The authors acknowledge the Robert W. Deutsch Foundation, the Defense Threat Reduction Agency (DTRA), and the National Science Foundation Emerging Frontiers in Research and Innovation (EFRI) for financial support. The authors also thank the Maryland Nanocenter and its Fablab for cleanroom facility support.

1. Microfabrication of the Microfluidic Chip
<ol>
	<li>Prepare Electrochemical Chip
	<ol>
		<li>Pattern Gold Electrodes
		<ol>
			<li>Rinse a blank 4&#8217;&#8217; silicon wafer (prime grade quality) with acetone, methanol, and isopropanol (&#8220;AMI&#8221; clean). Rinse the isopropanol from the wafer with deionized water (DI) followed by drying with N2 gun.</li>
			<li>Grow a 1 &#181;m thick SiO2 passivation layer with plasma-enhanced chemical vapor deposition (PECVD) tool. Deposit a 200 &#197; thick layer of chromium followed by a 2,000 &#197; thick layer of gold with a DC sputtering tool.</li>
			<li>Spin &#8220;PR1&#8221; positive photoresist (spinning parameters: 3,000 rpm, 1,000 rpm/sec, 30 sec) to create uniform film ~1.6 &#181;m thick. Pre-bake the wafer for 1 min at 100 &#176;C on a hot plate.</li>
			<li>Expose the wafer with 190 mJ/cm2 at 405 nm wavelength through a photomask. Develop the wafer for 30 sec in 352 developer and rinse the wafer with DI and dry with N2 gun.</li>
			<li>Etch the gold with gold etchant for 1.5 min. Etch the chromium with chromium etchant for ~30 sec. Rinse the wafer with DI and dry with N2 gun.</li>
			<li>Strip the photoresist with &#8220;AMI&#8221; clean procedure. 
			NOTE: STRONG OXIDIZER AND POTENTIALLY EXPLOSIVE.</li>
			<li>Clean the wafer with 4:1 H2SO4:H2O2 mixture (&#8220;Piranha&#8221; clean) for 1 min. Rinse the wafer with DI and dry with N2 gun.</li>
		</ol>
		</li>
		<li>Pattern Platinum Electrodes
		<ol>
			<li>Spin &#8220;PR2&#8221; positive photoresist (spinning parameters: 3,000 rpm, 1,000 rpm/sec, 30 sec) to create uniform film ~1.4 &#181;m thick. Pre-bake the wafer for 1 min at 100 &#176;C on a hot plate.</li>
			<li>Expose the wafer with 30 mJ/cm2 at 405 nm wavelength through a photomask. Bake the wafer for 45 sec at 125 &#176;C on a hot plate. Flood expose the wafer with 1,000 mJ/cm2 at 405 nm wavelength without a photomask. Develop the wafer for 2 min in 6:1 AZ400K developer and rinse the wafer with DI and dry with N2 gun.</li>
			<li>Deposit a 400 &#197; thick layer of titanium followed by a 1,600 &#197; thick layer of platinum using an E-beam evaporation system.</li>
			<li>Lift off photoresist in an ultrasonicated acetone bath for 5 min followed by rinse with acetone and isopropanol. Rinse the wafer with DI and dry with N2 gun.</li>
		</ol>
		</li>
	</ol>
	</li>
	<li>Prepare Assay Channels
	<ol>
		<li>Prepare Mold for Assay Channels
		<ol>
			<li>Rinse a blank 4&#8217;&#8217; silicon wafer (test grade quality) with &#8220;AMI&#8221; clean procedure. Rinse the isopropanol from the wafer with DI followed by drying with N2 gun.</li>
			<li>Spin &#8220;PR3&#8221; negative photoresist (2-step spinning parameters: step one - 600 rpm, 120 rpm/sec, 10 sec. Step two &#8211; 1,150 rpm, 383 rpm/sec, 27 sec) to create uniform film ~100 &#181;m thick. Pre-bake the wafer on a hot plate (2-step baking parameters: step one &#8211; ramp up from room temperature to 65 &#176;C at 300 &#176;C/hr and hold temperature for 10 min. Step 2 &#8211; ramp up to 95 &#176;C at 300 &#176;C/hr and hold temperature for 30 min).</li>
