Name: generation of recombinant human igg monoclonal antibodies from immortalized sorted b cells
Uploaded: 2015-06-05T13:00:00.000+00:00
Duration: 10 min 32 s
Description: Watch this Scientific Journal Video about Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells at JoVE.com

Research contract Miguel Servet (ISCIII CD14/00032) to (G.N.-G.). Fellowship from the Netherlands Organization for Scientific Research &#8220;Graduate School of Translational Neuroscience Program&#8221; (022005019) to (C.H.).
Grants from the Prinses Beatrix Fonds (Project WAR08-12) and the Association Fran&#231;aise contre les Myopathies to (P.M.-M.); as well as by a Veni Fellowship of the Netherlands Organization for Scientific Research (916.10.148) a fellowship of the Brain Foundation of the Netherlands (FS2008(1)-28) and the Prinses Beatrix Fonds (Project WAR08-12) (to M.L.).
We thank Jozien Jaspers for her help in the B-cell sorting by flow cytometry.

<ol>
	<li>Vrolix, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Clonal+heterogeneity+of+thymic+B+cells+from+early-onset+myasthenia+gravis+patients+with+antibodies+against+the+acetylcholine+receptor.">Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor.</a> J Autoimmun. 52, 101-112 (2014).</li><li>Yamashita, M., Katakura, Y., Shirahata, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+the+generation+of+human+monoclonal+antibody.">Recent advances in the generation of human monoclonal antibody.</a> Cytotechnology. 55 (2-3), 55-60 (2007).</li><li>Pereira, K. M., Dellavance, A., Andrade, L. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+challenge+of+identification+of+autoantibodies+specific+to+systemic+autoimmune+rheumatic+diseases+in+high+throughput+operation:+Proposal+of+reliable+and+feasible+strategies.">The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies.</a> Clin Chim Acta. 437, 403-410 (2014).</li><li>Losen, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Treatment+of+myasthenia+gravis+by+preventing+acetylcholine+receptor+modulation.">Treatment of myasthenia gravis by preventing acetylcholine receptor modulation.</a> Ann N Y Acad Sci. 1132, 174-179 (2008).</li><li>Smith, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+generation+of+fully+human+monoclonal+antibodies+specific+to+a+vaccinating+antigen.">Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen.</a> Nat Protoc. 4 (3), 372-384 (2009).</li><li>Fraussen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+method+for+making+human+monoclonal+antibodies.">A novel method for making human monoclonal antibodies.</a> J Autoimmun. 35 (2), 130-134 (2010).</li><li>Traggiai, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+efficient+method+to+make+human+monoclonal+antibodies+from+memory+B+cells:+potent+neutralization+of+SARS+coronavirus.">An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus.</a> Nat Med. 10 (8), 871-875 (2004).</li><li>Fraussen, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Autoantigen+induced+clonal+expansion+in+immortalized+B+cells+from+the+peripheral+blood+of+multiple+sclerosis+patients.">Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients.</a> J Neuroimmunol. 261 (1-2), 98-107 (2013).</li><li>Yamashita, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Different+individual+immune+responses+elicited+by+in+vitro+immunization.">Different individual immune responses elicited by in vitro immunization.</a> Cytotechnology. 40 (1-3), 161-165 (2002).</li><li>Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+B+cell+immortalization+for+monoclonal+antibody+production.">Human B cell immortalization for monoclonal antibody production.</a> Methods Mol Biol. 1131, 183-189 (2014).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Lanzavecchia, A., Corti, D., Sallusto, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+monoclonal+antibodies+by+immortalization+of+memory+B+cells.">Human monoclonal antibodies by immortalization of memory B cells.</a> Curr Opin Biotechnol. 18 (6), 523-528 (2007).</li><li>Traggiai, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+of+human+B+cells:+analysis+of+B+cell+repertoire+and+production+of+human+monoclonal+antibodies.">Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies.</a> Methods Mol Biol. 901, 161-170 (2012).</li><li>Strober, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+cell+growth.+Curr+Protoc+Immunol+/+edited+by.">Monitoring cell growth. Curr Protoc Immunol / edited by.</a> John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).</li><li>Ibrahim, S. F., van den Engh, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow+cytometry+and+cell+sorting.">Flow cytometry and cell sorting.</a> Adv Biochem Eng Biotechnol. 106, 19-39 (2007).</li><li>Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+feeder+cells+on+the+X-ray+sensitivity+of+human+colon+cancer+cells.">Effects of feeder cells on the X-ray sensitivity of human colon cancer cells.</a> Radiother Oncol. 21 (1), 53-59 (1991).</li><li>Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+Epstein-Barr+virus+growth-transformed+lymphoblastoid+cell+lines.">Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines.</a> J Vis Exp. (57), 3321 (2011).</li><li>Smith, L. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fluorescence+detection+in+automated+DNA+sequence+analysis.">Fluorescence detection in automated DNA sequence analysis.</a> Nature. 321 (6071), 674-679 (1986).</li></ol>

The authors declare that they have no competing financial interests.

