This work was supported in part by the Lupus Research Institute, NCI grant CA138617, NIDDK grant DK090978, Charlotte Schmidlapp Award (to E.M.J.), and the Albert J. Ryan Fellowship (to J.K.). We are grateful for the support and instrumentation provided by the Research Flow Cytometry Core in the Division of Rheumatology at Cincinnati Children&#8217;s Hospital Medical Center, supported in part by NIH AR-47363, NIH DK78392 and NIH DK90971.

Animal work was performed under specific pathogen-free conditions in accordance with guidelines set by the Association for Assessment and Accreditation of Laboratory Animal Care International and our Institutional Animal Care and Use Committee (IACUC).
NOTE: Incorporate mice expressing a congenic marker such as CD45.1 on either donor or recipient animals if possible, because this allows for the monitoring of donor graft efficiency and specific expansion of the donor CD4 T cell population. If considering the use of otherwise genetically modified mice as donor or recipients, ensure the strain is properly backcrossed to the B6 background, or transferred cells may be rejected&#8212;this will be addressed in greater detail in the representative results and discussion sections.
NOTE: The following procedures detail volumes for harvesting 4 donor bm12 mice, which should yield enough cells to inject 12-16 mice. Six to twelve week-old bm12 mice yield roughly 100-140 million lymphocytes with approximately 25% CD4 T cells. If starting with different numbers of mice, or different mouse strains, scale volumes up or down accordingly. C57BL/6 mice generally give similar yields with closer to only 20% CD4 T cells.
NOTE: Perform all steps at RT and use RT media to avoid heat and cold shock, which can impair long-term lymphocyte viability. Perform tissue-harvesting and tissue-processing steps in a tissue culture hood using aseptic technique. All media in this protocol is IMDM with 10% heat-inactivated FBS, unless indicated otherwise, and will be simply referred to as &#8220;complete media.&#8221;
1. Novel Method for Genotyping bm12 Mice
NOTE: A brief restriction digest-based protocol for genotyping is provided here, as a simple and inexpensive alternative to sequencing, which is currently the only published genotyping method for these mice.
<ol>
	<li>Isolate genomic DNA from mouse tails. Please refer to a previous JoVE article for detailed protocols on mouse tail clipping and the generation of cDNA from tail digests13.</li>
	<li>Perform a reverse-transcriptase polymerized chain reaction (PCR)14 to amplify a common 474 bp DNA fragment from MHC-II I-Ab and I-Abm12 using primers and thermocycling conditions listed in Table 1.</li>
	<li>Perform restriction digest on ~7 &#181;l of the PCR product using the enzyme PsuI, or one of its isoschizomers (BstX2I, BstYI, MflI, or XhoII), which cuts wild type I-Ab, but not I-Abm12 mutant. Follow digest protocol provided by the manufacturer, which will specify a mixture of water, buffer and enzyme, and an incubation of 5 min. to several hours at 37 &#176;C15.</li>
	<li>Load digest product and run on 1% polyacrylamide gel with ethidium bromide14 for 30-45 min. at 150V&#8212;though optimal voltage and time settings will vary depending on the PCR gel apparatus used. Visualize DNA bands with a UV illuminator. Representative results are shown in Figure 1.</li>
</ol>
<img alt="Figure 1" src="/files/ftp_upload/53319/53319fig1.jpg" /> 
Figure 1. Representative bm12 genotyping results. 
To identify mice homozygous for I-Abm12/bm12, tail DNA was screened for bm12 by PCR/restriction digest genotyping (Step 1). Homozygous wild type (I-Ab/b) DNA yields two bands at 227 and 247 bp (visualized as one thick band at ~250 bp); homozygous bm12 (I-Abm12/bm12) DNA yields one band at 474 bp; and heterozygous (I-Abm12/b) DNA yields two bands at ~250 and 474 bp. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
2. Harvesting Donor Cells
<ol>
	<li>Sacrifice donor mice using Institutional Animal Care and Use Committee (IACUC)-approved primary and secondary euthanasia methods. For example, euthanize mice by asphyxiation with CO2 followed by cervical dislocation.</li>
	<li>Using aseptic technique, harvest spleens and lymph nodes (superficial cervical, mandibular, brachial, axillary, mesenteric, and inguinal) into 15 ml tubes containing 10 ml complete media as in11-13. 
	NOTE: Refer to previous reports for detailed lymph node dissection protocols16&#8211;18. This model is also successful using only mouse splenocytes for transfer, but the addition of lymph nodes significantly reduces the required number of donor mice.</li>
	<li>Generate a single-cell suspension by mashing lymphoid tissues collected in step 2.2 through 70 &#181;m cell strainers using the plunger from a syringe. For better yields, do not overload strainers&#8212;use ~6 strainers for every 4 mice processed, and rinse strainers frequently while processing. Combine tissues from 4 mice into two 50 ml conical tubes, then centrifuge cells for 5 min at 400 x g and decant supernatant.</li>
	<li>Resuspend cells from both conical tubes in 50 ml complete media and transfer to new conical tube. Keep this tube at RT. 
	NOTE: Fat adheres to the sides of the tube, and if the tube is not replaced, final cellular yields can suffer.</li>
</ol>
3. Donor Cell Counting
NOTE: To preserve the highest viability, red blood cell (RBC) lysis of the entire sample is not recommended.
<ol>
	<li>Mix single cell suspension from step 2.4 well, remove 1 ml and transfer it to a separate 50 ml conical. Set aside remaining, untouched cells (49 ml) at RT while counting.</li>
	<li>Add 3 ml of an ammonium chloride-based red blood cell lysis buffer to the 1 ml donor cell sample. Mix gently for 1 min. by rocking, then fill to 50 ml with complete media, and centrifuge for 5 min. at 400 x g and decant supernatant.</li>
	<li>Resuspend RBC-lysed cells in 10 ml complete media and count (e.g., with trypan blue using a hemocytometer). Multiply result by 49&#8212;this is the total number of cells remaining in the non-lysed sample that was set aside. Discard RBC-lysed cells.</li>
</ol>
4. Donor Cell Labeling and/or CD4 T Cell Purification
<ol>
	<li>If desired, purify CD4 T cells at this stage, though this is not necessary. Additionally, if desired, label cells with CFSE, as in19, or other cell tracking dyes, an example of which is shown in Figure 4 of the representative results section. 
	NOTE: For CD4 T cell purification, negative magnetic selection is recommended, as it can achieve high purity and leaves cells untouched with high viability as described in20. It is important that endotoxin-free buffers are used; therefore, instead of BSA, make separation buffer with 2% FBS and the recommended concentration of EDTA.</li>
</ol>
5. Injection of Donor bm12 Cells
<ol>
	<li>After counting donor lymphocytes in step 3 (and purified or labeled as in step 4, as desired), centrifuge cells for 5 min&#160;at 400 x g. Decant supernatant and resuspend cells in PBS at 120 million lymphocytes per ml (or 30 million purified CD4 T cells per ml). Transfer cells to a sterile 5 ml round-bottom tube, or other sterile tube that easily accommodates a 1 ml syringe fitted with a 27.5 G x 13 mm needle.</li>
	<li>Prior to injection, set aside a small sample of donor cells from step 5.1 at 4 &#176;C for flow staining to determine the percentage of CD4 T cells within donor samples. Stain these samples as described in Step 8 using the minimal antibody panel (Table 2). 
	NOTE: If cells from different mouse strains are used as separate donors, this is an important consideration, and if CD4 T cell percentages vary substantially, purification may be required.</li>
	<li>Mix cells gently, but thoroughly. This can be done by pipetting cells up and down using a 1 ml syringe without an attached needle. After mixing, draw cells into the 1 ml syringe. Attach needle after removing any air bubbles. Keeping the needle off while priming the syringe helps maintain cell viability.</li>
	<li>Inject 250 &#181;l per mouse (which is equal to 30 million lymphocytes, or 7.5 million purified CD4 T cells per mouse) intraperitoneally, as described in21. 
	NOTE: In experiments shown here and in our prior work11, each mouse is injected with 30 million total lymphocytes from bm12 donors, rather than the 100 million total splenocytes traditionally used. In unpublished data from our lab, no difference was observed in serum anti-dsDNA at day 14 following injections of 30 or 100 million lymphocytes per mouse. While this significantly reduces the number of mice needed for experiments, the development of nephritis with this number of cells has not been assessed.</li>
</ol>
6. Determine Grafting Efficiency
NOTE 1: This section will describe how to determine the degree of donor cell grafting in the recipient at day 3 in order to identify any mice which may have received suboptimal injections (e.g.,&#160;the graft in one mouse is &#60;10% of that seen in all other mice from the same group). These data can also help determine whether cells from a genetically modified mouse strain are rejected at later time points (for details, see representative results section, Figure 6).
NOTE 2: This section is only possible if donors and recipients are from mice on different congenic backgrounds, e.g., when using CD45.1 bm12 donors and CD45.2 C57BL/6 recipients, or when donor cells are labeled with a cell tracking dye. Importantly, at 3 days post-injection, CD4 T cells have undergone minimal expansion (see representative results section, Figure 4), so differences observed in the degree of grafting are due to variability in injections, not expansion.
