This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Cell Culture and Ad-infection
<ol>
	<li>Propagate Ad5 WT virus in monolayers of HEK-293 cells and titer as fluorescent forming units (FFU) on HFF cells as described previously8.</li>
	<li>Grow Human Foreskin fibroblasts (HFF) in 10 ml of DMEM/10% Fetal Bovine Serum (FBS) in sterile culture 100 mm dishes at 37 &#186;C and 5% CO2 in a humidified incubator. Determine the cell number using a Neubauer chamber by counting cells in the four 16-square sets. The cell number per ml is obtained by calculating the average number of cells in the four 16-square sets and multiplying this number by 104. For each time post-infection included in step 1.3, use 1 x 107 HFF cells.</li>
	<li>Mock-infect or infect HFF cells with adenovirus type 5 (Ad5) wild-type (WT) (H5pg41008) in 100 mm tissue culture dishes using 1 ml of Ad5 in DMEM per dish at an MOI of 30 Focus Forming Unit, or FFU, per cell. Incubate for 2 hr in a humidified cell culture incubator at 37 &#186;C and 5% CO2, carefully rocking the dishes every 15 min to ensure homogeneous distribution of the virus inoculum over the cells. After this time, remove the medium and add fresh DMEM supplemented with 10% FBS and incubate for 16, 24 or 36 hr in a humidified cell culture incubator at 37 &#186;C and 5% CO2. Proceed to step 2.1.</li>
</ol>
2. Preparation of Sub-nuclear Fractions Enriched with Adenovirus RC
<ol>
	<li>Harvest Ad5-infected or mock-infected HFF cells with a cell scrapper and collect the cells in sterile centrifuge tubes. Determine the cell number as in step 1.2. Use 1 x 107 cells for each time post-infection specified in step 1.3.</li>
	<li>Centrifuge the cells at 220 x g, 4 &#186;C for 5 min.</li>
	<li>Resuspend the cell pellet in ice-cold PBS (137 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4 and 1.8 mM KH2PO4). Wash cell pellets 3 times using 5 ml of ice-cold PBS per wash. For this purpose, centrifuge the cells at 220 x g, 4 &#186;C for 5 min, decant and discard the supernatant (SN), and resuspend the cell pellet by gentle pipetting.</li>
	<li>To disrupt the plasma membrane, resuspend the cell pellet in 700 &#181;l of ice-cold hypotonic buffer (10 mM HEPES pH 7.9, 10 mM KCl, 1.5 mM MgCl2, 0.5 mM DTT, 20 &#181;g/ml phenylmethylsulfonyl fluoride (PMSF), a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and let the cells swell on ice for 3 hr.</li>
	<li>Lyse the cells using a homogenizer with a loose-fitting A type teflon pestle. Perform 80 dounce strokes and monitor samples every 20 strokes by bright field microscopy to ensure that all cells have been lysed, but that nuclei have not been damaged or ruptured.</li>
	<li>Centrifuge the cell homogenate at 300 x g, 4 &#186;C for 5 min. Store the SN as the cytoplasmic fraction at -20 &#186;C in a centrifuge tube.</li>
	<li>To remove cellular debris from nuclei, resuspend the pellet in 750 &#181;l of solution 1 (S1) (0.25 M sucrose, 10 mM MgCl2 20 &#181;g/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal) and layer over an equal volume of solution 2 (S2) (0.35 M sucrose, 0.5 mM MgCl2, 20 &#181;g/ml PMSF, a mixture of cysteine, serine, threonine and aspartyl protease inhibitors including 10 &#181;g/ml bovine pancreatic trypsin inhibitor, 10 &#181;g/ml pepstatin A and 10 &#181;g/ml N-acetyl-L-leucyl-L-leucyl-L-argininal). Centrifuge at 1,400 x g, 4 &#186;C for 5 min.</li>
	<li>Discard the SN using a micropipette. Avoid disturbing the pellet.</li>
	<li>Resuspend the pellet containing isolated nuclei in 750 &#181;l of S2.</li>
	<li>To isolate subnuclear fractions enriched with adenovirus RC (RCf), sonicate resuspended nuclei with an ultrasonic bath, using two 5 min pulses, or until all nuclei are lysed as observed by bright field microscopy. Use ice in ultrasonic bath as needed to keep samples at or below 4 &#176;C.</li>
	<li>Layer the sonicated nuclei over an equal volume of solution 3 (S3) (0.88 M sucrose, 0.5 mM MgCl2) and centrifuge at 3,000 x g, 4 &#186;C for 10 min. Store the 1.5 ml supernatant as the nucleoplasmic fraction (Npl) at -70 &#186;C. Resuspend the pellet in 700 &#181;l of S2 and store as RCf at -70 &#186;C.</li>
</ol>
3. Western Blot Analyses of RCf

NOTE: For Western Blot analysis of Npl and RCf fractions set aside 640 &#181;l for Npl and 300 &#181;l for RCf from the total volume obtained in step 2.11.

