. In this protocol embryoid bodies are generated from Myh6-DSRed-Nuc cells using the hanging drop method and kept in suspension until differentiation day 4 (d4). At d4 cells are treated with Grem2 and plated onto gelatin coated plates. Between d8-d10 large contracting areas are observed in the cultures and continue to expand and mature through d14. Molecular, histological and electrophysiogical analyses indicate cells in Grem2-treated cells acquire atrial-like characteristics providing an in vitro model to study the biology of atrial cardiomyocytes and their response to various pharmacological agents.

Prior to differentiation, pluripotent stem cells should be compact and free of spontaneous differentiation. The cells shown in Figure 1A are ready to be singularized and used for hanging drops as described in 5.1 of the protocol section. The cells shown in Figure 1B are spontaneously differentiating and should not be used for preparation of hanging drops.
The panels included in Figure 2 show successfully formed EBs at differentiation day 2. Quality EBs generally form best within evenly spaced, well rounded hanging drops as shown in Figure 2. By differentiation day 2, EBs should be visible to the naked eye as spherical arrangements of differentiating stem cells at the tips of the hanging drops (Figure 2). These EBs are ready for wash-down as described in 5.3 of the protocol section.
During days 2-4, washed-down EBs in suspension should continue to grow in size. At day 4, well-formed EBs should be free-floating and homogeneous in size and shape (Figure 3). The EBs shown in Figure 3 are ready to be transferred to pre-coated plates and treated with Grem2 as described in 6.1-6.3 of the protocol section.
Once plated, EBs should flatten as cells migrate out from the EB onto the surface of the tissue culture plate. Shown in Figure 4 are examples of properly attached EBs at differentiation days 8 (left panel) and 10 (right panel). Cells should continue to be monitored daily to be sure they remain attached and to check for cardiac differentiation as described below.
Contracting cells, indicating the presence of CMs, may be observed as early as day 6 and as late as day 9. Typically, contracting cells will be present at day 8 of differentiation. The numbers of contracting cells in each well should continue to increase through differentiation day 14. In non-treated control wells small, slowly contracting patches are observed (Video S1) while in Grem2 treated wells large patches with a relatively fast contracting rate are common (Video S2). Occasionally, cardiac differentiation fails to occur. In such cases the timing of Grem2 treatment, the activity of the protein, and the state of the cells prior to differentiation should be re-evaluated to be sure that each of these conditions is optimized as described in this protocol (see discussion).
Figure 5 shows results typical of Grem2-treated cultures and untreated controls. RT-qPCR analysis of gene expression in cells collected and lysed as described in 7.1-7.2 of the protocol section typically reveal high levels of cardiac structural and regulatory genes in Grem2-treated cultures (Figure 5A). If the &#945;MHC-DsRed-Nuc cell line is being used, the increased yield of CMs can be observed visually as higher numbers of DsRed-labeled nuclei in Grem2-treated wells (Figure 5B, bottom panel).
In addition to generating an increased number of CMs, Grem2 treatment also biases differentiation towards an atrial like phenotype. The atrial phenotype is usually confirmed in two ways. First, RT-qPCR analysis of cells collected as described in 7.1-7.2 of the protocol section should reveal that genes characteristic of atrial CMs are upregulated while ventricular genes are downregulated (Figure 6A). Second, patch clamp measurements of cellular action potential duration (as described in 8.1-8.2 of the protocol section) reveals that a short, atrial-like action potential predominates among Grem2 treated cells (Figure 6B).
<img alt="Figure 1" src="/files/ftp_upload/53919/53919fig1.jpg" /> 
Figure 1. Representative mouse embryonic stem cells (mESCs). Pluripotent mouse embryonic stem cells prior to EB formation with characteristic large nucleus, compact colony-forming morphology (A, black arrows), and white phase borders (A, orange arrows). Spontaneous differentiation of mouse ES cells is indicated by larger, single cells separated from colonies (B, black arrows) and loss of phase border around colonies (B, orange arrow). Images captured using an inverted phase contrast microscope. Scale bars represent 50 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53919/53919fig2.jpg" /> 