<ol>
	<li>Anesthetize mice with 4% isoflurane or other IACUC-approved method. Test rear foot reflexes to ensure mouse is properly anesthetized before proceeding to the blood draw.</li>
	<li>Harvest 100-200 &#181;l blood using an IACUC-approved method, such as retro-orbital puncture as in22. Collect blood into individual 0.5 ml microcentrifuge tubes containing an anti-coagulant, such as the plasma collection tubes referenced in the materials table, which contain lyophilized dipotassium EDTA. After blood collection, apply gentle pressure to the mouse eye using a sterile towel or gauze to ensure the bleeding stops, then place the mouse back in its home cage where it will remain until the final tissue harvest (Step 7). 
	NOTE: Do not leave mice unattended until mice have regained sufficient consciousness to maintain ventral recumbency, and do not return mice to the company of others until fully recovered.</li>
	<li>Bring blood volume to 500 &#181;l with 21 &#176;C PBS and transfer to conical-bottom microcentrifuge tube, then slowly underlay 200 &#181;l of 21 &#176;C high density cell separation solution with a 200 &#181;l pipet, being careful to minimize mixing between the two phases (see Materials Table for recommended solutions). Centrifuge cells at 700 x g for 20 min at 20-25 &#176;C with centrifuge brake set to low.</li>
	<li>Remove top layer containing lymphocytes with a 1 ml pipet and transfer to a new microcentrifuge tube containing 800 &#181;l cold complete media. Gently vortex to mix cells. Centrifuge cells at 700 x g for 5 min at 4 &#176;C and decant supernatant.</li>
	<li>Resuspend cells in 200 &#181;l complete media, transfer to a 96-well U-bottom plate, and stain for flow cytometry as described in Step 8 using a minimal antibody panel (Table 2) to determine the relative abundance of the CD4 T cell graft as a percentage of PBMCs.</li>
</ol>
7. Final Tissue Harvest
NOTE: The experiments described in the results section were harvested 14 days after injection of donor cells (or in some cases less time), as they focus on the initial development of Tfh cells and plasma cells; however, since this model is a chronic GVHD model of SLE, disease can be monitored at much later time points. The optimal timeframe will depend upon the research question posed in each individual experiment.
<ol>
	<li>At a predetermined time point after injection of bm12 donor cells (step 5.4), sacrifice mice using an IACUC-approved method of euthanasia. Asphyxiation with CO2 followed by exsanguination is recommended. Cervical dislocation can function as a secondary method of euthanasia, but this may reduce the blood draw yield.</li>
	<li>Wet the abdomen of the mouse lightly with a spray bottle containing 70% ethanol. Make a small, superficial incision with surgical scissors approximately 1 cm above the genitalia. Draw back the skin of the abdomen toward the sternum, being careful to keep the peritoneal fascia intact. 
	NOTE: Diseased mice usually present with 0.5-3 ml ascites at day 14, which, although it has not yet been well characterized, can be measured and analyzed as an additional disease parameter.</li>
	<li>Fit a 5 ml syringe with an 18 G&#160;needle. Insert the needle into the lower right quadrant of the abdomen with the needle directed up toward the animal&#8217;s head and at 15&#176; angle to the plane of the fascia. Position the needle tip near the cecum to help prevent the needle from getting clogged with intestine while aspirating ascites.</li>
	<li>Carefully rotate the mouse on its side, then slowly draw ascites into the syringe. Once ascites has been recovered, remove the syringe and record the aspirate volume, based upon the volumetric markings on the side of the syringe.</li>
	<li>Discharge ascites into a 5 ml round-bottom tube and store on ice for later processing.</li>
	<li>Harvest blood via draw from the inferior vena cava (IVC) essentially as in22. Using dull forceps, gently move intestines to the left side of the mouse, uncovering the IVC. Insert a 27.5 G&#160;needle fitted to a 1 ml syringe into the IVC and slowly draw 400-500 &#181;l of blood.</li>
	<li>To minimize hemolysis, slowly inject blood into a 0.5 ml microcentrifuge serum or plasma collection tube. For later serum analysis of ANAs by ELISA, keep blood on ice.</li>
	<li>Dissect and obtain additional relevant tissues (spleen and, if desired, lymph nodes and kidneys, particularly if collecting at later time points and glomerulonephritis will be scored). Remove spleen by gently placing the intestines back toward the right side of the animal, and pulling on the pancreas, which is the spleen&#8217;s primary connective tissue.</li>
	<li>Remove any pancreas remaining, then weigh spleens on a high precision balance immediately after dissection, as gross splenomegaly is a commonly reported parameter in mouse models of SLE. Place lymphoid tissues into individual 1.5 ml tubes filled with 1ml complete media on ice. Fix kidneys in 10% neutral buffered formalin or snap freeze kidneys for later histology as in23.</li>
	<li>Centrifuge blood within 2 hr of collection for 3 min. at 10,000 x g (4 &#176;C). Remove serum and store at -80 &#176;C for later analysis of ANA by ELISA. Refer to previous reports for detailed ANA ELISA protocols24,25. Store serum in multiple 10-20 &#181;l aliquots to minimize freeze/thaw cycles, and allow a greater number of future assays.</li>
	<li>Centrifuge ascites 400 x g for 5 min. Remove the supernatant with a 1 ml pipet and aliquot into several 0.5 ml tubes. Freeze supernatant at -80 &#176;C for later analyses of anti-nuclear antibodies (ANAs) or other soluble inflammatory mediators.</li>
	<li>Resuspend cellular fraction in approximately 1 ml complete media and transfer 200 &#181;l to a 96-well U-bottom plate for flow staining (as in Step 8).</li>
	<li>Mash each spleen through 70 &#181;m cell strainers into separate tubes and rinse with complete media. Resuspend splenocytes with 1 ml cold RBC lysis buffer for 1 min. and mix gently by rocking. Bring volume to 10 ml with cold complete media and centrifuge for 5 min at 400 x g and decant supernatant.</li>
	<li>Resuspend cell pellet in 5 ml complete media and count using a hemocytometer. Adjust volume such that 200 &#181;l of complete media contains 1-3 million cells. Begin staining for flow cytometry (Step 8) using an extended panel (Table 2) to quantify donor CD4 T cell and recipient B cell differentiation and expansion. 
	NOTE: Depending upon what laser, photomultiplier tube (PMT), and filter set combinations are available, separating the T and B cell analysis panel into multiple panels may be necessary.</li>
</ol>
8. Flow Staining
<ol>
	<li>Transfer 1-3 million splenocytes in 200 &#181;l complete media into individual 5 ml round-bottom tubes, or into separate wells of a 96-well U-bottom plate. 
	NOTE: Using a 96-well plate is an efficient way to stain multiple samples, but take care to plate samples in every other well in order to prevent cross-contamination. One 96-well plate can accordingly hold 24 samples.</li>
	<li>Centrifuge plate at 500 x g for 3 min., then flick supernatant from plate into appropriate (biohazard) container.</li>
	<li>Resuspend the cell pellets with 100 &#181;l of flow buffer (1% FBS in PBS) containing a fixable viability dye at the manufacturer&#8217;s recommended concentration and purified anti-CD16/anti-CD32 antibody cocktail at 1 &#181;g/ml. Incubate for 10 min at 20-25 &#176;C, then add 100 &#181;l cold complete media to quench viability dye. 
	NOTE: Splenocytes from diseased mice usually contain relatively high numbers of dead or dying cells; therefore, the inclusion of a viability dye is recommended to avoid non-specific antibody labeling of dying cells, resulting in cleaner, more reliable data. Similarly, the anti-CD16/anti-CD32 cocktail is included to block non-specific fluorescently-labeled antibody binding by Fc receptors.</li>
	<li>Centrifuge plate at 500 x g for 3 min., then flick supernatant from plate into biohazard container. Resuspend cells in 200 &#181;l flow buffer. Centrifuge plate at 500 x g for 3 min., then flick supernatant from plate into biohazard container.</li>
	<li>Resuspend cells in 50 &#181;l flow buffer containing antibody cocktail (Table 2). Incubate for 20 min at 4 &#176;C, then add 150 &#181;l flow buffer. Repeat wash step 8.4.</li>
	<li>Resuspend cells with 100 &#181;l 2% paraformaldehyde in PBS. Incubate for 30 min at 4 &#176;C, then add 100 &#181;l flow buffer. Centrifuge plate at 500 x g for 3 min., then flick supernatant from plate into biohazard container.</li>
	<li>Resuspend in 200 &#181;l flow buffer, transfer to flow tube inserts or standard flow tubes, add an additional 100-200 &#181;l flow buffer, and store at 4 &#176;C in the dark until acquiring on flow cytometer.</li>
	<li>Acquire on a flow cytometer equipped with the appropriate lasers and PMTs for the chosen antibody panels within several days of staining. Record forward scatter width and/or height in addition to forward scatter area, side scatter area, and area of the fluorescent parameters utilized. For reliable results, acquire &#8805;1,000 donor cells in each WT sample, or an equivalent number of total lymphocytes in genetically modified or otherwise manipulated mice that show minimal expansion of donor cells, where collection of so many events may not be feasible. 
	NOTE: Flow cytometry analyses are described in detail in the representative results section (Figures 3-6).</li>
</ol>