<ol>
	<li>Mix 15 &#181;l of each subnuclear fraction in Laemmli buffer 2x (4% SDS, 20% glycerol, 10% 2-mercaptoethanol, 0.004% bromophenol blue, 0.125 M Tris HCl pH 6.8) and boil at 95 &#186;C for 5 min. Load the samples in a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) denaturing gel and separate proteins for 1.5 hr, at 20 milliamperes (mA).</li>
	<li>Transfer proteins by electroblotting for 1.5 hr at 400 mA onto polyvinylidene difluoride (PVDF) membranes.</li>
	<li>Block membrane for 2 hr at RT using 3% nonfat dry milk in PBS.</li>
	<li>Incubate O/N&#160;at 4 &#186;C with primary antibody against viral E2A DNA-binding protein (B6-89) at a 1:500 dilution in PBS/0.3% nonfat dry milk.</li>
	<li>Wash membrane 3 times with PBS/0.1% Tween 20 for 10 min.</li>
	<li>Incubate the membrane with mouse anti IgG secondary antibody coupled to horse-radish peroxidase (HRP) at a 1:10,000 dilution in PBS for 2 hr at RT.</li>
	<li>Wash the membrane 3 times with PBS/0.1% Tween 20 for 10 min.</li>
	<li>Develop the membrane using enhanced chemiluminescence and X-ray films.</li>
</ol>
4. Viral DNA Detection in RCf
NOTE: For DNA isolation from both Npl and RCf fractions, use 210 &#181;l for Npl and 100 &#181;l for RCf of the total volume obtained in step 2.11.
<ol>
	<li>Incubate sub-nuclear fractions for 1 hr at 55 &#186;C with 1 mg/ml of proteinase K and 0.5% Tween 20.</li>
	<li>Inactivate proteinase K by incubating the samples for 10 min at 95 &#176;C.</li>
	<li>Centrifuge the samples at 20,000 x g, at RT for 2 min.</li>
	<li>Collect the SN. Precipitate the DNA with 1/10 volume of 3M sodium acetate and one volume of isopropanol, O/N&#160;at 4 &#176;C.</li>
	<li>Centrifuge the samples at 20,000 x g, at RT for 10 min.</li>
	<li>Discard the SN using a micropipette. Wash the pellet with 70% ethanol and centrifuge at 20,000 x g, 4 &#176;C for 5 min.</li>
	<li>Resuspend the DNA in 10 &#181;l of 10 mM Tris-HCl pH 7.4</li>
	<li>Quantify DNA using a spectrophotometer by measuring the optical density (OD) at 260 nm.</li>
	<li>To amplify viral DNA, use 100 ng of DNA from each subnuclear fraction in a standard PCR reaction using Taq DNA polymerase in 25 &#181;l of reaction volume with primers that allow the amplification of a region within the Major Late transcription unit, from nucleotide 7273 to nucleotide 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Use the following cycle conditions: Initial denaturation for 3 min at 95 &#186;C, followed by 20 cycles of amplification (1 min at 95 &#186;C, annealing for 1 min at 62 &#186;C and extension for 30 sec at 72 &#186;C) and a final extension step for 3 min at 72 &#186;C.</li>
	<li>Run the PCR product in 2% agarose gels, at 90 V. Stain with ethidium bromide at 0.5 &#181;g/ml final concentration and visualize DNA to corroborate viral DNA enrichment in the RCf. Handle ethidium bromide with extreme caution and always make sure to wear gloves, as this compound is a potent mutagen. Dispose ethidium bromide according to institutional guidelines.</li>
</ol>
5. Late Viral mRNA Detection in RCf
NOTE: For RNA isolation from both Npl and RCf fractions, use 640 &#181;l for Npl and 300 &#181;l for RCf from the total volume obtained in step 2.11.
<ol>
	<li>Isolate RNA from subnuclear fractions using Trizol according with the manufacturer&#8217;s instructions. Resuspend the RNA in 50 &#181;l of DEPC (diethilpyrocarbonate)-treated water.</li>
	<li>Quantify the RNA using a spectrophotometer to measure the OD at 260 nm (approximately 3 &#181;g are obtained). Store the RNA in 50 ng/&#181;l aliquots at -70 &#186;C.</li>
	<li>Check purified RNA for the absence of DNA contamination by performing a control PCR reaction in the absence of reverse transcriptase (RT), using 5 ng of total RNA and the cycle conditions described in step 4.9.
	<ol>
		<li>If DNA contamination is absent no amplicon should be produced. If DNA contamination is present, incubate the samples with 10 U DNase I, 10 U of Rnase inhibitor, 0.1 M Tris-HCl pH 8.3, 0.5 M KCl and 15 mM MgCl2 for 30 min at 37 &#186;C. Proceed to re-isolate RNA as in step 5.1.</li>
	</ol>
	</li>
	<li>To analyze viral mRNA associated to RCf, amplify 100 ng of RNA from each subnuclear fraction by RT-PCR using primers designed to detect adenoviral late mRNA from different gene families (Table 1).
	<ol>
		<li>For reverse transcription (RT), use 100 ng of RNA, from each subnuclear fraction in a standard RT reaction using M-MuLV RT enzyme in 20 &#181;l of reaction volume for 1 hr at 42 &#186;C and 10 min at 70 &#186;C.</li>
		<li>For amplification, use 1 &#181;l of the cDNA in PCR reactions, as in step 4.9. Use the following cycle conditions: Initial denaturation for 3 min at 95 &#186;C, followed by 25 cycles of amplification (1 min at 95 &#186;C, annealing for 1 min at the temperature specified in Table 1 and extension for 30 sec at 72 &#186;C) and a final extension step for 3 min at 72 &#186;C.</li>
	</ol>
	</li>
	<li>Run the RT-PCR products in 2% agarose gels, at 90 V. Stain gels with ethidium bromide at 0.5 &#181;g/ml final concentration and visualize to corroborate viral late mRNA association to the RCf. Handle ethidium bromide as indicated in step 4.10.</li>
</ol>
6. Immunofluorescence Visualization of RCf
NOTE: Carry-out this procedure under a laminar flow cabinet to avoid contamination of the samples with any dust particles, and filter all solutions before use.
<ol>
	<li>Spot 5 &#181;l of the RCf fraction obtained in step 2.10 directly on a silane-coated slide.</li>
	<li>Let the spot dry for about 5 min at RT.</li>
	<li>Re-hydrate by slowly and indirectly pipetting 500 &#181;l of PBS in a drop beside the RCf spot and letting it flow by tilting the slide. Drain off the excess PBS from the side.</li>
	<li>Block by covering the sample with 500 &#181;l of PBS/5% bovine serum albumin (BSA) for 2 hr at RT.</li>