In this manuscript, all the steps for the generation of IgG antibodies from human PBMCs are presented in detail. This protocol includes some advantages over previously published techniques. One of the advantages is that the antibody produced keeps the heavy and light chains corresponding to the original pair in the B cell clone. The identification of IgG antibodies can be done in any type of human donor, and there is no need for exacerbation of the immune response due to vaccination5. The use of the fibroblast cell line wi38 as a feeder cell, allows a more rapid detection of the growing clones, since they are morphologically different and very easy to differentiate, compared to the PBMCs used as feeder cell in previously described works1,6-8. Moreover the use of wi38 as a feeder cell favors the freezing of big amounts of cell aliquots that can be easily thawed and cultured before every experiment.
One of the critical steps in this protocol is the starting material: the PBMCs. If the blood has been waiting too long for centrifugation, or after the extraction of the PBMCs, they are not stored in the appropriate freezing conditions; as such the number of viable cells will be reduced, along with the number of the B cell IgG producing clones obtained. For that reason, an early extraction and a good preservation of the PBMCs are recommended for a successful outcome. The number of IgG producing clones will be limited to the number of PBMCs at the beginning of the experiment. Higher numbers of PBMCs will give higher numbers of IgG producing clones and a diverse antibody production. Another critical step is the cloning of the PCR fragments of the light and heavy chains of the antibody. If the ligation is not successful after several attempts, an extra step of cloning the 2nd PCR product in a TopoTA system is recommended. The digestion of the insert with the appropriate enzymes can be easier in the TopoTA vector, for a subsequent ligation in the pFUSEss expression vectors.
This technique can be transferred to any type of human tissue in which human B cells are enriched3. It can also be applied to the study of other types of immunoglobulins, just by changing the labelled antibodies used for sorting (antibodies against IgM, IgE, IgA or IgD), the primer design for the PCR, and the expressing vectors. The studies of these immunoglobulins can be of interest to understand, initial immune responses, mucosa antibody secretion and allergy profiles, among others.
In conclusion, we have described a technique to produce human recombinant monoclonal IgG antibodies that leaves the heavy and light chains pairs of the human immunoglobulin intact. The technique is useful and easy to perform starting from a blood sample. The monoclonal antibodies obtained through this method are potentially useful in studies on human immune responses. Furthermore, monoclonal antibodies produced with this method might be a good starting point for the development of immuno-therapeutics for different pathological conditions.

The goal of this article is to describe in detail a methodology to generate and characterize human IgG monoclonal antibodies obtained from human peripheral blood mononuclear cells (PBMCs).
The interest to study human antibodies has grown in many different fields of research. In particular, many research groups are interested in the pathology caused by auto-antibodies1-3. We have cloned and characterized pathogenic auto-antibodies1. The study of auto-antibodies can help to identify their targets and to develop therapeutic strategies, e.g., using competitor antibodies4. Moreover, the study of human antibodies can also be of interest in other fields of research, i.e., to evaluate the immune response after vaccination5, to characterize the antibody profile of individuals that were exposed and became resistant to specific pathogens6 or to study which antibodies are in the natural repertoire7,12.
Several techniques have been developed to generate recombinant human monoclonal antibodies8-12; most of these use phage display and B-cell immortalization. The use of phage display has been extensively applied for the discovery of new antibodies13. However it has a major disadvantage, namely that the heavy and light chain&#160;pairs of the human immunoglobulin become dissociated in the process. Production of hybridomas with human B cells or EBV transformation overcomes this drawback.
We use infection of thymic B cells with EBV in combination with polyclonal B cell stimulation via Toll-like receptor 9 (TLR-9)6,12.
In this paper, we describe in detail the technology that we use for the development of IgG human antibodies, with a complete overview of all the steps from PBMC isolation to the in vitro antibody generation. This protocol can be used for the analysis of any type of human IgG profile. In our laboratory, B cells producing IgG antibodies have been successfully separated from the rest of PBMCs after sorting. Fifty sorted B cells8 can then be plated in multi-well plates and immortalized by EBV and TLR-9 activation, for the clonal expansion of single B cells. As feeder cells, fibroblasts from human embryonic lung tissue have been used, cell line wi38, which facilitates the visualization of the immortalized B cells. From these B cells, the sequences of the heavy and light chains of the immunoglobulin can be obtained by PCR, and the antibodies&#39; genes cloned in immunoglobulin G expression vectors and produced in vitro. Using this technique, single antibodies with exactly the same antibody sequence found in the donor can be studied.