<ol>
	<li>Helmick, C. G., Felson, D. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Part+I.+Arthritis+Rheum.">Part I. Arthritis Rheum.</a> Estimates of the prevalence of arthritis and other rheumatic conditions in the United States. 58, 15-25 (2008).</li><li>Somers, E. C., Marder, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Population-based+incidence+and+prevalence+of+systemic+lupus+erythematosus:+The+Michigan+lupus+epidemiology+and+surveillance+program.">Population-based incidence and prevalence of systemic lupus erythematosus: The Michigan lupus epidemiology and surveillance program.</a> Arthritis and Rheumatol. 66, 369-378 (2014).</li><li>Perry, D., Sang, A., Yin, Y., Zheng, Y. -. Y., Morel, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Murine+models+of+systemic+lupus+erythematosus.">Murine models of systemic lupus erythematosus.</a> J Biomed Biotechnol. 2011, 271694 (2011).</li><li>Lindholm, L., Rydberg, L., Stranneg&#229;rd, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+of+host+plasma+cells+during+graft-versus-host+reactions+in+mice.">Development of host plasma cells during graft-versus-host reactions in mice.</a> Eur J Immunol. 3 (8), 511-515 (1973).</li><li>Fialkow, P. J., Gilchrist, C., Allison, A. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoimmunity+in+chronic+graft-versus-host+disease.">Autoimmunity in chronic graft-versus-host disease.</a> Clin Exp Immunol. 13, 479-486 (1973).</li><li>Streilein, J. W., Stone, M. J., Duncan, W. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+the+Specificity+of+Autoantibodies+Produced+in+Systemic+Graft-vs-Host+Disease.">Studies on the Specificity of Autoantibodies Produced in Systemic Graft-vs-Host Disease.</a> J Immunol. 114 (1), 255-260 (1975).</li><li>Gleichmann, E., Gleichmann, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Diseases+caused+by+reactions+of+T+lymphocytes+to+in+compatible+structures+of+the+major+histocompatibility+complex.+I.+Autoimmune+hemolytic+anemia.">Diseases caused by reactions of T lymphocytes to in compatible structures of the major histocompatibility complex. I. Autoimmune hemolytic anemia.</a> Eur J Immunol. 6 (12), 899 (1976).</li><li>Morris, S., Cohen, P. L., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Experimental+induction+of+systemic+lupus+erythematosus+by+recognition+of+foreign+Ia.">Experimental induction of systemic lupus erythematosus by recognition of foreign Ia.</a> Clin Immunol Immunopathol. 57 (2), 263-273 (1990).</li><li>Chen, F., Maldonado, M., Madaio, M., Eisenberg, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Role+of+Host+(Endogenous)+T+Cells+in+Chronic+Graft-Versus-Host+Autoimmune+Disease.">The Role of Host (Endogenous) T Cells in Chronic Graft-Versus-Host Autoimmune Disease.</a> J Immunol. 161 (11), 5880-5885 (1998).</li><li>Klarquist, J., Hennies, C. M., Lehn, M. A., Reboulet, R. A., Feau, S., Janssen, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=STING-Mediated+DNA+Sensing+Promotes+Antitumor+and+Autoimmune+Responses+to+Dying+Cells.">STING-Mediated DNA Sensing Promotes Antitumor and Autoimmune Responses to Dying Cells.</a> J Immunol. 193, 6124-6134 (2014).</li><li>Petri, M., Orbai, A. -. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+and+validation+of+systemic+lupus+international+collaborating+clinics+classification+criteria+for+systemic+lupus+erythematosus.">Derivation and validation of systemic lupus international collaborating clinics classification criteria for systemic lupus erythematosus.</a> Arthritis Rheum. 64 (8), 2677-2686 (2012).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Lorenz, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymerase+Chain+Reaction:+Basic+Protocol+Plus+Troubleshooting+and+Optimization+Strategies.">Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies.</a> J Vis Exp. (63), e3998 (2012).</li><li>. Product information: Thermo Scientific FastDigest PsuI Available from: <a target="_blank" href="https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf">https://tools.lifetechnologies.com/content/sfs/manuals/MAN0012567_FastDigest_PsuI_UG.pdf</a> (2012)</li><li>Matheu, M. P., Parker, I., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+and+2-photon+imaging+of+peripheral+lymph+nodes+in+mice.">Dissection and 2-photon imaging of peripheral lymph nodes in mice.</a> J Vis Exp. (7), e265 (2007).</li><li>Harrell, M. I., Iritani, B. M., Ruddell, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lymph+node+mapping+in+the+mouse.">Lymph node mapping in the mouse.</a> J Immunol Methods. 332 (1-2), 170-174 (2008).</li><li>Covelli, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chapter+3,+Internal+examination.">Chapter 3, Internal examination.</a> Guide to the necroscopy of the mouse. , (2009).</li><li>Quah, B. J. C., Parish, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+use+of+carboxyfluorescein+diacetate+succinimidyl+ester+(CFSE)+to+monitor+lymphocyte+proliferation.">The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation.</a> J Vis Exp. (44), e2259 (2010).</li><li>Matheu, M. P., Cahalan, M. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+CD4++T+cells+from+mouse+lymph+nodes+using+Miltenyi+MACS+purification.">Isolation of CD4+ T cells from mouse lymph nodes using Miltenyi MACS purification.</a> J Vis Exp. (9), e53319 (2007).</li><li>Machholz, E., Mulder, G., Ruiz, C., Corning, B. F., Pritchett-Corning, K. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manual+Restraint+and+Common+Compound+Administration+Routes+in+Mice+and+Rats.">Manual Restraint and Common Compound Administration Routes in Mice and Rats.</a> J Vis Exp. (67), e2771 (2012).</li><li>Hoff, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+of+Blood+Collection+in+the+Mouse.">Methods of Blood Collection in the Mouse.</a> Lab Animal. 29 (10), 47-53 (2000).</li><li>Cohen, M., Varki, N. M., Jankowski, M. D., Gagneux, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Using+Unfixed,+Frozen+Tissues+to+Study+Natural+Mucin+Distribution.">Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution.</a> J Vis Exp. (67), e3928 (2012).</li><li>Cohen, P. L., Maldonado, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+for+SLE.">Animal models for SLE.</a> Curr Protoc Immunol.. Chapter 15, Unit 15.20 (2003).</li><li>Seavey, M. M., Lu, L. D., Stump, K. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+systemic+lupus+erythematosus+(SLE)+and+ex+vivo+assay+design+for+drug+discovery.">Animal models of systemic lupus erythematosus (SLE) and ex vivo assay design for drug discovery.</a> Curr Protoc Pharmacol. Chapter 5, Unit 5 (2011).</li><li>McKenna, K. C., Vicetti Miguel, R. D., Beatty, K. M., Bilonick, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+caveat+for+T+cell+transfer+studies:+generation+of+cytotoxic+anti-Thy1.2+antibodies+in+Thy1.1+congenic+mice+given+Thy1.2++tumors+or+T+cells.">A caveat for T cell transfer studies: generation of cytotoxic anti-Thy1.2 antibodies in Thy1.1 congenic mice given Thy1.2+ tumors or T cells.</a> J Leukoc Biol. 89 (2), 291-300 (2011).</li><li>Scott, D. M., Ehrmann, I. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+a+mouse+male-specific+transplantation+antigen+H-Y..">Identification of a mouse male-specific transplantation antigen H-Y..</a> Nature. 376, 695-698 (1995).</li><li>Joly, E., Hudrisier, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=What+is+trogocytosis+and+what+is+its+purpose.">What is trogocytosis and what is its purpose.</a> Nat Immunol. 4 (9), 815 (2003).</li><li>Brown, D. R., Calpe, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+an+NK+cell-independent+role+for+Slamf4+in+controlling+humoral+autoimmunity.">Cutting edge: an NK cell-independent role for Slamf4 in controlling humoral autoimmunity.</a> J Immunol. 187 (1), 21-25 (2011).</li><li>Morris, S. C., Cheek, R. L., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allotype-specific+immunoregulation+of+autoantibody+production+by+host+B+cells+in+chronic+graft-versus+host+disease.">Allotype-specific immunoregulation of autoantibody production by host B cells in chronic graft-versus host disease.</a> J Immunol. 144 (3), 916-922 (1990).</li><li>Choudhury, A., Cohen, P. L., Eisenberg, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=B+cells+require+&#8220;nurturing&#8221;+by+CD4+T+cells+during+development+in+order+to+respond+in+chronic+graft-versus-host+model+of+systemic+lupus+erythematosus.">B cells require &#8220;nurturing&#8221; by CD4 T cells during development in order to respond in chronic graft-versus-host model of systemic lupus erythematosus.</a> Clin Immunol. 136 (1), 105-115 (2010).</li><li>Slifka, M. K., Antia, R., Whitmire, J. K., Ahmed, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humoral+immunity+due+to+long-lived+plasma+cells.">Humoral immunity due to long-lived plasma cells.</a> Immunity. 8 (3), 363-372 (1998).</li></ol>