			<li>Expose the wafer with 2,500 mJ/cm2 at 405 nm wavelength through a photomask. Post-bake the wafer by ramping up to 95 &#176;C at 300 &#176;C/hr and hold temperature for 10 min on a hot plate. Develop the wafer for 10 min in Propylene Glycol Monomethyl Ether Acetate (PGMEA) developer. Rinse the wafer with isopropanol and dry with N2 gun.</li>
		</ol>
		</li>
		<li>Fabricate Assay Channels
		<ol>
			<li>Prepare 10:1 polydimethylsiloxane (PDMS) mixture (20 g of elastomer, 2 g of curing agent) and completely degas in a vacuum chamber for 20 min.</li>
			<li>Define an enclosure around the mold wafer with aluminum foil and slowly pour the uncured PDMS over the mold.</li>
			<li>Bake the mold with the PDMS in a box furnace (2-step baking parameters: step one &#8211; 5 min ramp up from room temperature to 80 &#176;C. Step 2 &#8211; hold at 80 &#176;C for 17 min).</li>
			<li>Peel away the PDMS from the mold and place on aluminum foil. Cut the assay chips with a surgeon knife, define holes with a biopsy punching tool.</li>
		</ol>
		</li>
	</ol>
	</li>
</ol>
2. Assemble the Device
<ol>
	<li>Manually align the PDMS assay channels with the working electrodes on the electrochemical chip. PDMS sticks well to the electrochemical chip, sealing the channels and preventing leakage.</li>
	<li>Connect a flexible tubing (OD 0.087&#8217;&#8217; and ID 0.015&#8217;&#8217;) to a plastic elbow or straight connector using a short flexible tube as an adapter (OD 0.1875&#8217;&#8217; and ID 0.0625&#8217;&#8217;). Attach connectors to each of the hole-punched inlets in the device.</li>
	<li>Connect a syringe on the other end of the tubing and place the syringe in a syringe pump. Alternately change the set of a syringe, a tube, and a connector according to the required procedure step in section 3 and its corresponding solution.</li>
</ol>
3. Analyze DNA Hybridization
NOTE: Introduce each solution slowly into the channel at a flow rate of 200 &#181;l/hr until the whole channel is filled.
<ol>
	<li>Functionalize each vertical microchannel with a different ssDNA probe sequence (perform in parallel to the 3 separate vertical microchannels):
	<ol>
		<li>Fill each microchannel with a different ssDNA probe incubation solution (10 mM phosphate buffer, 100 mM NaCl, 10 &#181;M tris(2-carboxyethyl)phosphine (TCEP), and 1 &#181;M probe ssDNA), and incubate for 1 hr followed by rinsing the microchannel with PBS.</li>
		<li>Fill the microchannel with a solution containing 1 mM of 6-mercapto-1-hexanol (MCH) in a buffer of 10 mM PBS, 100 mM NaCl and 1.395 mM TCEP, and incubate for 1 hr followed by rinsing the microchannel with PBS.</li>
	</ol>
	</li>
	<li>Lift off the PDMS, rotate 90&#176; to a horizontal orientation, and place down to expose separate rows of reaction chambers with each row containing a unique counter and reference electrode (Figure S1).</li>
	<li>Fill the microchannels with control measurement solution of 4x concentrated saline-sodium citrate (SSC) buffer, and incubate for 20 min.</li>
	<li>Background measurement: Fill the microchannels with 5 mM ferricyanide / 5 mM ferrocyanide in PBS solution and record the impedance values of the electrochemical system for different frequencies (electrochemical impedance spectroscopy; EIS) using a potentiostat connected to the working, counter, and reference electrodes (EIS parameters: frequency range from 1 MHz to 0.1 Hz, 10 frequency data points per decade, 25 mV amplitude, 5 mV polarization versus the reference electrode). Repeat this measurement for each working electrode in the microchannels.</li>
	<li>Measure DNA hybridization (perform for each non-complementary and complementary ssDNA target).