Figure 2. Embryoid bodies (EBs) at day 2 of differentiation. Hanging drops suspended from a petri dish lid (left, scale bar is 2 cm) are evenly spaced and homogeneous in size. EBs in hanging drops are observed as compact spheres in the center of each drop (right, scale bar is 1 mm). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53919/53919fig3.jpg" /> 
Figure 3. EBs in suspension at day 4 of differentiation. Ideal EBs should be homogeneous in size and shape with minimal adherence to each other or the bottom of the plate. Images were captured using a dissecting scope under sterile conditions. Scale bar represents 100 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53919/53919fig4.jpg" /> 
Figure 4. Typical EB morphology after plating. Plated EBs at days 8 (left) and 10 (right) of differentiation. As EBs attach to gelatinized plates, they flatten out and appear as dense centers surrounded by an increasingly confluent monolayer of cells. Small pockets of contracting cells are generally observed around differentiation days 6-8 near the center of the EB. These pockets continue to expand throughout the differentiation protocol to form larger sheets of contracting cells in the surrounding monolayers. Images captured using an inverted phase contrast microscope and. Scale bars represent 200 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53919/53919fig5.jpg" /> 
Figure 5. Cardiac differentiation in Grem2-treated and non-treated control wells. qPCR analysis of cardiac markers indicates an increase in cardiac gene expression in EBs treated with Grem2 as early as day six and continuing through day 10 of differentiation (A). The engineered &#945;MHC-DsRed-Nuc cell line shows large pools of DsRed-labeled CMs in cultures treated with Grem2 (B, bottom) vs. non-treated controls (B, top). Figures adapted with permission from14. Error bars represent SEM from at least 3 replicate experiments. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53919/53919fig6.jpg" /> 
Figure 6. Characterization of atrial-like cardiac phenotype. qPCR analysis indicates an increase in expression of atrial genes and downregulation of genes associated with ventricular CMs in Grem2-treated samples (A). Control cultures produce CMs with action potential duration characteristic of atrial and ventricular cells while treatment with Grem2 generates cell populations with the short action potential duration characteristic of atrial myocytes (B). Samples were compared using student&#39;s t test. *, p &#60; 0.05; ***, p &#60; 0.001 Figures adapted with permission from14. Error bars represent SEM from at least 3 replicate experiments. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/53919fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Video S1" src="/files/ftp_upload/53919/53919video1.jpg" /> 
<a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/03b_Video_S1.mpg">Video S1. Non-treated control wells (Right click to download).</a> Small, slowly-contracting pockets or patches of cardiac myocytes around the periphery of the EB (white arrows). Video was taken at differentiation day 10.
<img alt="Video S2" src="/files/ftp_upload/53919/53919video2.jpg" /> 
<a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53919/03c_Video_S2.mp4">Video S2. Grem2-treated wells (Right click to download)</a>. Typical results observed in Grem2-treated cells. Large patches of quickly contracting cells are observed throughout the plated EB. Video was taken at differentiation day 10.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Forward Primer (5&#39; to 3&#39;)</td>
			<td>Reverse Primer (5&#39; to 3&#39;)</td>
		</tr>
		<tr>
			<td>Actin</td>
			<td>CTACGAGGGCTATGCTCTCCC</td>
			<td>CCGGACTCATCGTACTCCTGC</td>
		</tr>
		<tr>
			<td>Gapdh</td>
			<td>CTCACTCAAGATTGTCAGCAATG</td>
			<td>GAGGGAGATGCTCAGTGTTGG</td>
		</tr>
		<tr>
			<td>Gata4</td>
			<td>ACAAGGTCCAAGCCTACTCCA</td>
			<td>CTGCGATGTCTGAGTGACAGG</td>
		</tr>
		<tr>
			<td>Gja1</td>
			<td>ACAAGGTCCAAGCCTACTCCA</td>
			<td>CCGGGTTGTTGAGTGTTACAG</td>
		</tr>
		<tr>
			<td>Gja5</td>
			<td>ATAACAGTGGGCAGTTGAACAGCAG</td>
			<td>TACCCAATAACGAATGTGGGAGATG</td>
		</tr>
		<tr>
			<td>Myh6</td>
			<td>TACACTCTTCTCTACCTATGCTTCT</td>
			<td>CACTATCTTCTTGAACTCAATGC</td>
		</tr>
		<tr>
			<td>Myl2</td>
			<td>AGAGATCGATGAAATGATCAAAGAG</td>
			<td>CAGAGCCAAGACTTCCTGTTTATT</td>
		</tr>
		<tr>
			<td>Myl7</td>
			<td>AAATCAGACCTGAAGGAGACCTATT</td>
			<td>CAGAGAGACTTGTAGTCAATGTTGC</td>
		</tr>
		<tr>
			<td>Nkx2.5</td>
			<td>GTCTCAATGCCTATGGCTAC</td>
			<td>CTACGTCAATAAAGTGGGATG</td>
		</tr>
		<tr>
			<td>Tnnt2</td>
			<td>CAGAGGAGGCCAACGTAGAAG</td>
			<td>CTCCATCGGGGATCTTGGGT</td>
		</tr>
	</tbody>
</table>
Table 1. List of qPCR primer sequences. Primer sequences are listed alphabetically by gene name. Sequences are provided 5&#39; to 3&#39; for all genes analyzed in Figures 5 and 6.