	<li>Wash the slide 3 times by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess PBS.</li>
	<li>Incubate the sample with primary antibody against viral E2A DNA-binding protein (B6-89) at a 1:500 dilution in PBS for 2 hr at RT. Cover the spotted sample with 20 &#181;l of the antibody solution and incubate in a humid chamber to avoid drying.</li>
	<li>Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess wash solution.</li>
	<li>Incubate the samples with mouse anti IgG secondary antibody coupled to a fluorophore that is excited at 488 nm at a 1:2,000 dilution in PBS, for 1 hr at 4 &#186;C. Cover the spotted sample with 20 &#181;l of the antibody solution and incubate in a humid chamber to avoid drying.</li>
	<li>Wash the sample 3 times with PBS/0.02% Tween 20 by gently and indirectly pipetting 500 &#181;l of PBS onto the sample. Tilt the slide to drain off the excess wash solution.</li>
	<li>Cover the spotted sample on the slide with a coverslip using 2 &#181;l PBS/10% glycerol as mounting medium. Seal with clear nail polish and store al -20 &#186;C.</li>
	<li>Analyze the samples using a fluorescence microscope, with a 63x objective and a 1.4 Numeric Aperture (NA) at a wavelength of 488 nm.</li>
</ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of the procedure that require standardization depending on the cell type used are: i) standardization of the times used for cell swelling to avoid disruption of nuclei; ii) formation of the sucrose gradients so that fractions can be properly separated; iii) constant monitoring of the samples throughout the procedure by bright field microscopy; iv) sonication time and intensity to ensure that all nuclei are lysed but RC are not disrupted; v) all fractionation steps should be carried out on ice to avoid disruption of nuclear structures. 
Limitations of the technique that can be encountered or can be anticipated are: i) that nucleoli and perhaps other subnuclear structures or domains that share similar dimensions and biochemical composition are coisolated in the RC fraction, making the relative abundance of replication compartments versus other similar nuclear bodies variable depending on the virus, cell type and time post-infection used for their isolation; ii) it is possible that just as the size and composition of RC changes as the replication cycle of the virus progresses, the compactness of the RC particles may also change, making it necessary to perform experiments designed to determine detailed ultrastructural changes of the RC particles at different times post-infection to evaluate not only changes in the particles composition and activities, but whether their stability may vary. While these issues may limit the characterization of RC composition and activities at various different times post-infection, as less stable RC obtained by this procedure may not recapitulate their counterpart in the infected cell nucleus, such limitations may be overcome by using higher multiplicities of infection or by determining the times post-infection at which viral RC have attained a minimum size and abundance in the infected cell nucleus. These potential limitations notwithstanding, the technique reported here provides several advantages over the analysis that has hitherto solely relied on microscopy; namely that the precise biochemical and functional analysis of RC can be performed using this novel approach. 
We show here that the RC-fractions (RCf) obtained are enriched with bona fide RC markers, such as the viral E2-72K DBP protein, viral DNA and RNA. Using biochemical analysis by immunoblotting and PCR, we have confirmed that this approach facilitates the detailed analysis of components and activities associated to RC and should help unravel molecular mechanisms that regulate virus-host cell interactions in the infected-cell nucleus. 
It is well established that DNA replication, transcription and post-transcriptional processing of viral late mRNA are closely associated to viral replication compartments, events that lead to viral progeny production2,11,12. In adenovirus-infected cells the onset of viral DNA replication marks the transition to the late phase of infection and results in the activation of the Major Late promoter, which directs the production of high quantities of viral late transcripts. However, the L4 genes are expressed through a novel promoter (L4P) that is independent from the MLP13,14. Besides this complex program of late promoter activation, the selection of 3&#8217; splice sites for longer introns is progressively favored as the late phase proceeds. In addition, production of these transcripts is regulated by their selective release from the site of synthesis and by selective export to the cytoplasm. 
However, regulation of the late promoters and molecular events that lead to the selective production of viral late mRNA is incompletely understood. Therefore, as a proof of concept for the procedure reported here, we demonstrate that viral DNA and viral late mRNA can be isolated in RCf, suggesting that these subnuclear fractions can be used to determine the pattern of synthesis and partitioning of different species of viral late mRNA, hence allowing the use of quantitative techniques and potentially advancing the detailed study of the complex pattern of viral late mRNA biogenesis. 
Furthermore, this technique can be used to study the molecular mechanisms that are responsible for the efficient replication of the viral genome, regulation of the complex program of viral gene transcription and cellular factors that are co-opted in RC, as well as morphological and ultrastructural studies of these viral induced structures. Moreover this system should be easily adapted to isolate RC from other nuclear replicating viruses, and should help unravel viral mechanisms that govern virus-cell interactions.