The authors have nothing to disclose.

The bm12 inducible model is a relatively easy and efficient way to study the cellular and molecular processes of SLE. Chronic activation of adoptively transferred CD4 T cells directed against self antigens leads to the accumulation of Tfh, GC B cells, and plasma cells which can be measured by flow cytometry, as described here. Future studies using this model can quickly and easily interrogate the role of candidate genes and novel therapies in the autoimmune germinal center processes which resemble those occurring in patients with SLE, and ultimately govern the pathological accumulation of autoantibodies. Furthermore, the flow cytometric analysis described here can be used to study additional mouse models that involve the development of immunoglobulins including, but not limited to autoimmunity, infection, and allergy.
Like all animal models of human disease, this model also has its limitations. Given the speed with which disease develops and its magnitude, not all genes involved in the development of SLE are likely to be necessary for pathogenicity in this model. Additionally, care must be taken to rule out graft rejection when data suggest minimal expansion of Tfh in genetically modified recipients. Congenic markers should be used to confirm the presence of donor cells at harvest especially since recipient cells can also differentiate into Tfh (Figure 3B), which could otherwise mask the absence of donor cells. Using congenic markers, we observed complete elimination of donor cells that evidently harbored rejection antigens by day 14 (Figure 6). We have successfully used CD45.1+ bm12 and CD45.2+ bm12 mice as donors, and CD45.1+ BoyJ (B6.SJL-Ptprca Pepcb/BoyJ) and CD45.2+ C57BL/6 mice as recipients (Figures 3, 6, 7, and unpublished data). However, wild type congenic CD90.1+ cells from the B6.PL-Thy1a/CyJ mouse strain do not graft well, nor do CD90.2+ bm12 cells graft well in a CD90.1+ recipient (unpublished data), a phenomenon that is evidently not unique to this model26.
Either C57BL/6 or bm12 mice can serve as the donor or the recipient, as initially reported by Morris et al.9 However, in our lab we find the transfer of bm12 cells into B6 mice produces more consistent expansion of T cell and B cell populations at day 14. Furthermore, donor and recipient mice from different groups should be gender- and age-matched. Although experiments reported in the first description of the bm12 model found no significant difference in any disease parameter between male&#8594;male and female&#8594;female transfers9, male&#8594;female transfers are not advised, as male antigen (H-Y) expressed by transferred CD4 T cells may induce graft rejection in female recipients27.
When choosing antibodies and fluorochromes for congenic markers, it should be noted that donor cells become positive for the recipient congenic marker to varying degrees, such that a CD45.2&#8722; gate would not constitute the entire CD45.1+ graft. The phenomenon is clearly illustrated in a comparison of CD45.2 expression by CD45.1+ na&#239;ve, CD45.1+ donor, and CD45.2+ recipient CD4 T cells (Figure 7). Notably, donor cells also seem to upregulate expression of their own congenic marker, compared to na&#239;ve controls (Figure 7). Similar results are also seen with CD45.2+ bm12 transfer into CD45.1+ BoyJ mice (data not shown). Presumably, acquisition of recipient CD45 results from trogocytosis28 by activated CD4 T cells following repeated interactions with recipient B cells. In fact, the bm12 model may prove a useful tool in studying the process of trogocytosis in vivo.
<img alt="Figure 7" src="/files/ftp_upload/53319/53319fig7.jpg" /> 
Figure 7. Donor cells acquire recipient CD45 congenic marker. CD45.1+ bm12 lymphocytes were transferred into CD45.2+ C57BL/6 recipients. Donor, recipient, and na&#239;ve (CD45.1+) CD4 T cells are assessed for CD45.1 and CD45.2 expression 14 days after transfer. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
It has been shown that the transfer of purified bm12 CD4 T cells into C57BL/7 mice is sufficient to initiate disease29; however, equivalent disease develops when whole lymphocytes are transferred, and purification is not necessarily required to study disease dependence upon T cell-intrinsic gene expression. Eisenberg and colleagues, clearly demonstrated that the antibody-producing cell in the bm12 model is almost exclusively of recipient origin30. Furthermore, the requirement for recipient CD4 T cells10 is limited to the &#8216;nurturing&#8217; of B cells during their development, which can be off-set by the addition of exogenous IL-431, although our data indicate that recipient T cells may participate somewhat in the germinal center response, as some of them do develop a Tfh phenotype (Figure 3B, bottom right).
One critical decision that must be made for every bm12 experiment is when to harvest tissues for analyses. Of course the decision depends upon exactly what factors are important to the current study, which may vary. The experiments described here take up to 14 days, as they focus on the initial development of Tfh cells and plasma cells; however, since this model is a chronic GVHD model of SLE, disease can be monitored much longer. In fact, certain clinical features of SLE, including glomerulonephritis, develop later. Proteinuria has been detected as early as 2 weeks post-injection, but reaches peak levels at 4-8 weeks post-injection10,31. Additionally, the flow cytometric analyses described here have been optimized for experiments lasting 2 weeks. We find a considerable number of GC B cells and plasma cells at this time point; although, given additional time, a large percentage of ANA-secreting plasma cells may reside in the bone marrow32. Moreover, the plasma cells identified by this flow staining panel likely also include plasmablasts&#8212;in order to distinguish between these two cell types, additional antibodies would be required. Tfh expansion presumably reaches a peak at some point after the 14-day window on which we have focused. However, to our knowledge, no studies have reported bm12 donor cell number beyond 2 weeks, or used congenic markers to track adoptively transferred cells.