Watch this Scientific Journal Video about Differentiation of Atrial Cardiomyocytes from Pluripotent Stem Cells Using the BMP Antagonist Grem2 at JoVE.com

Differentiation of Atrial Cardiomyocytes from Pluripotent Stem Cells Using the BMP Antagonist Grem2

Generating cardiomyocytes from pluripotent stem cells in vitro allows access to large amounts of cardiac tissue in vitro for basic science and clinical applications. This protocol uses the atrializing factor Grem2 to both increase the numbers of cardiomyocytes obtained and to generate cardiomyocytes with an atrial phenotype.

Protocols for generating populations of cardiomyocytes from pluripotent stem cells have been developed, but these generally yield cells of mixed ...

differentiation-atrial-cardiomyocytes-from-pluripotent-stem-cells

Nanyang Technological University

Research

JoVE Journal

Developmental Biology

7.7K Views.  Vanderbilt University School of Medicine. Generating cardiomyocytes from pluripotent stem cells in vitro allows access to large amounts of cardiac tissue in vitro for basic science and clinical applications. This protocol uses the atrializing factor Grem2 to both increase the numbers of cardiomyocytes obtained and to generate cardiomyocytes with an atrial phenotype.

Video: Differentiation of Atrial Cardiomyocytes from Pluripotent Stem Cells Using the BMP Antagonist Grem2

Derivation of Cardiac Progenitor Cells from Embryonic Stem Cells

Cardiac progenitor cells (CPCs) have the capacity to differentiate into cardiomyocytes, smooth muscle cells (SMC), and endothelial cells and hold great promise in cell therapy against heart disease. Among various methods to isolate CPCs, differentiation of embryonic stem cell (ESC) into CPCs attracts great attention in the field since ESCs can provide unlimited cell source. As a result, numerous strategies have been developed to derive CPCs from ESCs. In this protocol, differentiation and purification of embryonic CPCs from both mouse and human ESCs is described. Due to the difficulty of using cell surface markers to isolate embryonic CPCs, ESCs are engineered with fluorescent reporters activated by CPC-specific cre recombinase expression. Thus, CPCs can be enriched by fluorescence-activated cell sorting (FACS). This protocol illustrates procedures to form embryoid bodies (EBs) from ESCs for CPC specification and enrichment. The isolated CPCs can be subsequently cultured for cardiac lineage differentiation and other biological assays. This protocol is optimized for robust and efficient derivation of CPCs from both mouse and human ESCs.