Adenoviruses contain a double-stranded DNA genome that replicates in the infected cell nucleus. When the viral DNA enters the nucleus, it localizes adjacent to PML nuclear bodies1. Following viral early gene expression, the nuclear architecture is dramatically reorganized, inducing formation of viral microenvironments, termed viral Replication Compartments (RC)2. Since adenovirus (Ad) RC are sites where viral genome replication and expression of viral late genes take place, they provide an environment for recruitment of all the necessary viral and cellular factors that participate in these processes. Interestingly, a variety of cellular proteins responsible for the cellular antiviral response, such as the DNA damage response, the innate immune response and tumor suppression are co-opted to these viral sites2. Hence, Ad RC can be considered regulatory hubs that promote efficient viral replication while concomitantly regulating the cellular antiviral response, indicating that these structures are key to the understanding of virus-host cell interactions. Nevertheless, the molecular mechanisms of RC formation, their composition and associated activities are poorly understood.
Adenoviral RC, as well as RC from other DNA viruses that replicate in the nucleus are not associated to membranes, in contrast to cytoplasmic RC3. Moreover, these virus-induced structures are likely to be composed entirely of proteins and nucleic acids. RC formed in cells infected with RNA viruses (usually termed viral factories) have been isolated, taking advantage of their cytoplasmic localization and membrane-bound status, which has facilitated their detailed morphological, functional and biochemical characterization4.
To our knowledge, nuclear viral RC have not been isolated, perhaps due to the complexity of the nuclear architecture and absence of intranuclear membranes that would facilitate their isolation. Their study has relied instead on immunofluorescence microscopy, FISH and transmission electron microscopy. However, despite complications inherent to isolating subnuclear structures, other nuclear domains such as nucleoli and Cajal Bodies have been isolated before 5,6. Since nucleoli and RC are both composed of proteins and nucleic acids, and have a diameter between 0.5 - 5 &#181;m, we hypothesized that RC should also be amenable to isolation. Therefore, in order to more precisely characterize the molecular composition and functions associated to RC, we established a novel method to isolate subnuclear fractions enriched with RC. To this end, we prepared sub-nuclear fractions using velocity gradients and sucrose cushions similar to procedures used to isolate nucleoli7 or other nuclear domains6 and established a cell-free system that allows the study of the molecular composition and associated activities of RC. This technique should therefore advance the understanding of virus-host cell interactions and represents a powerful tool that should also facilitate the detailed analysis of RC from other viruses that replicate in the nucleus and induce formation of replication compartments of similar dimensions to those formed in adenovirus-infected-cells, such as, herpesviruses, papillomaviruses or polyomaviruses.