Systemic lupus erythematosus (SLE) is a complex autoimmune disease characterized prototypically by anti-nuclear antibody (ANA) production and glomerulonephritis. Numerous other sequelae, including dermal, cardio-pulmonary, and hepatic lesions are associated with disease in some individuals. Prevalence estimates in the US vary widely, from 150,000-1,500,0001,2, with particularly high incidence in women and minorities3. Although the etiology of SLE has been difficult to discern, it is thought to arise from the interplay of various genetic and environmental factors, which culminate in systemic autoimmunity.
Numerous animal models have been employed to study factors leading to disease onset and progression. Classic mouse models of SLE include genetically predisposed mouse strains including the NZB x NZW F1 model and its NZM derivatives, the MLR/lpr strain, and the BXSB/Yaa strain, and inducible systems, such as the pristane and chronic graft-versus-host disease (cGVHD) models4. Early reports of autoantibody production in GVHD models used various mouse strains or hamster strains for parent into F1 transfers5&#8211;8; more common methods used to study lupus-like disease currently include the DBA/2 parent&#8594;(C57BL/6 x DBA/2) F1, and the bm12 transfer model described here. Each model has its own caveats, but they generally share a common set of features that correlate with clinical features of human disease. The most often reported parameters in mouse models include splenomegaly, lymphadenopathy, nephritis, ANA production, and at the cellular level, the expansion of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells.
The inducible bm12 model is achieved by the adoptive transfer of lymphocytes from I-Abm12B6(C)-H2-Ab1bm12/KhEgJ (bm12) mice, a strain identical to C57BL/6 except for 3 amino acid substitutions on MHC class II, into I-Ab C57BL/6 (B6) mice. Alloactivation of donor CD4 T cells by recipient APCs leads to cGVHD with symptoms closely resembling SLE. Specifically, these include expansion of donor-derived Tfh, expansion of recipient-derived GC B cells and plasma cells, and production of ANAs including anti-dsDNA, anti-ssDNA, anti-chromatin, and anti-RBC antibodies9. Over time, recipient mice develop glomerulonephritis associated with IgG deposits in the glomerular, interstitial, and vascular regions of the kidneys10. We have recently shown that, similar to human disease, there is also a critical role for type I IFN in this model11. Notably, the defining criteria for human SLE include the development of nephritis compatible with SLE in the presence of anti-dsDNA antibodies12, both of which are prominent features of this mouse model.
There are several advantages of the bm12 model over the spontaneous models. Classic models that develop SLE-like signs spontaneously rely upon either hybrid mouse strains, inbred mouse strains not on the B6 background, or large genetic loci on the B6 background, which make crossing to knockout or otherwise genetically modified mice difficult and time consuming. With the bm12 inducible model, genetically modified mice can serve as either the donor or recipient, allowing more rapid identification of the cellular compartment in which particular genes may be important for disease. Furthermore, disease development in the bm12 model is much faster, requiring only 2 weeks until the appearance of ANAs, compared to several months for most spontaneous models. Moreover, in contrast to the spontaneous models that develop disease at different time points, the disease onset and progression in the bm12&#8594;B6 model is highly synchronized. This allows for the generation of appropriately sized cohorts that can be used for interventional or therapeutic strategies at any stage of disease development.
What follows is a detailed protocol for initiating SLE-like autoimmunity by the adoptive transfer of bm12 lymphocytes into C57BL/6 mice, or genetic variants on the B6 background. Additionally, we describe a flow cytometric staining protocol for enumerating Tfh, GC B cells, and plasma cells&#8212;cell types associated with human disease. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells and plasma cells in other disease models.

<table><tbody><tr><td>B6.SJL-Ptprca Pepcb/BoyJ</td><td>The Jackson Laboratory</td><td>001162</td><td>CD45.1+ BoyJ mouse strain</td></tr><tr><td>B6(C)-H2-Ab1bm12/KhEgJ</td><td>The Jackson Laboratory</td><td>001162</td><td>Bm12 mouse strain</td></tr><tr><td>FastDigest PsuI</td><td>Life Technologies</td><td>FD1554</td><td>Restriction digest enzyme for genotyping</td></tr><tr><td>1X RBC Lysis Buffer</td><td>eBioscience</td><td>00-4333-57</td><td></td></tr><tr><td>IMDM</td><td>GE Healthcare</td><td>SH30228.01</td><td></td></tr><tr><td>Plasma Separation Tube (PST)</td><td>BD</td><td>365974</td><td>Blood collection tube with Dipotassium EDTA</td></tr><tr><td>Serum Separation Tube (SST)</td><td>BD</td><td>365967</td><td>Blood collection tube with Clot activator / SST Gel</td></tr><tr><td>Ficoll</td><td>GE Healthcare</td><td>17-1440-02&amp;nbsp;</td><td>High density cell separation solution</td></tr><tr><td>Lympholyte-M</td><td>Cedarlane</td><td>CL5030</td><td>High density cell separation solution</td></tr><tr><td>GL-7-biotin</td><td>eBioscience</td><td>13-5902-82&amp;nbsp;</td><td></td></tr><tr><td>Streptavidin-BUV395</td><td>BD</td><td>564176</td><td></td></tr><tr><td>CD138-BV421</td><td>BioLegend</td><td>142508</td><td></td></tr><tr><td>CD4-BV510</td><td>BioLegend</td><td>100559</td><td></td></tr><tr><td>TCR&amp;beta;-BV605</td><td>BD</td><td>562840</td><td></td></tr><tr><td>CD45.1-BV711</td><td>BioLegend</td><td>110739</td><td></td></tr><tr><td>CD45.2-FITC</td><td>BioLegend</td><td>109806</td><td></td></tr><tr><td>PD-1-PE</td><td>BioLegend</td><td>135206</td><td></td></tr><tr><td>CD19-PerCP</td><td>BioLegend</td><td>115532</td><td></td></tr><tr><td>Fas-PE-Cy7</td><td>BD</td><td>557653</td><td></td></tr><tr><td>CXCR5-APC</td><td>BioLegend</td><td>145506</td><td></td></tr><tr><td>Fixable Viability Dye ef780</td><td>eBioscience</td><td>65-0865-18</td><td></td></tr><tr><td>CD4-BV421</td><td>BioLegend</td><td>100443</td><td></td></tr><tr><td>1.2 ml FACS tube inserts, racked</td><td>USA Scientific</td><td>1412-1400</td><td></td></tr><tr><td>BD Falcon&amp;trade; Round-Bottom Tubes</td><td>BD</td><td>352017</td><td></td></tr></tbody></table>

the bm12 inducible model of systemic lupus erythematosus (sle) in c57bl/6 mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