	<ol>
		<li>Fill the microchannels with target ssDNA measurement solution of 4x concentrated SSC buffer containing 1 &#181;M of the target ssDNA, and incubate for 20 min. Measure the DNA according to step 3.4.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Hong, J., Edel, J. B., deMello, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Micro-+and+nanofluidic+systems+for+high-throughput+biological+screening.">Micro- and nanofluidic systems for high-throughput biological screening.</a> Drug Discov. Today. 14, 134-146 (2009).</li><li>Sun, Y., Kwok, Y. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polymeric+microfluidic+system+for+DNA+analysis.">Polymeric microfluidic system for DNA analysis.</a> Anal. Chim. Acta. 556, 80-96 (2006).</li><li>Xu, Y., Yang, X., Wang, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Review:+aptamers+in+microfluidic+chips.">Review: aptamers in microfluidic chips.</a> Anal. Chim. Acta. 683, 12-20 (2010).</li><li>Yang, W., Woolley, A. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+multiprocess+microfluidic+systems+for+automating+analysis.">Integrated multiprocess microfluidic systems for automating analysis.</a> J. Lab. Automat. 15, 198-209 (2010).</li><li>Gervais, T., Jensen, K. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mass+transport+and+surface+reactions+in+micro&#64258;uidic+systems.">Mass transport and surface reactions in micro&#64258;uidic systems.</a> Chem. Eng. Sci. 61, 1102-1121 (2006).</li><li>Song, H., Ismagilov, R. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Millisecond+kinetics+on+a+microfluidic+chip+using+nanoliters+of+reagents.">Millisecond kinetics on a microfluidic chip using nanoliters of reagents.</a> J. Am. Chem. Soc. 125, 14613-14619 (2003).</li><li>Jiang, H., Weng, X. A., Li, D. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+whole-blood+immunoassays.">Microfluidic whole-blood immunoassays.</a> Microfluid. Nanofluid. 10, 941-964 (2011).</li><li>Dutse, S. W., Yusof, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidics-based+lab-on-chip+systems+in+DNA-based+biosensing:+an+overview.">Microfluidics-based lab-on-chip systems in DNA-based biosensing: an overview.</a> Sensors. 11, 5754-5768 (2011).</li><li>Dittrich, P. S., Manz, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lab-on-a-chip:+microfluidics+in+drug+discovery.">Lab-on-a-chip: microfluidics in drug discovery.</a> Nat. Rev. Drug Discov. 5, 210-218 (2006).</li><li>Craighead, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Future+lab-on-a-chip+technologies+for+interrogating+individual+molecules.">Future lab-on-a-chip technologies for interrogating individual molecules.</a> Nature. 442, 387-393 (2006).</li><li>Hunt, H. K., Armani, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+biological+and+chemical+sensors.">Label-free biological and chemical sensors.</a> Nanoscale. 2, 1544-1559 (2010).</li><li>Dukkipati, V. R., Pang, S. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrated+microfluidic+system+for+DNA+analysis.">Integrated microfluidic system for DNA analysis.</a> IEEE-NANO 2006. Sixth IEEE Conference on Nanotechnology. 1, 162-165 (2006).</li><li>Fang, T. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Real-time+PCR+microfluidic+devices+with+concurrent+electrochemical+detection.">Real-time PCR microfluidic devices with concurrent electrochemical detection.</a> Biosens. Bioelectron. 24, 2131-2136 (2009).</li><li>Pavlovic, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+device+architecture+for+electrochemical+patterning+and+detection+of+multiple+DNA+sequences.">Microfluidic device architecture for electrochemical patterning and detection of multiple DNA sequences.</a> Langmuir. 24, 1102-1107 (2008).</li><li>Xu, X., Zhang, S., Chen, H., Kong, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integration+of+electrochemistry+in+micro-total+analysis+systems+for+biochemical+assays:+recent+developments.">Integration of electrochemistry in micro-total analysis systems for biochemical assays: recent developments.</a> Talanta. 80, 8-18 (2009).</li><li>Cai, H., Lee, T. M. -. H., Hsing, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Label-free+protein+recognition+using+an+aptamer-based+impedance+measurement+assay.">Label-free protein recognition using an aptamer-based impedance measurement assay.</a> Sensor. Actuat. B-Chem. 114, 433-437 (2006).</li><li>Iliescu, C., Poenar, D. P., Carp, M., Loe, F. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic+device+for+impedance+spectroscopy+analysis+of+biological+samples.">A Microfluidic device for impedance spectroscopy analysis of biological samples.</a> Sensor. Actuat. B-Chem. 123, 168-176 (2007).