<table><tbody><tr><td>Histopaque-1077&amp;nbsp;</td><td>Sigma-Aldrich</td><td>10771</td><td>solution containing polysucrose and sodium diatrizoate</td></tr><tr><td>FACSAria II cell sorter&amp;nbsp;</td><td>BD Biosciences&amp;nbsp;</td><td></td><td></td></tr><tr><td>96 U-bottom micro well plates&amp;nbsp;</td><td>Costar</td><td>3799</td><td></td></tr><tr><td>Advanced Roswell Park Memorial Institute (RPMI) 1640 medium&amp;nbsp;</td><td>Gibco, Life Technologies</td><td>12633-020</td><td></td></tr><tr><td>30% v/v EBV-containing supernatant of the B95-8 cell line&amp;nbsp;&amp;nbsp;</td><td>ATCC</td><td>CRL-1612</td><td>3.4 x 108 copies/ml</td></tr><tr><td>CpG2006&amp;nbsp;</td><td>Invivogen</td><td>ODN 7909</td><td></td></tr><tr><td>Wi38 cells&amp;nbsp;</td><td>Sigma-Aldrich</td><td>90020107</td><td></td></tr><tr><td>Interleukin-2</td><td>Roche&amp;nbsp;</td><td>10799068001</td><td></td></tr><tr><td>ELISA plates</td><td>Greiner Bio-One, Microlon</td><td>655092</td><td></td></tr><tr><td>AffiniPure F(ab&#039;)2 Fragment Goat Anti-Human IgG, Fc&amp;gamma; Fragment Specific (unconjugated)</td><td>Jackson ImmunoResearch</td><td>109-006-008</td><td></td></tr><tr><td>4% non-fat dry milk (Blotting Grade Blocker)&amp;nbsp;</td><td>Biorad</td><td>170-6404</td><td></td></tr><tr><td>Human IgG&amp;nbsp;</td><td>Sigma</td><td>I 2511</td><td>HUMAN IgG purified Immunoglobulin, 5.6 mg/ml</td></tr><tr><td>Goat F(ab)&lt;sub&gt;2&lt;/sub&gt; antihuman IgG Fc&amp;gamma; (conjugated with peroxidase (PO))</td><td>Jackson ImmunoResearch</td><td>109-036-008</td><td></td></tr><tr><td>ELISA reader (Perkin Elmer 2030)&amp;nbsp;</td><td>Perkin Elmer&amp;nbsp;</td><td>2030-0050</td><td></td></tr><tr><td>Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc&lt;sub&gt;5&amp;micro;&amp;nbsp;&lt;/sub&gt;</td><td>Jackson ImmunoResearch</td><td>309-035-095</td><td></td></tr><tr><td>SuperScript III Cells Direct cDNA Synthesis System&amp;nbsp;</td><td>Invitrogen&amp;nbsp;</td><td>18080-200</td><td></td></tr><tr><td>Applied Biosystems (ABI) GeneAm PCR System 2700</td><td>Applied Biosystems</td><td></td><td></td></tr><tr><td>High Pure RNA Isolation Kit&amp;nbsp;</td><td>Roche</td><td>11828665001</td><td></td></tr><tr><td>Reverse transcription system kit&amp;nbsp;</td><td>Promega</td><td>A3500</td><td></td></tr><tr><td>Recombinant Taq DNA Polymerase</td><td>TAKARA</td><td>R001A</td><td></td></tr><tr><td>Primers (2 &amp;mu;l)</td><td>Sigma</td><td></td><td></td></tr><tr><td>Ultrapure Agarose&amp;nbsp;</td><td>Invitrogen</td><td>16500-500</td><td></td></tr><tr><td>100 bp ladder</td><td>Invitrogen</td><td>15628-019</td><td></td></tr><tr><td>Quantity One 4.5.2 (Gel Doc 2000)</td><td>Biorad</td><td>170-8100</td><td></td></tr><tr><td>QIAquick PCR purification kit</td><td>QIAGEN</td><td>28106</td><td></td></tr><tr><td>BigDye Terminator v3.1 cycle sequencing kit&amp;nbsp;</td><td>Applied Biosystems</td><td>4337455</td><td></td></tr><tr><td>0.1 ml reaction plate (MicroAMP Optical 96-well)</td><td>Applied Biosystems</td><td>4346906</td><td></td></tr><tr><td>Genetic analyser ABI300&amp;nbsp;</td><td>Applied Biosystems</td><td>4346906</td><td></td></tr><tr><td>DH5&amp;alpha; competent cells (E. coli)</td><td>Invitrogen</td><td>18263-012</td><td></td></tr><tr><td>pFUSEss-CHIg-hG1 (4,493 bp)</td><td>Invivogen</td><td>pfusess-hchg1</td><td></td></tr><tr><td>pFUSEss-CHIg-hG4 (4,484 bp)&amp;nbsp;</td><td>Invivogen</td><td>pfusess-hchg4</td><td></td></tr><tr><td>pFUSE2ss-CLIg-hk (3,875 bp)</td><td>Invivogen</td><td>pfuse2ss-hclk</td><td></td></tr><tr><td>pFUSE2ss-CLIg-hl2 (3,883 bp)&amp;nbsp;</td><td>Invivogen</td><td>pfuse2ss-hcll2</td><td></td></tr><tr><td>SOC medium</td><td>Invitrogen</td><td>15544-034</td><td></td></tr><tr><td>LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar)</td><td>Invivogen</td><td>fas-zn-s</td><td></td></tr><tr><td>Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB)</td><td>Invivogen</td><td>fas-zn-l</td><td></td></tr><tr><td>DNA Miniprep kit&amp;nbsp;</td><td>Omega Bio Technology</td><td>D6942-02</td><td></td></tr><tr><td>Nanodrop (ND1000 Spectrophotometer)</td><td>Nanodrop</td><td></td><td></td></tr><tr><td>LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar)</td><td>Invivogen</td><td>fas-bl-s</td><td></td></tr><tr><td>Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB)</td><td>Invivogen</td><td>fas-bl-l</td><td></td></tr><tr><td>EcoRI</td><td>New England Biolabs</td><td>R0101S</td><td>20,000 U/ml, in 10x NEBuffer EcoRI</td></tr><tr><td>NheI</td><td>New England Biolabs</td><td>R0131S</td><td>10,000 U/ml, in 10x NEBuffer 2.1</td></tr><tr><td>2-Log DNA ladder</td><td>New England Biolabs</td><td>N3200S</td><td>0.1-10.0 kb, 1,000 &amp;mu;g/ml</td></tr><tr><td>XmaI</td><td>New England Biolabs</td><td>R0180S</td><td>10,000 U/ml, in 10x CutSmart Buffer&amp;nbsp;</td></tr><tr><td>BsiWI</td><td>New England Biolabs</td><td>R0553S</td><td>10,000 U/ml, in 10x NEBuffer 3.1</td></tr><tr><td>AvrII</td><td>New England Biolabs</td><td>R0174S</td><td>5,000 U/ml, in 10x CutSmart Buffer&amp;nbsp;</td></tr><tr><td>FastAP Thermosensitive Alkaline Phosphatase</td><td>Thermo Scientific</td><td>EF0651</td><td>1 U/&amp;micro;l, in 10x FastAP Buffer</td></tr><tr><td>DH5&amp;alpha; competent cells&amp;nbsp;</td><td>Invitrogen</td><td>18263-012</td><td></td></tr><tr><td>PE Mouse Anti-Human IgG</td><td>BD Pharmingen</td><td>555787</td><td></td></tr><tr><td>anti-CD22, PerCP-Cy5.5, Clone: HIB22</td><td>Fisher scientific</td><td>BDB563942</td><td></td></tr><tr><td>QIAprep Spin Miniprep Kit&amp;nbsp;</td><td>QIAGEN</td><td>27106</td><td></td></tr><tr><td>BigDye Terminator v3.1</td><td>Applied Biosystems</td><td>4337455</td><td></td></tr></tbody></table>

generation of recombinant human igg monoclonal antibodies from immortalized sorted b cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, including the development of immunotherapeutics. However, the techniques to identify and produce such antibodies tend to be arduous and sometimes the heavy and light chain pair of the antibodies are dissociated. Here, we describe a relatively simple, straightforward protocol to produce human recombinant monoclonal antibodies from human peripheral blood mononuclear cells using immortalization with Epstein-Barr Virus (EBV) and Toll-like receptor 9 activation. With an adequate staining, B cells producing antibodies can be isolated for subsequent immortalization and clonal expansion. The antibody transcripts produced by the immortalized B cell clones can be amplified by PCR, sequenced as corresponding heavy and light chain pairs and cloned into immunoglobulin expression vectors. The antibodies obtained with this technique can be powerful tools to study relevant human immune responses, including autoimmunity, and create the basis for new therapeutics.