Diseased mice develop splenomegaly in as little as 14 days, exhibiting spleens 2-3 times the size of healthy mice in terms of mass and cellularity (Figure 2).
Splenocytes are sequentially gated on light scatter (FSC-A by SSC-A), elimination of doublets (FSC-W or -H by FSC-A), viable cells (low staining of viability dye), and CD4+TCR&#946;+ (Figure 3A). Donor cells are distinguished from recipient cells based on CD45.1 and CD45.2 (Figure 3B, bottom left). Donor cells predominantly adopt a T follicular helper (Tfh) cell phenotype, as characterized by the upregulation of PD-1, CXCR5, Bcl-6, and ICOS (Figure 3B, C). A portion of the recipient CD4 T cell population also differentiates into Tfh (Figure 3B, bottom right). After an initial die-off and/or migration of transferred cells, the expansion of donor-derived Tfh is logarithmic, reaching 10-20 million cells in the spleens of mice 14 days after injection (Figure 3D).
CFSE-labeling of transferred lymphocytes demonstrated that donor CD4 T cells differentiate into Tfh early after activation; essentially all divided cells observed at days 3, 7, and 14 upregulated CXCR5 and PD-1 (Figure 4). The proliferation peak profiles also suggest that a relatively low percentage of donor CD4 T cells underwent alloactivation and division. By day 14, most of the detectable donor cells are those that have divided beyond the maximum number of divisions measurable by CFSE.
The expansion of donor-derived Tfh is accompanied by a corresponding accumulation of endogenous GC B cells and plasma cells (Figure 5A). Plasma cell accumulation in the spleen is delayed compared to that of Tfh, exhibiting no increase over na&#239;ve animals on days 3 or 7 (Figure 5B). Accordingly, anti-nuclear antibodies are not readily detectable prior to day 9 (data not shown), but can be reliably quantified on day 1411.
Through the use of congenic markers, we have observed rejection of donor cells in multiple strains. While this is a common problem when mice are not sufficiently backcrossed to the C57BL/6 background, we also observed rejection when bm12 cells were transferred into B6.PL-Thy1a/CyJ (CD90.1) mice that are generally considered to be fully backcrossed. Therefore, mice are routinely screened at day ~3 by flow staining blood samples to assess the efficiency of the initial CD4 T cell graft; we know from CFSE proliferation experiments that grafted cells have expanded very little at this early time point. These results are then compared to results obtained from the day 14 harvest. In an example case of rejection, 30 million CD45.1+ bm12 lymphocytes were transferred into Cardif-/- mice which had been backcrossed to C57BL/6 mice for 12 generations. At day 5, all mice displayed equivalent grafting (2-3% of circulating CD4 T cells), but by day 14, bm12 donor cells were completely eliminated from the genetically modified recipient (Figure 6).
<img alt="Figure 2" src="/files/ftp_upload/53319/53319fig2.jpg" /> 
Figure 2. Spleen growth kinetics after injection of bm12 lymphocytes. Spleens were weighed on a high precision balance directly after excision (left). Live cell numbers were determined by counting with a hemocytometer using trypan blue to exclude dead cells (right). Results are depicted as mean &#177; SEM, where n = 9, 4, 3, and 6, respectively. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53319/53319fig3.jpg" /> 
Figure 3. Analysis of T follicular helper cell expansion in the bm12 model of SLE. CD45.1+ bm12 lymphocytes were transferred into C57BL/6 recipients and spleens were analyzed 14 days later. (A) Representative gating strategy showing &#8220;lymphocytes&#8221; (first panel), &#8220;single cells&#8221; (second panel), &#8220;live cells&#8221; (third panel), and &#8220;CD4 T cells&#8221; (fourth panel). (B) Donor cells are distinguished from recipient CD4 T cells by CD45.1 and CD45.2 staining and analyzed for expression of PD-1 and CXCR5. (C) Donor cells adopt Tfh phenotype, as indicated by the upregulation of several proteins commonly associated with Tfh. (D) Typical results showing the expansion of donor-derived Tfh (defined as CD4+CD45.1+PD-1+CXCR5+ live cells) at days 3, 7, and 14 post transfer. Results are depicted as mean &#177;SEM, where n = 5, 4, 3, and 6, respectively. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53319/53319fig4.jpg" /> 
Figure 4. PD-1 and CXCR5 are upregulated on dividing cells. Bm12 cells were labeled with CFSE prior to injection into C57BL/6 recipients. Representative flow plots are shown for donor CD4 T cells at 3, 7, and 14 days after injection. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" src="/files/ftp_upload/53319/53319fig5.jpg" /> 
Figure 5. Expansion of splenic plasma cells and GC B cells. (A) Representative flow plots from na&#239;ve mouse spleens, or those from mice 14 days after CD45.1+ bm12 transfer. Plasma cells are defined as CD138+CD19low live cells (top panels). GC B cells are a subset of CD19+ B cells, which express GL-7 and Fas (bottom panels). (B) Quantitave data showing the accumulation of splenic plasma cells over time. Results are depicted as mean &#177; SEM, where n = 5, 4, 3, and 6, respectively. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" src="/files/ftp_upload/53319/53319fig6.jpg" /> 
Figure 6. Bm12 grafts are rejected by some genetically modified recipient mice. CD45.1+ bm12 lymphocytes were transferred into either genetically modified mice (top panels) or C57BL/6 (bottom panels) recipient mice. Mice were bled at 5 days post injection and assessed for graft efficiency. Splenocytes from the same mice were analyzed 14 days later. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53319/53319fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" fo:keep-together.within-page="1" style="top-margin: 20px">
	<tbody>
		<tr>
			<td>Primer Name</td>
			<td colspan="2">Sequence (5&#39; - 3&#39;)</td>
			<td>Annealing Temperature</td>
		</tr>
		<tr>
			<td>Bm12F</td>
			<td colspan="2">CGTGGTCCCCGCTGTCCCCC</td>
			<td rowspan="2">*65 &#176;C</td>
		</tr>
		<tr>
			<td>Bm12R</td>
			<td colspan="2">GGGCAGAGGGCAGAGGTGAG</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Segment</td>
			<td>Number&#160;&#160;&#160;&#160; of cycles</td>
			<td>Temperature</td>
			<td>Duration</td>
		</tr>
		<tr>
			<td>1</td>
			<td>1</td>
			<td>95 &#176;C</td>
			<td>2 min.</td>
		</tr>
		<tr>
			<td rowspan="3">2</td>
			<td rowspan="3">40</td>
			<td>95 &#176;C</td>
			<td>15 sec.</td>
		</tr>
		<tr>
			<td>*65 &#8722; 0.5 &#176;C/step</td>
			<td>15 sec.</td>
		</tr>
		<tr>
			<td>72 &#176;C</td>
			<td>45 sec.</td>
		</tr>
		<tr>
			<td>3</td>
			<td>1</td>
			<td>72 &#176;C</td>
			<td>10 min.</td>
		</tr>
	</tbody>
</table>
Table 1: Primers and thermocycling conditions for bm12 genotyping. Optimal thermocycling conditions will depend upon the exact reagents and instruments used. These conditions have been optimized for a thermocycler capable of changing annealing temperature at every step, though the protocol may also work using a static annealing temperature.
<img alt="Table 2" src="/files/ftp_upload/53319/53319table2.jpg" /> 
Table 2: Antibody panels for splenic Tfh, GC B and plasma cell identification by flow cytometry. Presented are panels we have used successfully for assessing graft efficiency at day 3 (left) and the analysis of T and B cells at day 14 after bm12 cell injection (middle). These have been optimized for an LSRII with 5 lasers (355, 405, 488, 561, and 640 nm). Recommended filter sets for each fluorochrome are listed (right), though these may not be the best option for every machine. Depending upon what laser, PMT, and filter set combinations are available, separating the T and B cell analysis panel into multiple panels may be necessary.