</li><li>Prakash, S. B., Abshire, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Tracking+cancer+cell+proliferation+on+a+CMOS+capacitance+sensor+chip.">Tracking cancer cell proliferation on a CMOS capacitance sensor chip.</a> Biosens. Bioelectron. 23, 1449-1457 (2008).</li><li>Yamaguchi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+fabrication+of+electrochemical+enzyme+sensor+chip+using+polydimethylsiloxane+microfluidic+channel.">Rapid fabrication of electrochemical enzyme sensor chip using polydimethylsiloxane microfluidic channel.</a> Anal. Chim. Acta. 468, 143-152 (2002).</li><li>Beebe, D. J., Mensing, G. A., Walker, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physics+and+applications+of+microfluidics+in+biology.">Physics and applications of microfluidics in biology.</a> Annu. Rev. Biomed. Eng. 4, 261-286 (2002).</li><li>Mariella, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sample+preparation:+the+weak+link+in+microfluidics-based+biodetection.">Sample preparation: the weak link in microfluidics-based biodetection.</a> Biomed. Microdevices. 10, 777-784 (2008).</li><li>Bhushan, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Springer handbook of nanotechnology. , (2010).</li><li>Ghallab, Y. H., Badawy, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Lab-on-a-chip: Techniques, circuits, and biomedical applications. , (2010).</li><li>Chee, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Accessing+genetic+information+with+high-density+DNA+arrays.">Accessing genetic information with high-density DNA arrays.</a> Science. 25, 610-614 (1996).</li><li>Ma, K. -. S., Zhou, H., Zoval, J., Madou, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+hybridization+detection+by+label+free+versus+impedance+amplifying+label+with+impedance+spectroscopy.">DNA hybridization detection by label free versus impedance amplifying label with impedance spectroscopy.</a> Sensor. Actuat. B-Chem. 114, 58-64 (2006).</li><li>Ito, T., Hosokawa, K., Maeda, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+single-base+mismatch+at+distal+end+of+DNA+duplex+by+electrochemical+impedance+spectroscopy.">Detection of single-base mismatch at distal end of DNA duplex by electrochemical impedance spectroscopy.</a> Biosens. Bioelectron. 22, 1816-1819 (2007).</li><li>Kao, L. T. -. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiplexed+detection+and+differentiation+of+the+DNA+strains+for+influenza+A+(H1N1+2009)+using+a+silicon-based+microfluidic+system.">Multiplexed detection and differentiation of the DNA strains for influenza A (H1N1 2009) using a silicon-based microfluidic system.</a> Biosens. Bioelectron. 26, 2006-2011 (2011).</li><li>Li, J., Chen, S., Evans, D. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Typing+and+subtyping+influenza+virus+using+DNA+microarrays+and+multiplex+reverse+transcriptase+PCR.">Typing and subtyping influenza virus using DNA microarrays and multiplex reverse transcriptase PCR.</a> J. Clin. Microbiol. 39, 696-704 (2001).</li><li>Gautier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Hybridization-induced+interfacial+changes+detected+by+non-faradaic+impedimetric+measurements+compared+to+faradaic+approach.">Hybridization-induced interfacial changes detected by non-faradaic impedimetric measurements compared to faradaic approach.</a> J. Electroanal. Chem. 610, 227-233 (2007).</li><li>Ma, Y., Jiao, K., Yang, T., Sun, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sensitive+PAT+gene+sequence+detection+by+nano-SiO2/p-aminothiophenol+self-assembled+films+DNA+electrochemical+biosensor+based+on+impedance+measurement.">Sensitive PAT gene sequence detection by nano-SiO2/p-aminothiophenol self-assembled films DNA electrochemical biosensor based on impedance measurement.</a> Sensor. Actuat. B-Chem. 131, 565-571 (2008).</li><li>Kim, J. H. -. S., Marafie, A., Jia, X. -. Y., Zoval, J. V., Madou, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Characterization+of+DNA+hybridization+kinetics+in+a+microfluidic+flow+channel.">Characterization of DNA hybridization kinetics in a microfluidic flow channel.</a> Sensor. Actuat. B-Chem. 113, 281-289 (2006).</li><li>Dykstra, P. H., Roy, V., Byrd, C., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microfluidic+electrochemical+sensor+array+for+characterizing+protein+interactions+with+various+functionalized+surfaces.">Microfluidic electrochemical sensor array for characterizing protein interactions with various functionalized surfaces.</a> Anal. Chem. 83, 5920-5927 (2011).