In this protocol, derivation of cardiac progenitor cells from both mouse and human embryonic stem cells will be illustrated. A major strategy in this protocol is to enrich cardiac progenitor cells with flow cytometry using fluorescent reporters engineered into the embryonic stem cell lines.

Cardiac progenitor cells (CPCs) have the capacity to differentiate into cardiomyocytes, smooth muscle cells (SMC), and endothelial cells and hold great ...

Large-Scale Production of Cardiomyocytes from Human Pluripotent Stem Cells Using a Highly Reproducible Small Molecule-Based Differentiation Protocol

Maximizing the benefit of human pluripotent stem cells (hPSCs) for research, disease modeling, pharmaceutical and clinical applications requires robust methods for the large-scale production of functional cell types, including cardiomyocytes. Here we demonstrate that the temporal manipulation of WNT, TGF-&#946;, and SHH signaling pathways leads to highly efficient cardiomyocyte differentiation of single-cell passaged hPSC lines in both static suspension and stirred suspension bioreactor systems. Employing this strategy resulted in ~ 100% beating spheroids, consistently containing &#62; 80% cardiac troponin T-positive cells after 15 days of culture, validated in multiple hPSC lines. We also report on a variation of this protocol for use with cell lines not currently adapted to single-cell passaging, the success of which has been verified in 42 hPSC lines. Cardiomyocytes generated using these protocols express lineage-specific markers and show expected electrophysiological functionalities. Our protocol presents a simple, efficient and robust platform for the large-scale production of human cardiomyocytes.

Here, we present a robust, fast and scalable cardiomyocyte differentiation protocol for human pluripotent stem cells (hPSCs). Cardiomyocytes derived using this large-scale method can provide sufficient cell numbers for their effective use in human cardiovascular disease modeling, high-throughput drug screening, and potentially clinical applications.

Maximizing the benefit of human pluripotent stem cells (hPSCs) for research, disease modeling, pharmaceutical and clinical applications requires robust ...

Aggregate Size Optimization in Microwells for Suspension-based Cardiac Differentiation of Human Pluripotent Stem Cells

Cardiac differentiation of human pluripotent stems cells (hPSCs) is typically carried out in suspension cell aggregates. Conventional aggregate formation of hPSCs involves dissociating cell colonies into smaller clumps, with size control of the clumps crudely controlled by pipetting the cell suspension until the desired clump size is achieved. One of the main challenges of conventional aggregate-based cardiac differentiation of hPSCs is that culture heterogeneity and spatial disorganization lead to variable and inefficient cardiomyocyte yield. We and others have previously reported that human embryonic stem cell (hESC) aggregate size can be modulated to optimize cardiac induction efficiency. We have addressed this challenge by employing a scalable, microwell-based approach to control physical parameters of aggregate formation, specifically aggregate size and shape. The method we describe here consists of forced aggregation of defined hPSC numbers in microwells, and the subsequent culture of these aggregates in conditions that direct cardiac induction. This protocol can be readily scaled depending on the size and number of wells used. Using this method, we can consistently achieve culture outputs with cardiomyocyte frequencies greater than 70%.

Conventional methods to initiate suspension aggregate based cardiac differentiation of human pluripotent stems cells (hPSCs) are plagued with culture heterogeneity with respect to aggregate size and shape. Here, we describe a robust method for cardiac differentiation employing microwells to generate size-controlled hPSC aggregates cultured under cardiac-promoting conditions.

Cardiac differentiation of human pluripotent stems cells (hPSCs) is typically carried out in suspension cell aggregates.  Conventional aggregate formation ...