The sorting gating after staining CD22 and IgG positive cells is shown in Figure 1. In this image the area of the double positive cells &#8211; B cells producing IgG antibodies &#8211; is selected to sort all these cells in a separate tube. In the analysis, approximately 1% of the total PBMCs correspond to this double positive population. The number of sorted cells obtained will depend on the number of cells obtained in section 1.
The different outcomes after 5 weeks of EBV immortalization and CpG (ODN2006) stimuli are shown in Figure 2. The detection of the growing clones is easy; Wi38 feeder cells have a more elongated fibroblast shape, and the B cell clones appear as very small round cells growing clustered in the middle of the round bottom multi-well plate. At this stage, it is evident that some clones start growing. However, the growing speed can be variable and of course some of the wells containing immortalized cells may not have any cells growing at all.
The supernatant of the growing clones is tested in an ELISA for detecting IgG as shown in Table 2. In this ELISA a standard curve for IgG is tested, together with the supernatant of the clones and the blanks. A positive clone is considered when the value in the ELISA is 3 standard deviations over the blank value. Negative clones&#8217; values are under the 3 standard deviations of the blank. For confirmation, positive clones should be positive in the ELISA at least three times in different supernatants of the same clone and if possible verified by an additional screening method.
The complete sequence of a human IgG antibody obtained applying the steps described in this manuscript is shown in Figure 3. This sequence has been obtained after cloning the immunoglobulin heavy and lambda chain pair from a clonally expanded B cell. Variable and constant regions of the heavy and light chain can be characterized with this technique. After obtaining the sequences, antibodies sequences can be cloned and produced in vitro in HEK cell cultures.
<img alt="Figure 1" src="/files/ftp_upload/52830/52830fig1.jpg" /> 
Figure 1.&#160;Flow cytometric analysis of CD22+ and IgG+ cells from human peripheral blood mononuclear cells.&#160;(A) Selection of the population of living cells is shown in P1. (B) Forward scatter plot. (C) Size scatter plot. (D) The Y axis shows cells separated by anti-CD22-PerCP and on the X axis separated by IgG-PE. P4 square indicates the cell fraction that has been sorted (CD22+, IgG+) and recovered for culture. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52830/52830fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" src="/files/ftp_upload/52830/52830fig2.jpg" /> 
Figure 2.&#160;Representative image of B cell immortalized clones in a 96 well-plate after 5 weeks of culture. (A) In this well no immortalization was observed after 5 weeks, but wi38 irradiated feeder cells can be observed. (B) A slowly growing clone was observed in this well, with tiny round aggregates in the middle. (C) Fast growing clone showing round aggregates of immortalized B cells. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52830/52830fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" src="/files/ftp_upload/52830/52830fig3.jpg" /> 
Figure 3. Human antibody sequences of heavy and light chain pair from a human immortalized B cell clone, F5.2, indicating V CDR1, CDR2 and CDR3 sequences. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52830/52830fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<colgroup>
		<col span="2" />
	</colgroup>
	<tbody>
		<tr>
			<td colspan="3">1st PCR primers</td>
		</tr>
		<tr>
			<td></td>
			<td>Forward (5&#8217;-3&#8217;)</td>
			<td>Reverse (3&#8217;-5&#8217;)&#160;</td>
		</tr>
		<tr>
			<td rowspan="4" width="10">IgG</td>
			<td>5&#8242; L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG</td>
			<td>3&#8242; C&#947; CH1 GGAAGGTGTGCACGCCGCTGGTC</td>
		</tr>
		<tr>
			<td>5&#8242; L-VH 3 AAGGTGTCCAGTGTGARGTGCAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="4" width="10">&#954;</td>
			<td>5&#8242; L V&#954; 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG</td>
			<td>3&#8242; C&#954; 543 GTTTCTCGTAGTCTGCTTTGCTCA</td>
		</tr>
		<tr>
			<td>5&#8242; L V&#954; 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG</td>
			<td>3&#8242; C&#954; 494 GTGCTGTCCTTGCTGTCCTGCT</td>
		</tr>
		<tr>
			<td>5&#8242; L V&#954; 4 ATTTCTCTGTTGCTCTGGATCTCTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; Pan V&#954; ATGACCCAGWCTCCABYCWCCCTG</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="7" width="10">&#955;</td>
			<td>5&#8242; L V&#955; 1 GGTCCTGGGCCCAGTCTGTGCTG</td>
			<td>3&#8242; C&#955; CACCAGTGTGGCCTTGTTGGCTTG</td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 2 GGTCCTGGGCCCAGTCTGCCCTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 3 GCTCTGTGACCTCCTATGAGCTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 4/5 GGTCTCTCTCSCAGCYTGTGCTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 6 GTTCTTGGGCCAATTTTATGCTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 7 GGTCCAATTCYCAGGCTGTGGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; L V&#955; 8 GAGTGGATTCTCAGACTGTGGTG</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="3">2nd PCR primers</td>
		</tr>
		<tr>
			<td></td>
			<td>Forward (5&#8217;-3&#8217;)</td>
			<td>Reverse (3&#8217;-5&#8217;)&#160;</td>
		</tr>
		<tr>
			<td rowspan="12" width="10">IgH</td>
			<td>5&#8242; EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG 
			TGCAG</td>
			<td>3&#8242; NheI JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT 
			GACCAG</td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH1 to 5 CAACCGGAATTCAGAGGTGCAGCTG 
			GTGCAG</td>
			<td>3&#8242; NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA 
			CCATTG</td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG 
			GTGGAG</td>
			<td>3&#8242; NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG 
			ACCGTG</td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT 
			GTTGGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT 
			GCAGGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC 
			AGCAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT 
			GGTGCAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT 
			GGTACAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT 
			GGTGGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT 
			GGTGGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT 
			GCAGGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT 
			GCAGCAG</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="10" width="10">&#954;</td>
			<td>5&#8242; EcoRI V&#954; 1 5 CAACCGGAATTCAGACATCCAGATGA 
			CCCAGTC</td>
			<td>3&#8242; BsiWI J&#954; 1 to 4 GCCACCGTACGTTTGATYTCCACCTTGGTC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 1 9 CTTCCGGAATTCAGACATCCAGTTGAC 
			CCAGTCT</td>
			<td>3&#8242; BsiWI J&#954; 2 GCCACCGTACGTTTGATCTCCAG 
			CTTGGTC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 1D 43 CTTGGCGAATTCAGCCATCCGGATGA 
			CCCAGTC</td>
			<td>3&#8242; BsiWI J&#954; 3 GCCACCGTACGTTTGATATCCACT 
			TTGGTC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 2 24 CTTCCGGAATTCAGATATTGTGATGA 
			CCCAGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 2 28 CTTCCGGAATTCAGATATTGTGATG 
			ACTCAGTC</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 2 30 CTTCCGGAATTCAGATGTTGTGATGA 
			CTCAGTC</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 3 11 CTTCCGGAATTCAGAAATTGTGTTG 
			ACACAGTC</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 3 15 CTTCCGGAATTCAGAAATAGTGATG 
			ACGCAGTC</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 3 20 CTTCCGGAATTCAGAAATTGTGTTGA 
			CGCAGTCT</td>
			<td></td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#954; 4 1 CTTCCGGAATTCAGACATCGTGATG 
			ACCCAGTC</td>
			<td></td>
		</tr>
		<tr>
			<td rowspan="6" width="10">&#955;</td>
			<td>5&#8242; EcoR1 V&#955; 1 CTTCCGGAATTCACAGTCTGTGCT 
			GACKCAG</td>
			<td>3&#8242; AvrII J&#955; 1 to 3 CTGGTTACCTAGGAGGACGGTSACCT 
			TGGTCCC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#955; 2 CTTCCGGAATTCACAGTCTGCCC 
			TGACTCAG</td>
			<td>3&#8242; AvrII J&#955; 4 CTGGTTACCTAGGAAAATGATCAGC 
			TGGGTTCC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#955; 3 CTTCCGGAATTCATCCTATGAGC 
			TGACWCAG</td>
			<td>3&#8242; AvrII J&#955; 5 CTGGTTACCTAGGAGGACGGTCAGC 
			TCGGTCCC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#955; 4 to 5 CTTCCGGAATTCACAGCYTGTG 
			CTGACTCA</td>
			<td>3&#8242; AvrII J&#955; 6 CTGGTTACCTAGGAGGACGGTCAGCT 
			GGGTGCC</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#955; 6 CTTCCGGAATTCAAATTTTATGC 
			TGACTCAG</td>
			<td>3&#8242; AvrII J&#955; 7 CTGGTTACCTAGGAGGACGGTCAC 
			TTGGTCCAT</td>
		</tr>
		<tr>
			<td>5&#8242; EcoR1 V&#955; 7 to 8 CTTCCGGAATTCACAGRCTGTG 
			GTGACYCAG</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 1.&#160;Primers used.
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td></td>
			<td>1</td>
			<td>2</td>
			<td>3</td>
			<td>4</td>
			<td>5</td>
			<td>6</td>
			<td>7</td>
			<td>8</td>
			<td>9</td>
			<td>10</td>
			<td>11</td>
			<td>12</td>
		</tr>
		<tr>
			<td>A</td>
			<td align="left">0.076</td>
			<td align="left">0.077</td>
			<td align="left">2.003</td>
			<td align="left">0.080</td>
			<td align="left">0.138</td>
			<td align="left">0.102</td>
			<td align="left">0.188</td>
			<td align="left">0.338</td>
			<td align="left">0.040</td>
			<td align="left">2.041</td>
			<td align="left">0.051</td>
			<td align="left">0.081</td>
		</tr>
		<tr>
			<td>B</td>
			<td align="left">2.011</td>
			<td align="left">0.085</td>
			<td align="left">0.074</td>
			<td align="left">0.069</td>
			<td align="left">0.081</td>
			<td align="left">0.122</td>
			<td align="left">0.372</td>
			<td align="left">2.133</td>
			<td align="left">0.119</td>
			<td align="left">0.097</td>
			<td align="left">0.072</td>
			<td align="left">0.072</td>
		</tr>
		<tr>
			<td>C</td>
			<td align="left">0.068</td>
			<td align="left">0.179</td>
			<td align="left">0.091</td>
			<td align="left">0.073</td>
			<td align="left">0.077</td>
			<td align="left">0.097</td>
			<td align="left">0.606</td>
			<td align="left">1.882</td>
			<td align="left">0.081</td>
			<td align="left">2.071</td>
			<td align="left">0.094</td>
			<td align="left">0.075</td>
		</tr>
		<tr>
			<td>D</td>
			<td align="left">0.063</td>
			<td align="left">0.070</td>
			<td align="left">0.065</td>
			<td align="left">0.071</td>
			<td align="left">0.082</td>
			<td align="left">2.071</td>
			<td align="left">0.339</td>
			<td align="left">2.089</td>
			<td align="left">0.076</td>
			<td align="left">0.086</td>
			<td align="left">0.066</td>
			<td align="left">0.069</td>
		</tr>
		<tr>
			<td>E</td>
			<td align="left">1.921</td>
			<td align="left">0.077</td>
			<td align="left">0.065</td>
			<td align="left">0.085</td>
			<td align="left">0.095</td>
			<td align="left">1.968</td>
			<td align="left">1.910</td>
			<td align="left">0.122</td>
			<td align="left">0.072</td>
			<td align="left">0.070</td>
			<td align="left">0.065</td>
			<td align="left">0.066</td>
		</tr>
		<tr>
			<td>F</td>
			<td align="left">0.113</td>
			<td align="left">0.068</td>
			<td align="left">0.066</td>
			<td align="left">0.082</td>
			<td align="left">0.088</td>
			<td align="left">0.090</td>
			<td align="left">0.460</td>
			<td align="left">0.070</td>
			<td align="left">0.079</td>
			<td align="left">0.952</td>
			<td align="left">0.098</td>
			<td align="left">0.065</td>
		</tr>
		<tr>
			<td>G</td>
			<td align="left">2.041</td>
			<td align="left">2.108</td>
			<td align="left">1.472</td>
			<td align="left">0.665</td>
			<td align="left">0.331</td>
			<td align="left">0.194</td>
			<td align="left">0.123</td>
			<td align="left">0.094</td>
			<td align="left">0.080</td>
			<td align="left">0.072</td>
			<td align="left">0.070</td>
			<td align="left">0.072</td>
		</tr>
		<tr>
			<td>H</td>
			<td align="left">2.146</td>
			<td align="left">2.132</td>
			<td align="left">1.634</td>
			<td align="left">0.665</td>
			<td align="left">0.341</td>
			<td align="left">0.178</td>
			<td align="left">0.132</td>
			<td align="left">0.094</td>
			<td align="left">0.082</td>
			<td align="left">0.080</td>
			<td align="left">0.074</td>
			<td align="left">0.068</td>
		</tr>
		<tr>
			<td>Standards ng/&#181;l</td>
			<td align="left">1000</td>
			<td align="left">500</td>
			<td align="left">250</td>
			<td align="left">125</td>
			<td align="left">62.5</td>
			<td align="left">31.25</td>
			<td align="left">15.6</td>
			<td align="left">7.8</td>
			<td align="left">3.9</td>
			<td align="left">1.95</td>
			<td align="left">0.975</td>
			<td align="left">0</td>
		</tr>
	</tbody>
</table>