</li><li>Ben-Yoav, H., Dykstra, P. H., Bentley, W. E., Ghodssi, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Microfluidic-based+electrochemical+biochip+for+label-free+diffusion-restricted+DNA+hybridization+analysis.">A Microfluidic-based electrochemical biochip for label-free diffusion-restricted DNA hybridization analysis.</a> Biosens. Bioelectron. 38, 114-120 (2012).</li><li>Wink, T., van Zuilen, S. J., Bult, A., van Bennekom, W. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Self-assembled+monolayers+for+biosensors.">Self-assembled monolayers for biosensors.</a> Analyst. 122, 43R-50R (1997).</li><li>McEwen, G. D., Chen, F., Zhou, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immobilization,+hybridization,+and+oxidation+of+synthetic+DNA+on+gold+surface:+Electron+transfer+investigated+by+electrochemistry+and+scanning+tunneling+microscopy.">Immobilization, hybridization, and oxidation of synthetic DNA on gold surface: Electron transfer investigated by electrochemistry and scanning tunneling microscopy.</a> Anal. Chim. Acta. 643, 26-37 (2009).</li><li>Arinaga, K., Rant, U., Tornow, M., Fujita, S., Abstreiter, G., Yokoyama, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+role+of+surface+charging+during+the+coadsorption+of+mercaptohexanol+to+DNA+layers+on+gold:+Direct+observation+of+desorption+and+layer+reorientation.">The role of surface charging during the coadsorption of mercaptohexanol to DNA layers on gold: Direct observation of desorption and layer reorientation.</a> Langmuir. 22, 5560-5562 (2006).</li><li>Katz, E., Willner, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Probing+biomolecular+interactions+at+conductive+and+semiconductive+surfaces+by+impedance+spectroscopy:+Routes+to+impedimetric+immunosensors,+DNA-sensors,+and+enzyme+biosensors.">Probing biomolecular interactions at conductive and semiconductive surfaces by impedance spectroscopy: Routes to impedimetric immunosensors, DNA-sensors, and enzyme biosensors.</a> Electroanalysis. 15, 913-947 (2003).</li></ol>

The authors have nothing to disclose.

Our procedures demonstrate the manufacturing of a microfluidic-based electrochemical biochip and its utilization for DNA hybridization events analysis. Through a high yield controlled microfabrication process we develop a device comprised of microscale channels integrated with an array of electrochemical transducers. We have devised controlled processing parameters for the photolithography procedure of the electrochemical chip and the microfluidic channel mold through an iterative approach. These steps provide guidelines for future creation of other miniaturized analytical devices. Importantly, they provide a method to optimize various biosensing parameters such as signal-to-noise ratio, stability, and sensitivity. Following device fabrication, we functionalize the electrochemical transducers with ssDNA probe as a bioreceptor, providing a unique analytical purpose. Although these procedures demonstrate low device failure rate, solution leakage shows to be a major issue following assembly of the device and during the performance of the DNA hybridization assay. Further investigation of bonding failure in such devices would improve the yield of the process and make it ideal for micro-bio-systems study.
In our studies, we show the ability of the biochip to accurately and specifically sense DNA hybridization events. As part of design parameters for a new analytical micro-device, one should take into consideration the manufacturing of the device, which demands an iterative approach to optimize fabrication parameters (e.g., photolithography parameters, microchannel dimensions, type of the deposited metal). In order to efficiently detect DNA hybridization events, ssDNA probe assembly and hybridization conditions have to be optimized as well (e.g., incubation time, buffer concentration, probe concentration, prevention of non-specific adsorption).
The ability to quickly screen for particular DNA sequences is very beneficial in the fields of cancer research, influenza detection and genetic engineering. Most arrayed detection methods utilize a label to produce the signal and use multiple washing and incubation steps. Utilizing the proposed microfluidic devices, DNA hybridization will be performed with high number of DNA sequences in the same device without the need for labels of any kind. We envision near-term applications integrating more sophisticated capabilities to the biochip to improve its performance and modularity. For example, valve-based microfluidics has the potential to provide the biochip with automatic and controlled analysis abilities. Another example is functionalizing the device with other bioreceptors, providing unique sensing properties that can be used in a wider range of applications.