<table><tbody><tr><td>DMEM</td><td>Gibco</td><td>12100-046</td><td>Warm in 37 &amp;ordm;C water bath before use</td></tr><tr><td>Fetal Bovine Serum</td><td>Gibco</td><td>12484-028</td><td></td></tr><tr><td>Sucrose, Ultra Pure</td><td>Research Organics</td><td>0928S</td><td>Prepare a 2.55 M stock solution and store at 4 &amp;ordm;C</td></tr><tr><td>Dounce homogenizer</td><td>Kontess Glass Company</td><td>884900-0000</td><td></td></tr><tr><td>Branson 1800 Ultrasonic Bath</td><td>Branson</td><td>Z769533&amp;nbsp;SIGMA</td><td>Turn on 15 min before use.</td></tr><tr><td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td><td>Life Technologies</td><td>A-21121</td><td>Use at a 1:2,000 dilution in PBS</td></tr><tr><td>Silane-Prep Slides</td><td>Sigma</td><td>S4651-72EA</td><td>Open in a laminar flow cabinet</td></tr><tr><td>SuperSignal West Pico Chemiluminescent Substrate</td><td>Pierce ThermoScientific</td><td>34080</td><td></td></tr></tbody></table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Since viral replication compartments (RC) are subnuclear viral-induced structures composed of proteins and nucleic acids, similar to other nuclear domains, they proved to be amenable to isolation by velocity gradients based on biochemical features. Critical steps in the fractionation protocol are illustrated in Figure 1. At each step the samples need to be monitored by bright field microscopy to ensure integrity of the different sub-cellular fractions. For example, when swelling the cells, incubation time in the hypotonic buffer needs to be standardized in order to swell the cytoplasm avoiding damage to the nuclei. After cell homogenization, intact nuclei, free of cytoplasmic components including endoplasmic reticulum membranes, need to be obtained. Also, sonication time needs to be standardized in order to rupture the nuclear membrane of all cells without disrupting RC.
After obtaining the sub-nuclear fractions, key controls need to be included to determine the association and enrichment of bona fide RC markers in the RCf. Adenoviral RC are commonly visualized in infected cells by immunofluorescence using antibodies against the viral E2A-72K protein (DBP). DBP is a viral protein that participates directly in viral genome replication; therefore, the presence of DBP in particles enriched in the RCf demonstrates the direct association of this viral protein with the isolated particles, as shown in Figure 1. Furthermore, detection of DBP in RCf by Western Blot confirms the association of this protein to the isolated RC. In Figure 2 it is shown that by late times post-infection (36 hpi), DBP is enriched in the RCf compared to the nucleoplasmic fraction (Npl), demonstrating that RC obtained with this procedure at different times post-infection reflect the expected temporal pattern of DBP association to RC. An essential viral component of RC is the viral DNA itself. In experiments like that shown in Figure 3 we demonstrate that increasing amounts of viral DNA associate with RCf as the replication cycle of the virus progresses, indicating that, as for DBP, the temporal pattern of DNA replication in these fractions can also be studied.
Besides containing viral proteins and the viral genome, RC are also sites of viral late gene expression. In Figure 4 we present representative results of experiments designed to measure by RT-PCR the level of various species of viral late mRNA and their segregation between RCf and Npl at 36 hpi. Viral late mRNA are synthesized in RC and their postranscriptional processing initiates in these sites; later these viral mRNA dissociate from RC, are liberated to the nucleoplasm, and are subsequently exported to the cytoplasm. The total pool of mature viral late mRNA (ML mRNA) was measured using primers that amplify an exon junction of the tripartite leader, a sequence that constitutes the 5&#8217; of all adenoviral late mRNA (Figure 4A). Exon junctions in the mRNA of specific mature transcripts of the L2, L4 and L5 families were also measured. It has been established that as the late phase of the viral replication cycle progresses, increasing amounts of viral late mRNA are exported to the cytoplasm; however, by late times production of the L5 mRNA species increases further in comparison with the other late mRNA families. In the representative results sown in Figure 4 an approximately 2.5-fold difference in ML mRNA is observed in Npl compared with RCf, as expected. Interestingly when we compare mRNA from specific families, both L2 and L4 mRNA appear to be distributed in similar levels between both subnuclear fractions (Figure 4B and C, respectively), while in contrast, the L5 mRNA showed an almost 2-fold increase in Npl compared to RCf. These results suggest a differential pattern in the synthesis and liberation of the different viral late mRNA species from adenoviral RC (as has been suggested before10). Significantly, these results also demonstrate that precise measurements of the different steps in the biogenesis of the viral mRNA can be performed using isolated RC with this novel procedure.
<img alt="Figure 1" src="/files/ftp_upload/53296/53296fig1.jpg" /> 
Figure 1.&#160;Bright Field Microscopy of Different Steps during the Fractionation Procedure. During the isolation of RC, the samples need to be monitored by an optical microscope to ensure integrity of sub-cellular fractions. The figure shows the steps used in the procedure to obtain RCf, from the swelling of HFF cells, to separation of nuclei and isolation of RCf through sucrose cushions. 40x micrographs: scale bar 50 &#181;m; 63x micrographs: scale bar 5 &#181;m; DBP is shown in green. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53296/53296fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/53296/53296fig2.jpg" /> 
Figure 2.&#160;Western Blot against DBP. The samples are analyzed by SDS-PAGE and processed for western blot against DBP, a bona fide marker of viral RC. To determine the enrichment of the protein in RCf, it is useful to compare the presence and relative abundance of DBP in both RCf and Npl at different times post-infection. In HFF cells 16 hpi represents an early time during the adenoviral replication cycle; 24 hpi marks the transition to the late phase of infection as viral DNA synthesis begins; 36 hpi represents a late time post-infection. The expected molecular mass of DBP is shown. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53296/53296fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/53296/53296fig3.jpg" /> 
Figure 3.&#160;PCR Assay to Detect Viral DNA (vDNA) in RCf. DNA was purified from RCf and Npl at 24 and 36 hpi. Viral DNA was amplified by PCR using primers specific for the viral genome. The graph shows the enrichment of viral DNA in RCf at 36 hpi. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53296/53296fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" src="/files/ftp_upload/53296/53296fig4.jpg" /> 
Figure 4.&#160;Analysis of Viral Late mRNA. RNA was isolated from RCf and Npl and analyzed by RT-PCR to detect specific viral late mRNA. (A) Total Viral Late mRNA (ML: Major Late); (B) mRNA from the L2 Family; (C) mRNA from the L4 Family; (D) mRNA from the L5 Family. Values represent mean &#177; standard deviation of triplicate samples. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53296/53296fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
&#160;&#173;&#160;
<table border="0" fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Name</td>
			<td>Forward primer sequence (5&#39;-3&#39;)</td>
			<td>Reverse primer sequence (5&#39;-3&#39;)</td>
			<td>Annealing temperature</td>
		</tr>
		<tr>
			<td>ML mRNA</td>
			<td>GCCT&#173;CCGA&#173;ACGG&#173;TACT&#173;CCGC&#173;C</td>
			<td>CGCC&#173;ACGG&#173;TGCT&#173;CAGC&#173;CTAC&#173;C</td>
			<td>60 &#186;C</td>
		</tr>
		<tr>
			<td>L2 mRNA</td>
			<td>GTCA&#173;CAGT&#173;CGCA&#173;AGAT&#173;GTCC&#173;AAGC&#173;</td>
			<td>GCAA&#173;CGCC&#173;AGCA&#173;TGTC&#173;CTTA&#173;TGC</td>
			<td>58 &#186;C</td>
		</tr>
		<tr>
			<td>L4 mRNA</td>
			<td>CCTC&#173;CGAA&#173;CGGT&#173;ACTC&#173;CGC</td>
			<td>CCTT&#173;GCTC&#173;ATCT&#173;TGCG&#173;ACTG&#173;TG</td>
			<td>58 &#186;C</td>
		</tr>
		<tr>
			<td>L5 mRNA</td>
			<td>GTCA&#173;CAGT&#173;CGCA&#173;AGAT&#173;GAAG&#173;CG</td>
			<td>GGTA&#173;ACTA&#173;GAGG&#173;TTCG&#173;GATA&#173;GGCG&#173;</td>
			<td>60 &#186;C</td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Primers Used for Viral Late mRNA Amplification. ML mRNA: these primers allow the amplification of a region within the tripartite leader, the 5&#8217; sequence that is common to all viral late mRNA; L2 mRNA primers allow the amplification of a specific region within the pV mRNA; L4 mRNA primers allow the amplification of a specific region within the 100 K mRNA; L5 mRNA allows the amplification of a region within the fiber mRNA. The sequence and annealing temperatures for each primer are shown.