Assessing Cardiomyocyte Subtypes Following Transcription Factor-mediated Reprogramming of Mouse Embryonic Fibroblasts

Direct reprogramming of one cell type into another has recently emerged as a powerful paradigm for regenerative medicine, disease modeling, and lineage specification. In particular, the conversion of fibroblasts into induced cardiomyocyte-like myocytes (iCLMs) by Gata4, Hand2, Mef2c, and Tbx5 (GHMT) represents an important avenue for generating de novo cardiac myocytes in vitro and in vivo. Recent evidence suggests that GHMT generates a greater diversity of cardiac subtypes than previously appreciated, thus underscoring the need for a systematic approach to conducting additional studies. Before direct reprogramming can be used as a therapeutic strategy, however, the mechanistic underpinnings of lineage conversion must be understood in detail to generate specific cardiac subtypes. Here we present a detailed protocol for generating iCLMs by GHMT-mediated reprogramming of mouse embryonic fibroblasts (MEFs). 
We outline methods for MEF isolation, retroviral production, and MEF infection to accomplish efficient reprogramming. To determine the subtype identity of reprogrammed cells, we detail a step-by-step approach for performing immunocytochemistry on iCLMs using a defined set of compatible antibodies. Methods for confocal microscopy, identification, and quantification of iCLMs and individual atrial (iAM), ventricular (iVM), and pacemaker (iPM) subtypes are also presented. Finally, we discuss representative results of prototypical direct reprogramming experiments and highlight important technical aspects of our protocol to ensure efficient lineage conversion. Taken together, our optimized protocol should provide a stepwise approach for investigators to conduct meaningful cardiac reprogramming experiments that require identification of individual CM subtypes.

This manuscript describes a step-by-step protocol for the generation and quantification of diverse reprogrammed cardiac subtypes using a retrovirus-mediated delivery of Gata4, Hand2, Mef2c, and Tbx5.

Direct reprogramming of one cell type into another has recently emerged as a powerful paradigm for regenerative medicine, disease modeling, and lineage ...

Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes (hPSC-CMs) Using Multi-electrode Arrays (MEAs)

Cardiomyocytes can now be derived with high efficiency from both human embryonic and human induced-Pluripotent Stem Cells (hPSC). hPSC-derived cardiomyocytes (hPSC-CMs) are increasingly recognized as having great value for modeling cardiovascular diseases in humans, especially arrhythmia syndromes. They have also demonstrated relevance as in vitro systems for predicting drug responses, which makes them potentially useful for drug-screening and discovery, safety pharmacology and perhaps eventually for personalized medicine. This would be facilitated by deriving hPSC-CMs from patients or susceptible individuals as hiPSCs. For all applications, however, precise measurement and analysis of hPSC-CM electrical properties are essential for identifying changes due to cardiac ion channel mutations and/or drugs that target ion channels and can cause sudden cardiac death. Compared with manual patch-clamp, multi-electrode array (MEA) devices offer the advantage of allowing medium- to high-throughput recordings. This protocol describes how to dissociate 2D cell cultures of hPSC-CMs to small aggregates and single cells and plate them on MEAs to record their spontaneous electrical activity as field potential. Methods for analyzing the recorded data to extract specific parameters, such as the QT and the RR intervals, are also described here. Changes in these parameters would be expected in hPSC-CMs carrying mutations responsible for cardiac arrhythmias and following addition of specific drugs, allowing detection of those that carry a cardiotoxic risk.

Electrophysiological Analysis of human Pluripotent Stem Cell-derived Cardiomyocytes hPSC-CMs Using Multi-electrode Arrays MEAs

Electrophysiological characterization of cardiomyocytes derived from human Pluripotent Stem Cells (hPSC-CMs) is crucial for cardiac disease modeling and for determining drug responses. This protocol provides the necessary information to dissociate and plate hPSC-CMs on multi-electrode arrays, measure their field potential, and a method for analyzing QT and RR intervals.

Cardiomyocytes can now be derived with high efficiency from both human embryonic and human induced-Pluripotent Stem Cells (hPSC). hPSC-derived ...