Microfluidic lab-on-a-chip (LOC) devices provide numerous advantages in clinical diagnostics, environmental monitoring and biomedical research. These devices utilize microfluidic channels to control fluid flow to regions of the chip where a variety of procedures can take place including reagent mixing, affinity based binding, signal transduction, and cell culturing1-4. Microfluidics provides many advantages over conventional clinical diagnostic tools such as microwell plate readers or electrophoretic gel shift assays. Microfluidic devices require 2 to 3 orders of magnitude (nanoliters as opposed to microliters) fewer reagents to perform similar assays. Also, these devices can increase the speed by which some biological events occur due to the smaller confinement of the species within the channels5,6. Thirdly, sensors can be integrated within microfluidic devices using lithography and etching techniques, which can provide label-free detection. Lastly, these devices are inexpensive to produce and require little work on the part of the technician to operate7-10.
Label-free detection typically is performed using an optical or electrical transducer. Optical devices can present better sensing performance due to lower interference with analytes in the sample. Nevertheless, their performance is compromised in cases where the sample&#8217;s background has the same resonating wavelength as the sensor11. There are many advantages to using electrical signals to perform biological and chemical detection in microfluidic systems. The fabrication is inherently less complicated since these sensors typically only require patterned electrodes to operate. In addition, electrical signals can be directly interfaced with most measurement equipment while other signal modalities may require a transducer to convert the signal12-15. Electrical sensors commonly measure changes in impedance16,17, capacitance18, or redox activity19. However, new challenges are presented as these systems are miniaturized. The most important challenges to overcome include: sample preparation and mixing of fluids (due to the low sample volume and Reynolds number), physical and chemical effects (including capillary forces, surface roughness, chemical interactions between construction materials and analytes), low signal-to-noise ratio (produced by the reduced surface area and volume)20-23, and potential interference from electro-active analytes in complex biological samples (e.g., blood and saliva). Further investigation of these effects will result in guidelines for an accurate fabrication and operation of these devices in a reproducible manner that would improve upon their overall performance.
DNA hybridization detection is used extensively to diagnose genetic disorders24,25 and various forms of cancer26. Every year, multiple strains of influenza are identified in patients using results from DNA hybridization techniques27. The influenza virus alone accounts for 36,000 deaths each year in the United States28. Such examples could benefit from a bench-top microfluidic device that can perform the same assay techniques as a plate reader or gel shift assay with low sample volume and at a fraction of the cost without sacrificing sensitivity or specificity. Due to the many advantages of label-free electrochemical sensing, it has been used extensively for detection of DNA hybridization events29,30. A setup where macro-scale electrodes (in the millimeter range) are dipped in beakers with the solution of interest can be used to provide very sensitive data regarding the binding kinetics of single stranded DNA sequences to their matching complementary sequences. Recently, there have been a few advances in incorporating electrochemical sensing in microfluidics for DNA hybridization. Studies have been performed regarding hybridization kinetics31 and integration of sensors for detection15 in microfluidic channels. However, there still exists a need for a rapid high throughput microfluidic device that can analyze DNA hybridization events in parallel without complicated sample preparation steps.
The device presented in this work provides a platform that allows for multiple interactions to be screened in parallel and without complicated sample preparation steps. Our protocol presents how microfluidic-based electrochemical biochips are microfabricated with micro-electromechanical systems (MEMS) technology32,33. We describe the fabrication process of both the microfluidic chip, made of polydimethylsiloxane (PDMS), and the electrochemical chip, comprised of an array of electrodes. The chemical functionalization of the biochip with ssDNA probes is also addressed. Finally, the ability of the biosensor to specifically detect and analyze ssDNA targets is demonstrated. Overall, the microfluidic-based electrochemical biochip is a rapid and high-throughput analysis technique. It can be used to investigate interactions between biological molecules and conducting transducers, and can be utilized in a variety of lab-on-a-chip applications.