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

8.7K Views.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Video: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Efficient Recombinant Parvovirus Production with the Help of Adenovirus-derived Systems

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 which regulate the expression of non-structural (NS1 and NS2) and capsid proteins (VP1 and VP2) respectively1. They attract high interest as anticancer agents for their oncolytic and oncosuppressive abilities while being non-pathogenic for humans2. NS1 is the major effector of viral cytotoxicity3. In order to further enhance their natural antineoplastic activities, derivatives from these vectors have been generated by replacing the gene encoding for the capsid proteins with a therapeutic transgene (e.g. a cytotoxic polypeptide, cytokine, chemokine, tumour suppressor gene etc.)4. The recombinant parvoviruses (recPVs) vector retains the NS1/2 coding sequences and the PV genome telomeres which are necessary for viral DNA amplification and packaging. Production of recPVs occurs only in the producer cells (generally HEK293T), by co-transfecting the cells with a second vector (pCMV-VP) expressing the gene encoding for the VP proteins (Fig. 1)4. The recPV vectors generated in this way are replication defective. Although recPVs proved to possess enhanced oncotoxic activities with respect to the parental viruses from which they have been generated, their production remains a major challenge and strongly hampers the use of these agents in anti-cancer clinical applications.
We found that introduction of an Ad-5 derived vector containing the E2a, E4(orf6) and the VA RNA genes (e.g. pXX6 plasmid) into HEK293T improved the production of recPVs by more than 10 fold in comparison to other protocols in use. Based on this finding, we have constructed a novel Ad-VP-helper that contains the genomic adenoviral elements necessary to enhance recPVs production as well as the parvovirus VP gene unit5. The use of Ad-VP-helper, allows production of rec-PVs using a protocol that relies entirely on viral infection steps (as opposed to plasmid transfection), making possible the use of cell lines that are difficult to transfect (e.g. NB324K) (Fig. 2). We present a method that greatly improves the amount of recombinant virus produced, reducing both the production time and costs, without affecting the quality of the final product5. In addition, large scale production of recPV (in suspension cells and bioreactors) is now conceivable.

Here we describe a protocol based only on cell infection, which improves the efficiency of recombinant parvovirus production by more than 100 fold in comparison to other protocols in use. This protocol relies on the use of a novel adenovirus 5-based helper containing the parvovirus VP transcription unit (Ad-VP).

Rodent parvoviruses (PV) such as rat H-1PV and MVM, are small icosahedral, single stranded, DNA viruses. Their genome includes two promoters P4 and P38 ...

Affinity Purification of Influenza Virus Ribonucleoprotein Complexes from the Chromatin of Infected Cells

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the single-stranded genome is encapsidated by the nucleoprotein (NP), and associated with the trimeric polymerase complex consisting of the PA, PB1, and PB2 subunits. However, in contrast to most RNA viruses, influenza viruses perform viral RNA synthesis in the nuclei of infected cells. Interestingly, viral mRNA synthesis uses cellular pre-mRNAs as primers, and it has been proposed that this process takes place on chromatin1. Interactions between the viral polymerase and the host RNA polymerase II, as well as between NP and host nucleosomes have also been characterized1,2.
Recently, the generation of recombinant influenza viruses encoding a One-Strep-Tag genetically fused to the C-terminus of the PB2 subunit of the viral polymerase (rWSN-PB2-Strep3) has been described. These recombinant viruses allow the purification of PB2-containing complexes, including vRNPs, from infected cells. To obtain purified vRNPs, cell cultures are infected, and vRNPs are affinity purified from lysates derived from these cells. However, the lysis procedures used to date have been based on one-step detergent lysis, which, despite the presence of a general nuclease, often extract chromatin-bound material only inefficiently. 
Our preliminary work suggested that a large portion of nuclear vRNPs were not extracted during traditional cell lysis, and therefore could not be affinity purified. To increase this extraction efficiency, and to separate chromatin-bound from non-chromatin-bound nuclear vRNPs, we adapted a step-wise subcellular extraction protocol to influenza virus-infected cells. Briefly, this procedure first separates the nuclei from the cell and then extracts soluble nuclear proteins (here termed the "nucleoplasmic" fraction). The remaining insoluble nuclear material is then digested with Benzonase, an unspecific DNA/RNA nuclease, followed by two salt extraction steps: first using 150 mM NaCl (termed "ch150"), then 500 mM NaCl ("ch500") (Fig. 1). These salt extraction steps were chosen based on our observation that 500 mM NaCl was sufficient to solubilize over 85% of nuclear vRNPs yet still allow binding of tagged vRNPs to the affinity matrix.
After subcellular fractionation of infected cells, it is possible to affinity purify PB2-tagged vRNPs from each individual fraction and analyze their protein and RNA components using Western Blot and primer extension, respectively. Recently, we utilized this method to discover that vRNP export complexes form during late points after infection on the chromatin fraction extracted with 500 mM NaCl (ch500)3.

Influenza viruses replicate their RNA genome in association with host-cell chromatin. Here, we present a method to purify intact viral ribonucleoprotein complexes from the chromatin of infected cells. Purified viral complexes can be analyzed by both Western blot and primer extension of protein and RNA content, respectively.

Like all negative-strand RNA viruses, the genome of influenza viruses is packaged in the form of viral ribonucleoprotein complexes (vRNP), in which the ...