Table 2.&#160;Representative results of IgG screening by ELISA. Clone supernatants are in A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Blanks are in A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, F12.Standard curve is duplicated: G1-G12 and H1-H12. The corresponding concentration of immunoglobulins in each duplicate is shown below.Positive or IgG producing clones are shown in dark grey. Negative or non-IgG producing clones are shown in light grey

Watch this Scientific Journal Video about Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells at JoVE.com

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

generation-recombinant-human-igg-monoclonal-antibodies-from

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

18.3K Views.  Maastricht University. Synthesis of human monoclonal antibodies is the first step in studies aimed at unraveling the pathophysiological mechanisms of auto-antibody-mediated immune responses. We have developed a protocol to generate recombinant human immunoglobulin G (IgG) monoclonal antibodies from blood sorted B cells, including B-cell isolation, antibody cloning and in vitro synthesis.

Video: Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Generation of Recombinant Influenza Virus from Plasmid DNA

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally established in 1999 1,2 plasmid-based reverse genetic techniques to generate recombinant viruses have revolutionized the influenza research field because specific questions have been answered by genetically engineered, infectious, recombinant influenza viruses. Such studies include virus replication, function of viral proteins, the contribution of specific mutations in viral proteins in viral replication and/or pathogenesis and, also, viral vectors using recombinant influenza viruses expressing foreign proteins 3.

Rescue of influenza A viruses from plasmid DNA is a basic and essential experimental technique that allows influenza researchers to generate recombinant viruses to study multiple aspects in the biology of influenza virus, and to be used as potential vectors or vaccines.

Efforts by a number of influenza research groups have been pivotal in the development and improvement of influenza A virus reverse genetics. Originally ...

Recombinant Retroviral Production and Infection of B Cells

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control of a heterologous expression system to facilitate the analysis of the resulting phenotype. This approach can be used to express a gene that is not normally found in the organism, to express a mutant form of a gene product, or to over-express a dominant-negative form of the gene product. It is particularly useful in the study of the hematopoetic system, where transcriptional regulation is a major control mechanism in the development and differentiation of B cells 1, reviewed in 2-4.
Mouse genetics is a powerful tool for the study of human genes and diseases. A comparative analysis of the mouse and human genome reveals conservation of synteny in over 90% of the genome 5. Also, much of the technology used in mouse models is applicable to the study of human genes, for example, gene disruptions and allelic replacement 6. However, the creation of a transgenic mouse requires a great deal of resources of both a financial and technical nature. Several projects have begun to compile libraries of knock out mouse strains (KOMP, EUCOMM, NorCOMM) or mutagenesis induced strains (RIKEN), which require large-scale efforts and collaboration 7. Therefore, it is desirable to first study the phenotype of a desired gene in a cell culture model of primary cells before progressing to a mouse model. 
Retroviral DNA integrates into the host DNA, preferably within or near transcription units or CpG islands, resulting in stable and heritable expression of the packaged gene of interest while avoiding transcriptional silencing 8 9. The genes are then transcribed under the control of a high efficiency retroviral promoter, resulting in a high efficiency of transcription and protein production. Therefore, retroviral expression can be used with cells that are difficult to transfect, provided the cells are in an active state during mitosis. Because the structural genes of the virus are contained within the packaging cell line, the expression vectors used to clone the gene of interest contain no structural genes of the virus, which both eliminates the possibility of viral revertants and increases the safety of working with viral supernatants as no infectious virions are produced 10. 
Here we present a protocol for recombinant retroviral production and subsequent infection of splenic B cells. After isolation, the cultured splenic cells are stimulated with Th derived lymphokines and anti-CD40, which induces a burst of B cell proliferation and differentiation 11. This protocol is ideal for the study of events occurring late in B cell development and differentiation, as B cells are isolated from the spleen following initial hematopoetic events but prior to antigenic stimulation to induce plasmacytic differentiation.

An efficient system of structure and function analysis of a gene in an ex vivo culture of splenic B-lymphocytes is described. This method takes advantage of recombinant retroviral production in a helper free, ecotrophic packaging cell line. Stable, heritable expression of a gene of interest within primary lymphocytes is achieved leading to generation of surface antibodies on B cells undergoing class switch recombination.

The transgenic expression of genes in eukaryotic cells is a powerful reverse genetic approach in which a gene of interest is expressed under the control ...