Watch this Scientific Journal Video about The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice at JoVE.com

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

the-bm12-inducible-model-systemic-lupus-erythematosus-sle-c57bl6

Nanyang Technological University

Research

JoVE Journal

Medicine

17.4K Views.  Cincinnati Children's Hospital Medical Center and University of Cincinnati College of Medicine. The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

Video: The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Immunology and Infection

The CYP2D6 Animal Model: How to Induce Autoimmune Hepatitis in Mice

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to generate an animal model that reflects the characteristics of the human disease 3-5. However, in various models the induction of disease was rather complex and often hepatitis was only transient3-5. Therefore, we have developed a straightforward mouse model that uses the major human autoantigen in type 2 autoimmune hepatitis (AIH-2), namely hCYP2D6, as a trigger6. Type 1 liver-kidney microsomal antibodies (LKM-1) antibodies recognizing hCYP2D6 are the hallmark of AIH-27,8. Delivery of hCYP2D6 into wildtype FVB or C57BL/6 mice was by an Adenovirus construct (Ad-2D6) that ensures a direct delivery of the triggering antigen to the liver. Thus, the ensuing local inflammation generates a fertile field9 for the subsequent development of autoimmunity. A combination of intravenous and intraperitoneal injection of Ad-2D6 is the most effective route to induce a long-lasting autoimmune damage to the liver (section 1). Here we provide a detailed protocol on how autoimmune liver disease is induced in the CYP2D6 model and how the different aspects of liver damage can be assessed. First, the serum levels of markers indicating hepatocyte destruction, such as aminotransferases, as well as the titers of hCYP2D6 antibodies are determined by sampling blood retroorbitaly (section 2). Second, the hCYP2D6-specific T cell response is characterized by collecting lymphocytes from the spleen and the liver. In order to obtain pure liver lymphocytes, the livers are perfused by PBS via the portal vein (section 3), digested in collagen and purified over a Percoll gradient (section 4). The frequency of hCYP2D6-specific T cells is analyzed by stimulation with hCYP2D6 peptides and identification of IFN&gamma;-producing cells by flow cytometry (section 5). Third, cellular infiltration and fibrosis is determined by immunohistochemistry of liver sections (section 6). Such analysis regimen has to be conducted at several times after initiation of the disease in order to prove the chronic nature of the model. The magnitude of the immune response characterized by the frequency and activity of hCYP2D6-specific T and/or B cells and the degree of the liver damage and fibrosis have to be assessed for a subsequent evaluation of possible treatments to prevent, delay or abrogate the autodestructive process of the liver.

Infection of mice with an Adenovirus expressing the major human autoantigen cytochrome P450 2D6 (hCYP2D6) recognized by sera of patients suffering from type 2 autoimmune hepatitis results in a persistent form of autoimmune-mediated liver disease characterized by extensive hepatitis, fibrosis and generation of a CYP2D6-specific immune response.

Autoimmune hepatitis is a rare but life threatening autoimmune disease of the liver of unknown etiology1,2. In the past many attempts have been made to ...

Myelin Oligodendrocyte Glycoprotein (MOG35-55) Induced Experimental Autoimmune Encephalomyelitis (EAE) in C57BL/6 Mice

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While the exact etiology of the disease is yet unclear, autoreactive T lymphocytes are thought to play a central role in its pathophysiology. MS therapy is only partially effective so far and research efforts continue to expand our knowledge on the pathophysiology of the disease and to develop novel treatment strategies. Experimental autoimmune encephalomyelitis (EAE) is the most common animal model for MS sharing many clinical and pathophysiological features. There is a broad diversity of EAE models which reflect different clinical, immunological and histological aspects of human MS. Actively-induced EAE in mice is the easiest inducible model with robust and replicable results. It is especially suited for investigating the effects of drugs or of particular genes by using transgenic mice challenged by autoimmune neuroinflammation. Therefore, mice are immunized with CNS homogenates or peptides of myelin proteins. Due to the low immunogenic potential of these peptides, strong adjuvants are used. EAE susceptibility and phenotype depends on the chosen antigen and rodent strain. C57BL/6 mice are the commonly used strain for transgenic mouse construction and respond among others to myelin oligodendrocyte glycoprotein (MOG). The immunogenic epitope MOG35-55 is suspended in complete Freund's adjuvant (CFA) prior to immunization and pertussis toxin is applied on the day of immunization and two days later. Mice develop a "classic" self-limited monophasic EAE with ascending flaccid paralysis within 9-14 days after immunization. Mice are evaluated daily using a clinical scoring system for 25-50 days. Special considerations for care taking of animals with EAE as well as potential applications and limitations of this model are discussed.

Myelin Oligodendrocyte Glycoprotein MOG35-55 Induced Experimental Autoimmune Encephalomyelitis EAE in C57BL/6 Mice

Experimental autoimmune encephalomyelitis (EAE) is an established animal model of multiple sclerosis. C57BL/6 mice are immunized with myelin oligodendrocyte glycoprotein (MOG) peptide 35-55 (MOG35-55), resulting in an ascending flaccid paralysis caused by autoreactive immune cells in the central nervous system. Protocols for disease induction and monitoring will be discussed.

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While ...

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) resulting in cognitive and motor impairment. Experimental autoimmune encephalomyelitis (EAE) is a useful animal model of MS, because it is also characterized by lesion formation in the CNS, motor impairment and is also driven by autoimmune and inflammatory reactions. One of the EAE models is induced with a peptide derived from the myelin oligodendrocyte protein (MOG)35-55 in mice. The EAE mice develop a progressive disease course. This course is divided into three phases: the preclinical phase (day 0 - 9), the disease onset (day 10 - 11) and the acute phase (day 12 - 14). MS and EAE are induced by autoreactive T cells that infiltrate the CNS. These T cells secrete chemokines and cytokines which lead to the recruitment of further immune cells. Therefore, the immune cell distribution in the spinal cord during the three disease phases was investigated. To highlight the time point of the disease at which the activation/proliferation/accumulation of T cells, B cells and monocytes starts, the immune cell distribution in lymph nodes, spleen and blood was also assessed. Furthermore, the levels of several cytokines (IL-1&#946;, IL-6, IL-23, TNF&#945;, IFN&#947;) in the three disease phases were determined, to gain insight into the inflammatory processes of the disease. In conclusion, the data provide an overview of the functional profile of immune cells during EAE pathology.