Purification and Visualization of Influenza A Viral Ribonucleoprotein Complexes

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A nucleoprotein (NP) into viral ribonulceoprotein particles (vRNPs). The influenza vRNPs are enclosed within the viral envelope. During cell entry, however, these vRNP complexes are released into the cytoplasm, where they gain access to the host nuclear transport machinery. In order to study the nuclear import of influenza vRNPs and the replication of the influenza genome, it is useful to work with isolated vRNPs so that other components of the virus do not interfere with these processes. Here, we describe a procedure to purify these vRNPs from the influenza A virus. The procedure starts with the disruption of the influenza A virion with detergents in order to release the vRNP complexes from the enveloped virion. The vRNPs are then separated from the other components of the influenza A virion on a 33-70% discontinuous glycerol gradient by velocity sedimentation. The fractions obtained from the glycerol gradient are then analyzed on via SDS-PAGE after staining with Coomassie blue. The peak fractions containing NP are then pooled together and concentrated by centrifugation. After concentration, the integrity of the vRNPs is verified by visualization of the vRNPs by transmission electron microscopy after negative staining. The glycerol gradient purification is a modification of that from Kemler et al. (1994)1, and the negative staining has been performed by Wu et al. (2007).2

The genome of the influenza A virus consists of eight separate complexes of RNA and proteins, termed viral ribonucleoprotein complexes (vRNPs). This paper describes the glycerol gradient purification and transmission electron microscopy visualization of influenza A vRNPs.

The influenza A viral genome consists of eight negative-sense, single stranded RNA molecules, individually packed with multiple copies of the influenza A ...

Biology

Adenoviral Transduction of Naive CD4 T Cells to Study Treg Differentiation

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 T cells in vitro with TCR- and co-stimulation in the presence of TGF&beta; and IL-2. This bears enormous potential for future therapies, however, the molecules and signaling pathways that control differentiation are largely unknown.
Primary T cells can be manipulated through ectopic gene expression, but common methods fail to target the most important naive state of the T cell prior to primary antigen recognition. Here, we provide a protocol to express ectopic genes in naive CD4 T cells in vitro before inducing Treg differentiation. It applies transduction with the replication-deficient adenovirus and explains its generation and production. The adenovirus can take up large inserts (up to 7 kb) and can be equipped with promoters to achieve high and transient overexpression in T cells. It effectively transduces naive mouse T cells if they express a transgenic Coxsackie adenovirus receptor (CAR). Importantly, after infection the T cells remain naive (CD44low, CD62Lhigh) and resting (CD25-, CD69-) and can be activated and differentiated into Tregs similar to non-infected cells. Thus, this method enables manipulation of CD4 T cell differentiation from its very beginning. It ensures that ectopic gene expression is already in place when early signaling events of the initial TCR stimulation induces cellular changes that eventually lead into Treg differentiation.

Adenoviral gene transfer into naive CD4 T cells with transgenic expression of the Coxsackie adenovirus receptor enables the molecular analysis of regulatory T cell differentiation in vitro.

Regulatory T cells (Tregs) are essential to provide immune tolerance to self as well as to certain foreign antigens. Tregs can be generated from naive CD4 ...

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

An Efficient Method for Adenovirus Production

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types and organs. However, recombinant adenoviral technology is laborious, time-consuming, and expensive. Here, we present an improved protocol using the pAdEasy system to obtain purified adenoviral particles that can induce a strong green fluorescent protein (GFP) expression in transduced cells. The advantages of this improved method are faster preparation and decreased production cost compared to the original method developed by Bert Vogelstein. The main steps of the adenoviral technology are: (1) the recombination of pAdTrack-GFP with the pAdEasy-1 plasmid in BJ5183 bacteria; (2) the packaging of the adenoviral particles; (3) the amplification of the adenovirus in AD293 cells; (4) the purification of the adenoviral particles from cell lysate and culture medium; and (5) the viral titration and functional testing of the adenovirus. The improvements to the original method consist of (i) the recombination in BJ5183-containing pAdEasy-1 by chemical transformation of bacteria; (ii) the selection of recombinant clones by &#8220;negative&#8221; and &#8220;positive&#8221; PCR; (iii) the transfection of AD293 cells using the K2 transfection system for adenoviral packaging; (iv) the precipitation with ammonium sulfate of the viral particles released by AD293 cells in cell culture medium; and (v) the purification of the virus by one-step cesium chloride discontinuous gradient ultracentrifugation. A strong expression of the gene of interest (in this case, GFP) was obtained in different types of transduced cells (such as hepatocytes, endothelial cells) from various sources (human, bovine, murine). Adenoviral-mediated gene transfer represents one of the main tools for developing modern gene therapies.

Here, we present a protocol for adenovirus production using the pAdEasy system. The technology includes the recombination of the pAdTrack and pAdEasy-1 plasmids, the adenovirus packaging and amplification, the purification of the adenoviral particles from cell lysate and culture medium, the viral titration, and the functional testing of the adenovirus.

Adenoviral transduction has the advantage of a strong and transient induction of the expression of the gene of interest into a broad variety of cell types ...