A High-throughput Automated Platform for the Development of Manufacturing Cell Lines for Protein Therapeutics

The fast-growing biopharmaceutical industry demands speedy development of highly efficient and reliable production systems to meet the increasing requirement for drug supplies. The generation of production cell lines has traditionally involved manual operations that are labor-intensive, low-throughput and vulnerable to human errors. We report here an integrated high-throughput and automated platform for development of manufacturing cell lines for the production of protein therapeutics.
The combination of BD FACS Aria Cell Sorter, CloneSelect Imager and TECAN Freedom EVO liquid handling system has enabled a high-throughput and more efficient cell line development process. In this operation, production host cells are first transfected with an expression vector carrying the gene of interest 1, followed by the treatment with a selection agent. The stably-transfected cells are then stained with fluorescence-labeled anti-human IgG antibody, and are subsequently subject to flow cytometry analysis 2-4. Highly productive cells are selected based on fluorescence intensity and are isolated by single-cell sorting on a BD FACSAria. Colony formation from single-cell stage was detected microscopically and a series of time-laps digital images are taken by CloneSelect Imager for the documentation of cell line history. After single clones have formed, these clones were screened for productivity by ELISA performed on a TECAN Freedom EVO liquid handling system. Approximately 2,000 - 10,000 clones can be screened per operation cycle with the current system setup.
This integrated approach has been used to generate high producing Chinese hamster ovary (CHO) cell lines for the production of therapeutic monoclonal antibody (mAb) as well as their fusion proteins. With the aid of different types of detecting probes, the method can be used for developing other protein therapeutics or be applied to other production host systems. Comparing to the traditional manual procedure, this automated platform demonstrated advantages of significantly increased capacity, ensured clonality, traceability in cell line history with electronic documentation and much reduced opportunity in operator error.

A high-throughput, automated platform of manufacturing cell line development for producing protein therapeutics is described. Implementation of BD FACS Aria Cell Sorter, CloneSelect Imager and TECAN Freedom EVO liquid handling system has demonstrated significantly increased processing capacity in cell line development with improved cell line quality and high reproducibility.

The fast-growing biopharmaceutical industry demands speedy development of highly efficient and reliable production systems to meet the increasing ...

Medicine

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding molecules is time-consuming and laborious due to the complicated handling and lack of alternatives. The aim of this protocol is to provide one standard method for the generation of monoclonal antibodies using hybridoma technology. This technology combines two steps. Step 1 is an appropriate immunization of the animal and step 2 is the fusion of B lymphocytes with immortal myeloma cells in order to generate hybrids possessing both parental functions, such as the production of antibody molecules and immortality. The generated hybridoma cells were then recloned and diluted to obtain stable monoclonal cell cultures secreting the desired monoclonal antibody in the culture supernatant. The supernatants were tested in enzyme-linked immunosorbent assays (ELISA) for antigen specificity. After the selection of appropriate cell clones, the cells were transferred to mass cultivation in order to produce the desired antibody molecule in large amounts. The purification of the antibodies is routinely performed by affinity chromatography. After purification, the antibody molecule can be characterized and validated for the final test application. The whole process takes 8 to 12 months of development, and there is a high risk that the antibody will not work in the desired test system.

An optimized protocol is presented for the generation of monoclonal antibodies based on the hybridoma technology. Mice were immunized with an immunoconjugate. Spleen cells were fused by PEG and an electric impulse with immortal myeloma cells. Antibody-producing hybridoma cells were selected by HAT and antigen-specific ELISA screening.

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

Single-cell Screening Method for the Selection and Recovery of Antibodies with Desired Specificities from Enriched Human Memory B Cell Populations

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational methods, such as next generation sequencing (NGS), yield enormous sets of data on the antibody repertoire at the sequence level, functional data is required to identify which sequences are relevant for a particular antigen or set of antigens. Here, we describe a method to identify and recover individual antigen-specific antibodies from peripheral blood mononuclear cells (PBMCs) from a human blood donor. This method utilizes an initial enrichment of mature B cells and requires a combination of phenotypic cell markers and fluorescently-labeled protein to isolate IgG memory B cells via flow cytometry. The heavy and light chain variable regions are then cloned and re-screened. Although limited to the memory B cell compartment, this method takes advantage of flow cytometry to interrogate millions of B cells and returns paired heavy and light chain sequences from a single cell in a format ready for expression and confirmation of specificity. Antibodies recovered with this method can be considered for therapeutic potential, but can also link specificity and function with bioinformatic approaches to assess the B cell repertoire within individuals.

The BSelex method to identify and recover individual antigen-specific antibodies from human peripheral blood mononuclear cells combines flow cytometry with single cell PCR and cloning.

The human antibody repertoire represents a largely untapped source of potential therapeutic antibodies and useful biomarkers. While current computational ...