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

Determining Immune System Suppression versus CNS Protection for Pharmacological Interventions in Autoimmune Demyelination

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in myelin destruction, which not only slows conduction of nerve impulses, but causes axonal injury resulting in motor and cognitive decline. Current treatments for MS focus on attenuating immune cell infiltration into the central nervous system (CNS). These treatments decrease the number of relapses, improving quality of life, but do not completely eliminate relapses so long-term disability is not improved. Therefore, therapeutic agents that protect the CNS are warranted. In both animal models as well as human patients with MS, T cell entry into the CNS is generally considered the initiating inflammatory event. In order to assess if a drug protects the CNS, any potential effects on immune cell infiltration or proliferation in the periphery must be ruled out. This protocol describes how to determine whether CNS protection observed after drug intervention is a consequence of attenuating CNS-infiltrating immune cells or blocking death of CNS cells during inflammatory insults. The ability to examine MS treatments that are protective to the CNS during inflammatory insults is highly critical for the advancement of therapeutic strategies since current treatments reduce, but do not completely eliminate, relapses (i.e., immune cell infiltration), leaving the CNS vulnerable to degeneration.

This protocol describes how to determine whether pharmacological treatments for experimental autoimmune encephalomyelitis show CNS protection as a consequence of suppressing immune cell infiltration or are neuroprotective during the onslaught of immune cell infiltration.

A major hallmark of the autoimmune demyelinating disease multiple sclerosis (MS) is immune cell infiltration into the brain and spinal cord resulting in ...

A Simple Approach to Induce Experimental Autoimmune Neuritis in C57BL/6 Mice for Functional and Neuropathological Assessments

Experimental autoimmune neuritis (EAN) is a well-appreciated experimental model of autoimmune peripheral demyelinating diseases. EAN disease is induced by immunizing mice with neurogenic peptides to direct an inflammatory attack toward components of the peripheral nervous system (PNS). Recent advances have enabled the induction of EAN in the relatively resistant C57BL/6 mouse line using myelin protein zero (P0)106-125 or P0180-199 peptides delivered in adjuvant combined with the injection of pertussis toxin. The ability to induce EAN in the C57BL/6 strain allows for the use of the numerous genetic tools that exist on this mouse background, and thus allows the sophisticated study of disease pathogenesis and interrogation of the mechanistic action of novel therapeutics in combination with transgenic approaches. In this study, we demonstrate a simple approach to successfully induce EAN using the P0180-199 peptide in C57BL/6 mice. We also outline a protocol for the assessment of functional deficits that occur in this model, accompanied by an array of neuropathological features. Thus, this model is a powerful experimental model to study the pathogenesis of human peripheral demyelinating neuropathies, and to determine the efficacy of potential therapies that aim to promote myelin repair and protect against nerve damage in autoimmune neuritis.

This report outlines a simple approach to successfully induce experimental autoimmune neuritis (EAN) using the myelin protein zero (P0)180-199 peptide in combination with Freund&#39;s complete adjuvant and pertussis toxin. We present a sophisticated paradigm capable of accurately assessing the extent of functional deficits and neuropathology that occur in this EAN.

Experimental autoimmune neuritis (EAN) is a well-appreciated experimental model of autoimmune peripheral demyelinating diseases. EAN disease is induced by ...

Neuroscience

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Murine Distal Colostomy, A Novel Model of Diversion Colitis in C57BL/6 Mice

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a diverting enterostomy. The etiology of this disease remains ill-defined but appears to differ from that of classical inflammatory bowel diseases such as Crohn's disease and ulcerative colitis. Research aimed to decipher the pathophysiological mechanisms leading to the development of this disease has been severely hampered by the lack of an appropriate murine model. This protocol generates a murine model of DC that facilitates the study of the immune system's role and its interaction with the microbiome in the development of DC. In this model using C57BL/6 animals, distal parts of the colon are excluded from the fecal stream by creating a distal colostomy, triggering the development of mild to moderate inflammation in the excluded bowel segments and reproducing the hallmark lesions of human DC with a moderate systemic inflammatory response. In contrast to the rat model, a large number of genetically-modified murine models on the C57BL/6 background are available. The combination of these animals with our model allows the potential roles of individual cytokines, chemokines, or receptors of bioactive molecules (e.g., interleukin (IL)-17; IL-10, chemokine CXCL13, chemokine receptors CXCR5 and CCR7, and the sphingosine-1-phosphate receptor 4) to be assessed in the pathogenesis of DC. The availability of congenic mouse strains on the C57BL/6 background largely facilitates transfer experiments to establish the roles of distinct cell types involved in the etiology of DC. Finally, the model offers the opportunity to assess the influences of local interventions (e.g., modification of the local microbiome or local anti-inflammatory therapy) on mucosal immunity in affected and non-affected bowel segments and the on systemic immune homeostasis.

Murine distal colostomy provides a murine model for human diversion colitis, a predominantly lymphocytic colitis in colon segment excluded from the fecal stream.

Diversion colitis (DC) is a frequent clinical condition occurring in patients with bowel segments excluded from the fecal stream as a result of a ...

Analyses of Proteinuria, Renal Infiltration of Leukocytes, and Renal Deposition of Proteins in Lupus-prone MRL/lpr Mice

Systemic lupus erythematosus (SLE) is an autoimmune disorder with no known cure and is characterized by persistent inflammation in many organs, including the kidneys. Under such circumstances, the kidney loses its ability to clean waste from the blood and regulate salt and fluid concentrations, eventually leading to renal failure. Women, particularly those of childbearing age, are diagnosed nine times more often than men. Kidney disease is the leading cause of mortality in SLE patients. The present protocol describes a quick and simple method to measure excreted protein levels in collected urine, tracking lupus progression over time. In addition, an approach to isolate kidney mononuclear cells is provided based on size and density selection to investigate renal infiltration of leukocytes. Furthermore, an immunohistochemical method has been developed to characterize protein deposition in the glomeruli and leukocyte infiltration in the tubulointerstitial space. Together, these methods can help investigate the progression of chronic inflammation associated with the kidneys of lupus-prone MRL/lpr mice.

The present protocol describes a method to track lupus progression in mice. Two additional procedures are presented to characterize lupus nephritis based on cell infiltration and protein deposition in the kidneys.

Systemic lupus erythematosus (SLE) is an autoimmune disorder with no known cure and is characterized by persistent inflammation in many organs, including ...

Induction and Evaluation of Experimental Autoimmune Encephalomyelitis in Mouse

Modeling Multiple Sclerosis in the Two Sexes: MOG35-55-Induced Experimental Autoimmune Encephalomyelitis

Multiple Sclerosis (MS) is a chronic autoimmune inflammatory disease affecting the central nervous system (CNS). It is characterized by different prevalence in the sexes, affecting more women than men, and different outcomes, showing more aggressive forms in men than in women. Furthermore, MS is highly heterogeneous in terms of clinical aspects, radiological, and pathological features. Thus, it is necessary to take advantage of experimental animal models that allow the investigation of as many aspects of the pathology as possible. Experimental autoimmune encephalomyelitis (EAE) represents one of the most used models of MS in mice, modeling different disease features, from the activation of the immune system to CNS damage. Here we describe a protocol for the induction of EAE in both male and female C57BL/6J mice using myelin oligodendrocyte glycoprotein peptide 35-55 (MOG35-55) immunization, which leads to the development of a chronic form of the disease. We also report the evaluation of the daily clinical score and motor performance of these mice for 28 days post immunization (28 dpi). Lastly, we illustrate some basic histological analysis at the CNS level, focusing on the spinal cord as the primary site of disease-induced damage.

Author Spotlight: Creating a Versatile Experimental Autoimmune Encephalomyelitis Model Relevant for Both Male and Female Mice 

Experimental autoimmune encephalomyelitis is one of the most widely used murine models of multiple sclerosis. In the current protocol, C57BL/6J mice of both sexes are immunized with myelin oligodendrocyte glycoprotein peptide, resulting mainly in ascending paresis of the tail and limbs. Here we discuss the protocol of EAE induction and evaluation.

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Samenvatting

Meer video's verkennen