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading cause of mortality worldwide. Mesenchymal stem cells (MSCs) are a promising option for cell-based therapies to replace current, invasive techniques. MSCs can differentiate into mesenchymal lineages, including cardiac cell types, but complete differentiation into functional cells has not yet been achieved. Previous methods of differentiation were based on pharmacological agents or growth factors. However, more physiologically relevant strategies can also enable MSCs to undergo cardiomyogenic transformation. Here, we present a differentiation method using MSC aggregates on cardiomyocyte feeder layers to produce cardiomyocyte-like contracting cells.
Human umbilical cord perivascular cells (HUCPVCs) have been shown to have a greater differentiation potential than commonly investigated MSC types, such as bone marrow MSCs (BMSCs). As an ontogenetically younger source, we investigated the cardiomyogenic potential of first-trimester (FTM) HUCPVCs compared to older sources. FTM HUCPVCs are a novel, rich source of MSCs that retain their in utero immunoprivileged properties when cultured in vitro. Using this differentiation protocol, FTM and term HUCPVCs achieved significantly increased cardiomyogenic differentiation compared to BMSCs, as indicated by the increased expression of cardiomyocyte markers (i.e., myocyte enhancer factor 2C, cardiac troponin T, heavy chain cardiac myosin, signal regulatory protein &#945;, and connexin 43). They also maintained significantly lower immunogenicity, as demonstrated by their lower HLA-A expression and higher HLA-G expression. Applying aggregate-based differentiation, FTM HUCPVCs showed increased aggregate formation potential and generated contracting cells clusters within 1 week of co-culture on cardiac feeder layers, becoming the first MSC type to do so. 
Our results demonstrate that this differentiation strategy can effectively harness the cardiomyogenic potential of young MSCs, such as FTM HUCPVCs, and suggests that in vitro pre-differentiation could be a potential strategy to increase their regenerative efficacy in vivo.

In Vitro Differentiation of Human Mesenchymal Stem Cells into Functional Cardiomyocyte-like Cells

Here, we present a method to efficiently harness the cardiac differentiation potential of young sources of human mesenchymal stem cells in order to generate functional, contracting, cardiomyocyte-like cells in vitro.

Myocardial infarction and the subsequent ischemic cascade result in the extensive loss of cardiomyocytes, leading to congestive heart failure, the leading ...

In Vitro Generation of Heart Field-specific Cardiac Progenitor Cells

Pluripotent stem cells offer great potential for understanding heart development and disease and for regenerative medicine. While recent advances in developmental cardiology have led to generating cardiac cells from pluripotent stem cells, it is unclear if the two cardiac fields - the first and second heart fields (FHF and SHF) &#8212; are induced in pluripotent stem cells systems. To address this, we generated a protocol for in vitro specification and isolation of heart field-specific cardiac progenitor cells. We used embryonic stem cells lines carrying Hcn4-GFP and Tbx1-Cre; Rosa-RFP reporters of the FHF and the SHF, respectively, and live cell immunostaining of the cell membrane protein Cxcr4, a SHF marker. With this approach, we generated progenitor cells which recapitulate the functional properties and transcriptome of their in vivo counterparts. Our protocol can be utilized to study early specification and segregation of the two heart fields and to generate chamber-specific cardiac cells for heart disease modelling. Since this is an in vitro organoid system, it may not provide precise anatomical information. However, this system overcomes the poor accessibility of gastrulation-stage embryos and can be upscaled for high-throughput screens.

The purpose of this method is to generate heart field-specific cardiac progenitor cells in vitro in order to study the progenitor cell specification and functional properties, and to generate chamber specific cardiac cells for heart disease modelling.

Pluripotent stem cells offer great potential for understanding heart development and disease and for regenerative medicine. While recent advances in ...