Bioengineering

Construction of Adenoviral Vectors using DNA Assembly Technology

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an adenoviral vector by manipulating the genomic DNA of wild-type HAdV-7 by using a DNA assembly method. First, an infectious clone of HAdV-7, pKan-Ad7, was generated by fusing the viral genomic DNA with a PCR product from plasmid backbone, comprising of the kanamycin-resistant gene and the origin of replication (Kan-Ori), through DNA assembly. This was done by designing a pair of PCR primers, that contained ~25 nucleotides of the terminal sequence of HAdV-7 inverted terminal repeat (ITR) at the 5' end, a non-cutter restriction enzyme site for HAdV-7 genome in the middle, and a template-specific sequence for PCR priming at the 3' end. Second, an intermediate plasmid-based strategy was employed to replace the E3 region with transgene-expressing elements in the infectious clone to generate an adenoviral vector. Briefly, pKan-Ad7 was digested with dual-cutter restriction enzyme Hpa I, and the fragment containing the E3 region was ligated to another PCR product of plasmid backbone by Gibson assembly to construct an intermediate plasmid pKan-Ad7HpaI. For convenience, restriction-assembly was used to designate the plasmid cloning method of combined restriction digestion and assembly. Using restriction-assembly, the E3 genes in pKan-Ad7HpaI was replaced with a green fluorescent protein (GFP) expression cassette, and the modified E3 region was released from the intermediate plasmid and restored to the infectious clone to generate an adenoviral plasmid pKAd7-E3GFP. Finally, pKAd7-E3GFP was linearized by Pme I digestion and used to transfect HEK293 packaging cells to rescue recombinant HAdV-7 virus. To conclude, a DNA assembly-based strategy was introduced here for constructing adenoviral vectors in general laboratories of molecular biology without the need of specialized materials and instruments.

In this study, an infectious clone of human adenovirus type 7 (HAdV-7) was constructed, and an E3-deleted HAdV-7 vector system was established by modifying the infectious clone. This strategy used here can be generalized to make gene transfer vectors from other wild-type adenoviruses.

Adenoviral vectors have been used as a gene transfer tool in gene therapy for more than three decades. Here, we introduce a protocol to construct an ...

Purification of AAV Vectors by Single-Step Heparin Affinity Chromatography

Isolation of Adeno-Associated Viral Vectors Through a Single-Step and Semi-Automated Heparin Affinity Chromatography Protocol

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. However, the commonly used methods to purify AAVs make use of cesium chloride or iodixanol density gradient ultracentrifugation. Despite their advantages, these methods are time-consuming, have limited scalability, and often result in vectors with low purity. To overcome these constraints, researchers are turning their attention to chromatography techniques. Here, we present an optimized heparin-based affinity chromatography protocol that serves as a universal capture step for the purification of AAVs.
This method relies on the intrinsic affinity of AAV serotype 2 (AAV2) for heparan sulfate proteoglycans. Specifically, the protocol entails the co-transfection of plasmids encoding the desired AAV capsid proteins with those of AAV2, yielding mosaic AAV vectors that combine the properties of both parental serotypes. Briefly, after the lysis of producer cells, a mixture containing AAV particles is directly purified following an optimized single-step heparin affinity chromatography protocol using a standard fast protein liquid chromatography (FPLC) system. Purified AAV particles are subsequently concentrated and subjected to comprehensive characterization in terms of purity and biological activity. This protocol offers a simplified and scalable approach that can be performed without the need for ultracentrifugation and gradients, yielding clean and high viral titers.

Author Spotlight: Improved Method for Production and Purification of Adeno-Associated Viral Vectors

This manuscript describes a detailed protocol for the generation and purification of adeno-associated viral vectors using an optimized heparin-based affinity chromatography method. It presents a simple, scalable, and cost-effective approach, eliminating the need for ultracentrifugation. The resulting vectors exhibit high purity and biological activity, proving their value in preclinical studies.

Adeno-associated virus (AAV) has become an increasingly valuable vector for in vivo gene delivery and is currently undergoing human clinical trials. ...

Adenofection: A Method for Studying the Role of Molecular Chaperones in Cellular Morphodynamics by Depletion-Rescue Experiments

Cellular processes such as mitosis and cell differentiation are governed by changes in cell shape that largely rely on proper remodeling of the cell cytoskeletal structures. This involves the assembly-disassembly of higher-order macromolecular structures at a given time and location, a process that is particularly sensitive to perturbations caused by overexpression of proteins. Methods that can preserve protein homeostasis and maintain near-to-normal cellular morphology are highly desirable to determine the functional contribution of a protein of interest in a wide range of cellular processes. Transient depletion-rescue experiments based on RNA interference are powerful approaches to analyze protein functions and structural requirements. However, reintroduction of the target protein with minimum deviation from its physiological level is a real challenge. Here we describe a method termed adenofection that was developed to study the role of molecular chaperones and partners in the normal operation of dividing cells and the relationship with actin remodeling. HeLa cells were depleted of BAG3 with siRNA duplexes targeting the 3&#39;UTR region. GFP-tagged BAG3 proteins were reintroduced simultaneously into &#62;75% of the cells using recombinant adenoviruses coupled to transfection reagents. Adenofection enabled to express BAG3-GFP proteins at near physiological levels in HeLa cells depleted of BAG3, in the absence of a stress response. No effect was observed on the levels of endogenous Heat Shock Protein chaperones, the main stress-inducible regulators of protein homeostasis. Furthermore, by adding baculoviruses driving the expression of fluorescent markers at the time of cell transduction-transfection, we could dissect mitotic cell dynamics by time-lapse microscopic analyses with minimum perturbation of normal mitotic progression. Adenofection is applicable also to hard-to-infect mouse cells, and suitable for functional analyses of myoblast differentiation into myotubes. Thus adenofection provides a versatile method to perform structure-function analyses of proteins involved in sensitive biological processes that rely on higher-order cytoskeletal dynamics.

We describe a method for depletion-rescue experiments that preserves cellular integrity and protein homeostasis. Adenofection enables functional analyses of proteins within biological processes that rely on finely tuned actin-based dynamics, such as mitotic cell division and myogenesis, at the single-cell level.

Cellular processes such as mitosis and cell differentiation are governed by changes in cell shape that largely rely on proper remodeling of the cell ...

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Samenvatting

Meer video's verkennen