<table><tbody><tr><td>4&#039;&#039; Silicon wafer</td><td>Ultrasil</td><td>4-5664</td><td>Single side polished; P-type; Boron doped; Orientation 1-0-0; Thickness 500 micron; Resistance 10-20 ohm&amp;middot;cm</td></tr><tr><td>Shipley 1813 photoresist (&quot;PR1&quot;)</td><td>Microchem</td><td></td><td>positive photoresist</td></tr><tr><td>AZ5214 photoresist (&quot;PR2&quot;)</td><td>Hoechst Celanse</td><td></td><td>positive photoresist</td></tr><tr><td>SU-8 50 photoresist (&quot;PR3&quot;)</td><td>Microchem</td><td></td><td>negative photoresist</td></tr><tr><td>Gold etchant</td><td>Transene</td><td>TFA</td><td>No dilution</td></tr><tr><td>Chromium etchant</td><td>Transene</td><td>1020AC</td><td>No dilution</td></tr><tr><td>PDMS elastomer</td><td>Dow Corning</td><td>3097366 1004</td><td></td></tr><tr><td>PDMS curing agent</td><td>Dow Corning</td><td>3097358 1004</td><td></td></tr><tr><td>Biopsy punching tool</td><td>Healthlink</td><td>BP20</td><td></td></tr><tr><td>Tygon flexible tubing</td><td>Cole Parmer&amp;nbsp;</td><td>R 3603</td><td>0.015&quot;</td></tr><tr><td>Tygon flexible adapter</td><td>Cole Parmer&amp;nbsp;</td><td>06417-41</td><td>0.0625&quot;</td></tr><tr><td>1 ml syringe</td><td>Beckton-Dickenson</td><td>301025</td><td></td></tr><tr><td>Monobasic potassium phosphate</td><td>Fluka</td><td>1551139</td><td></td></tr><tr><td>Potassium phosphate dibasic anhydrous</td><td>Sigma</td><td>RES20765-A7</td><td></td></tr><tr><td>Sodium chloride</td><td>Sigma-Aldrich</td><td>S7653</td><td></td></tr><tr><td>tris(2-carboxyethyl)phosphine</td><td>Aldrich</td><td>C4706</td><td></td></tr><tr><td>6-mercapto-1-hexanol</td><td>Aldrich</td><td>451088</td><td></td></tr><tr><td>20x concentrated saline-sodium citrate buffer</td><td>Sigma</td><td>93017</td><td></td></tr><tr><td>Potassium hexacyanoferrate(III)</td><td>Aldrich</td><td>455946</td><td></td></tr><tr><td>Complementary ssDNA #1</td><td>Integrated DNA Technologies (IDT)</td><td>100 nmole DNA oligo</td><td>5&amp;rsquo;-GGGACGTCCACGGAGCGCTA&lt;br/&gt; TCGGAGCTTT-3&amp;rsquo;</td></tr><tr><td>Target ssDNA #2</td><td>Integrated DNA Technologies (IDT)</td><td>100 nmole DNA oligo</td><td>5&amp;rsquo;-/5ThioMC6-D/ACGCGTCAGGTCATTGACGA&lt;br/&gt; ATCGATGAGT-3&amp;rsquo;</td></tr><tr><td>Complementary ssDNA #2</td><td>Integrated DNA Technologies (IDT)</td><td>100 nmole DNA oligo</td><td>5&amp;rsquo;-ACTCATCGATTCGTCAATGA&lt;br/&gt; CCTGACCCGT-3&amp;rsquo;</td></tr><tr><td>Target ssDNA #3</td><td>Integrated DNA Technologies (IDT)</td><td>100 nmole DNA oligo</td><td>5&amp;rsquo;-/5ThioMC6-D/ACCTAGATCCAGTAGTTAGA&lt;br/&gt; CCCATGATGA-3&amp;rsquo;</td></tr><tr><td>Complementary ssDNA #3</td><td>Integrated DNA Technologies (IDT)</td><td>100 nmole DNA oligo</td><td>5&amp;rsquo;-TCATCATGGGTCTAACTACT&lt;br/&gt; GGATCTAGGT-3&amp;rsquo;</td></tr><tr><td colspan="4">&lt;strong&gt;Instrument&lt;/strong&gt;</td></tr><tr><td>Plasma Enhanced Chemical Vapor Deposition (PECVD)</td><td>Oxford Instruments</td><td>PlasmaLab System 100</td><td>Chamber pressure 1,000 mTorr, Tempreture 200 &amp;#176;C, RF power 20 W, Gasses: a) N&lt;sub&gt;2&lt;/sub&gt;O flow rate 710 sccm; b) a composition of 5% SiH&lt;sub&gt;4&lt;/sub&gt; and 95% N&lt;sub&gt;2&lt;/sub&gt; gasses flow rate 170 sccm, SiO&lt;sub&gt;2&lt;/sub&gt; growth rate 690 &amp;#197;/min.</td></tr><tr><td>DC sputtering unit</td><td>AJA International</td><td>ATC 1800-V</td><td>For Chrome: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 10 nm/min. For Gold: Chamber pressure 10 mTorr, Argon flow rate 20 sccm, Supplied DC power 200 W, Sputter rate 36 nm/min.</td></tr><tr><td>E-beam evaporation system</td><td>Denton</td><td>Custom-built</td><td>For Titanium: Chamber pressure &amp;lt; 2 x 10&lt;sup&gt;-6&lt;/sup&gt; Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 6-10 &amp;#197;/sec. For Platinum: Chamber pressure &amp;lt; 2 x 10&lt;sup&gt;-6&lt;/sup&gt; Torr, Supplied power to the e-gun 7.5 kW, Filament current 150-200 mA, Evaporation rate 2-3 &amp;#197;/sec.</td></tr><tr><td>Potentiostat</td><td>CH Instruments</td><td>660D</td><td></td></tr><tr><td>Syringe pump</td><td>KD Scientific</td><td>KDS230</td><td></td></tr></tbody></table>