Generation and Expansion of Human Cardiomyocytes from Patient Peripheral Blood Mononuclear Cells

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. Cardiac differentiation from human induced pluripotent stem cells (iPSCs) is modulated by defined signaling pathways that are essential for embryonic heart development. Numerous cardiac differentiation methods on 2-D and 3-D platforms have been developed with various efficiencies and cardiomyocyte yield. This has puzzled investigators outside the field as the variety of these methods can be difficult to follow. Here we present a comprehensive protocol that elaborates robust generation and expansion of patient-specific cardiomyocytes from peripheral blood mononuclear cells (PBMCs). We first describe a high-efficiency iPSC reprogramming protocol from a patient&#39;s blood sample using non-integration Sendai virus vectors. We then detail a small molecule-mediated monolayer differentiation method that can robustly produce beating cardiomyocytes from most human iPSC lines. In addition, a scalable cardiomyocyte expansion protocol is introduced using a small molecule (CHIR99021) that could rapidly expand patient-derived cardiomyocytes for industrial- and clinical-grade applications. At the end, detailed protocols for molecular identification and electrophysiological characterization of these iPSC-CMs are depicted. We expect this protocol to be pragmatic for beginners with limited knowledge on cardiovascular development and stem cell biology.

Here, we present a protocol to robustly generate and expand human cardiomyocytes from patient peripheral blood mononuclear cells.

Generating patient-specific cardiomyocytes from a single blood draw has attracted tremendous interest in precision medicine on cardiovascular disease. ...

Efficient Derivation of Human Cardiac Precursors and Cardiomyocytes from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based transplantation or by cardiac tissue engineering1-3. Cardiomyocytes become terminally-differentiated soon after birth and lose their ability to proliferate. There is no evidence that stem/progenitor cells derived from other sources, such as the bone marrow or the cord blood, are able to give rise to the contractile heart muscle cells following transplantation into the heart1-3. The need to regenerate or repair the damaged heart muscle has not been met by adult stem cell therapy, either endogenous or via cell delivery1-3. The genetically stable human embryonic stem cells (hESCs) have unlimited expansion ability and unrestricted plasticity, proffering a pluripotent reservoir for in vitro derivation of large supplies of human somatic cells that are restricted to the lineage in need of repair and regeneration4,5. Due to the prevalence of cardiovascular disease worldwide and acute shortage of donor organs, there is intense interest in developing hESC-based therapies as an alternative approach. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity6-8 (see a schematic in Fig. 1A). In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic9-11. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules12 (see a schematic in Fig. 1B). After screening a variety of small molecules and growth factors, we found that such defined conditions rendered nicotinamide (NAM) sufficient to induce the specification of cardiomesoderm direct from pluripotent hESCs that further progressed to cardioblasts that generated human beating cardiomyocytes with high efficiency (Fig. 2). We defined conditions for induction of cardioblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human cardiac cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of cardioblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human cardiac progenitors and functional cardiomyocytes for cardiovascular repair.

To date, the lack of a suitable human cardiac cell source has been the major setback in regenerating the human myocardium, either by cell-based ...

Biology

Generation of Human Cardiomyocytes: A Differentiation Protocol from Feeder-free Human Induced Pluripotent Stem Cells

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is essential first to generate functional human cardiomyocytes (CMs). The use of these cells in drug discovery and toxicology studies would also be highly beneficial, allowing new pharmacological molecules for the treatment of cardiac disorders to be validated pre-clinically on cells of human origin. Of the possible sources of CMs, induced pluripotent stem (iPS) cells are among the most promising, as they can be derived directly from readily accessible patient tissue and possess an intrinsic capacity to give rise to all cell types of the body 1. Several methods have been proposed for differentiating iPS cells into CMs, ranging from the classical embryoid bodies (EBs) aggregation approach to chemically defined protocols 2,3. In this article we propose an EBs-based protocol and show how this method can be employed to efficiently generate functional CM-like cells from feeder-free iPS cells.

Pluripotent stem cells, either embryonic or induced pluripotent stem (iPS) cells, constitute a valuable source of human differentiated cells, including cardiomyocytes. Here, we will focus on cardiac induction of iPS cells, showing how to use them to obtain functional human cardiomyocytes through an embryoid bodies-based protocol.

In order to investigate the events driving heart development and to determine the molecular mechanisms leading to myocardial diseases in humans, it is ...

Differentiation of Atrial Cardiomyocytes from Pluripotent Stem Cells Using the BMP Antagonist Grem2

Samenvatting

Meer video's verkennen