Antibody Generation: Producing Monoclonal Antibodies Using Hybridomas

Source: Frances V. Sjaastad1,2, Whitney Swanson2,3, and Thomas S. Griffith1,2,3,4 
1 Microbiology, Immunology, and Cancer Biology Graduate Program, University of Minnesota, Minneapolis, MN 55455 
2 Center for Immunology, University of Minnesota, Minneapolis, MN 55455 
3 Department of Urology, University of Minnesota, Minneapolis, MN 55455 
4 Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455
Polyclonal antibodies are defined as a collection of antibodies directed against different antigenic determinants of an antigen or several antigens (1). While polyclonal antibodies are powerful tools for identifying biological molecules, there is one important limitation - they are unable to distinguish between antigens that share antigenic determinants. For example, when bovine serum albumin is used to immunize an animal, B cells with different surface Ig will respond to different antigenic determinants on bovine serum albumin. The result is a mixture of antibodies in the antiserum. Because bovine serum albumin shares some epitopes with human serum albumin in evolutionarily conserved regions of the protein, this anti-bovine serum albumin antiserum will also react with human serum albumin. Therefore, this antiserum will not be useful for distinguishing between bovine and human serum albumins.
Several approaches have been taken to overcome the specificity issue of polyclonal antisera. One is by absorbing the unwanted antibodies by passing the antiserum through a chromatography column of immobilized antigens (2). This method is tedious and frequently unable to completely remove the unwanted antibodies. Another approach is to isolate individual antibody-producing B cells and expand them in culture. However, like most normal untransformed cells, B cells do not survive in long-term culture.
To overcome the inability of B cells to survive in culture, one approach is to prepare a myeloma-B cell hybridoma. In 1847, Henry Bence-Jones discovered that patients with multiple myeloma, a lymphoid tumor, produced a large quantity of antibodies (3). B cells in these patients have become malignant and grow uncontrollably. Since the malignant B cells are derived from a single clone, they are identical and produce only a single type of antibody (i.e., a monoclonal antibody, or mAb). However, most of these myeloma cells produce antibodies of unknown specificities. In 1975, by fusing a myeloma cell to a B cell, Cesar Milstein and Georges Kohler succeeded in producing a hybridoma that can be cultured indefinitely in vitro and produces an unlimited number of monoclonal antibodies of known antigenic specificity (4). The rationale behind their approach is to combine the immortal properties of the myeloma cell and the antibody producing properties of the B cell. Their technique revolutionized antibody production and provides a powerful means for identification and purification of biological molecules using monoclonal antibodies.
Generally, preparing a monoclonal antibody requires several months. The general procedure includes the following steps:
<ol>
	<li>Immunization and screening of antibody titer</li>
	<li>Fusion of antibody-producing B cells and myeloma cells</li>
	<li>Selective growth of the hybridoma</li>
	<li>Screening the hybridomas for producing the desired monoclonal antibody</li>
	<li>Cloning by limiting dilution - a process whereby cells are diluted to a concentration to statistically allow for less than 1 cell to be added to the wells of a 96-well plate. Some wells will end up with 0 cells and some will have 1 cell. The wells with seeded with 1 cell will eventually grow into a monoclonal population of cells.</li>
	<li>Growth of the hybridoma and preparation of monoclonal antibody</li>
</ol>
This protocol focuses on the last step - growth of the hybridoma and preparation of the monoclonal antibody. The antibody is purified from the culture supernatant by ammonium sulfate precipitation (often referred to as salting out) - a commonly used method of removing proteins from a solution. Proteins in solution form hydrogen bonds, along with other hydrophilic interactions, with water through their exposed polar and ionic groups. When concentrations of small, highly charged ions (such as ammonium or sulfate) are added, these groups compete with the proteins for binding to water. This removes the water molecules from the protein and decreases its solubility, resulting in precipitation of the protein.

Producing Monoclonal Antibodies Using Hybridomas

Source: Frances V. Sjaastad1,2, Whitney Swanson2,3, and Thomas S. Griffith1,2,3,4
1 Microbiology, Immunology, and Cancer Biology Graduate Program, ...

Education

JoVE Science Education

Advanced Biology

Immunology

Generating Recombinant Monoclonal Antibodies From Mammalian Cell Cultures

Source: Nogales-Gadea, G. et al., <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/52830">Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells.</a>&#160;J. Vis. Exp.&#160;(2015)
This video demonstrates a method of antibody generation from mammalian cells by introducing plasmid vectors with heavy and light chain genes. These vectors interact with polyethylenimine and enter the cells by forming polyplexes; later, they are translated into individual proteins and assembled into complete antibodies, which are secreted into the extracellular medium.

All procedures involving sample collection have been performed in accordance with the institute&#39;s IRB guidelines.
1. Isolation of Peripheral Blood ...

JoVE Encyclopedia of Experiments

Antibody-Based Technologies

Production and Purification

A Technique to Generate Monoclonal Antibodies from Antigen-Specific B Cells

Source: Devilder, M., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/56508">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood.</a> J. Vis. Exp. (2018).
The video demonstrates a technique for generating monoclonal antibodies from antigen-specific B cells. Eukaryotic expression vectors encoding the heavy and light chains of antibodies, cloned from isolated antigen-specific B cells, are introduced into mammalian cells using polyplexes. Once inside the cells, these vectors undergo translation, and the resulting heavy and light chain peptides assemble into antibodies, which are subsequently secreted by the cells.

1. Production of mAbs

	The day before the transfection, seed 15,000 Human embryonic kidney 293A (HEK 293A) cells in 200 &#181;L of Dulbecco&#39;s ...

Hybridoma Technology

Hybridoma technology is used for the large-scale production of monoclonal antibodies. Monoclonal antibodies bind to only a single antigenic determinant or epitope. Such antibodies are used in research, diagnostics, and disease therapy. The hybridoma technology established in 1975 by Georges K&#246;hler and Cesar Milstein was awarded the Nobel Prize in Medicine in 1984 for revolutionizing research and therapy.
Hybridoma Selection
Commonly used fusion techniques &#8212; electroporation, polyethylene glycol (PEG) mediated fusion, and the use of fusogenic viruses &#8212; generally produce hybridomas at a very low frequency. Fusion products thus have a high ratio of self-fused B-cells and myeloma cells, or unfused cells, with a low number of hybrid cells.
The hypoxanthine-aminopterin-thymidine (HAT) medium is used to select hybridomas by selectively allowing their growth. The aminopterin blocks the default nucleotide synthesis in cells. However, cells can utilize hypoxanthine and thymidine from the medium to synthesize nucleotides via the salvage pathway.
Myeloma cells deficient in the HGPRT enzyme cannot synthesize nucleotides via this pathway and thus, do not grow in HAT medium. Although B-cells produce functional HGPRT enzymes, they cannot divide indefinitely. Thus, only the hybrid cells with functional HGPT from the B-cells and immortality from the myeloma line can grow on the HAT selection medium. Such a culture of hybrid cells is called a hybridoma, which can be screened for monoclonal antibody production.
Hybridoma Screening
Hybridoma cultures from the HAT selection are plated onto a 96-well plate; each well containing only one cell. Using Enzyme-linked Immunosorbent Assay (ELISA), each cell is screened for the production of antibodies specific to the epitope of interest. Cells that test positive are then selected and grown in a larger culture vessel to establish hybridoma cell lines. These cell lines are a permanent source of unlimited monoclonal antibodies. Thus hybridoma technology is a convenient and cost-effective method for mass production of monoclonal antibodies.

Hybridoma technology is used for the large-scale production of monoclonal antibodies. Monoclonal antibodies bind to only a single antigenic determinant or ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video