a microfluidic-based electrochemical biochip for label-free dna hybridization analysis

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration of pre-processing steps. Utilizing these devices towards the analysis of DNA hybridization events is important because it offers a technology for real time assessment of biomarkers at the point-of-care for various diseases. However, when the device footprint decreases the dominance of various physical phenomena increases. These phenomena influence the fabrication precision and operation reliability of the device. Therefore, there is a great need to accurately fabricate and operate these devices in a reproducible manner in order to improve the overall performance. Here, we describe the protocols and the methods used for the fabrication and the operation of a microfluidic-based electrochemical biochip for accurate analysis of DNA hybridization events. The biochip is composed of two parts: a microfluidic chip with three parallel micro-channels made of polydimethylsiloxane (PDMS), and a 3 x 3 arrayed electrochemical micro-chip. The DNA hybridization events are detected using electrochemical impedance spectroscopy (EIS) analysis. The EIS analysis enables monitoring variations of the properties of the electrochemical system that are dominant at these length scales. With the ability to monitor changes of both charge transfer and diffusional resistance with the biosensor, we demonstrate the selectivity to complementary ssDNA targets, a calculated detection limit of 3.8 nM, and a 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation. This methodology can improve the performance of miniaturized devices by elucidating on the behavior of diffusion at the micro-scale regime and by enabling the study of DNA hybridization events.

A controllable and accurate manufacturing process for the experimental device is essential in research. It allows researchers to obtain reproducible and high throughput experiments. Here we have demonstrated a high yield, high reproducibility microfabrication process of a microfluidic-based electrochemical biochip (Figure 1). With a low failure rate, few devices have shown bonding issues that lead to solution leakage. In order to validate the electrochemical activity of the biochip, cyclic voltammetry measurements are done in the microchannels filled with an electro-active redox couple ferricyanide/ferrocyanide. Figure 2 shows the reproducible electrochemical response of nine different working electrode on the chip. These results show that the electrochemical activity is the same in all nine chambers of the biochip allowing high-throughput measurements.
Most DNA hybridization sensors immobilize ssDNA probes onto a sensor surface. As gold is used to pattern the sensing electrodes for the microfluidic devices, thiols are good candidates to form strong covalent bonds with the sensor surfaces34. One common conjugation technique involved adding a functional thiol (-SH) group at one end of the ssDNA. The S-S disulfide bond protects the free thiol group from oxidation until it is ready to be used. Once the disulfide is reduced by tris(2-carboxyethyl)phosphine (TCEP) addition, the free thiol (-SH) becomes available to bond the DNA to a gold surface. Without TCEP, the disulfide bonds of the ssDNA will also assemble on the electrode, but the bond is much weaker than the thiol-gold bond and will not remain stable throughout the experiment. In this work, a stable ssDNA monolayer for hybridization detection has been achieved with incubation times between one and two hours. Once the ssDNA probes have been assembled onto the electrode, 6-mercapto-1-hexanol (MCH) is used to passivate any exposed regions on the surface to reduce non-specific binding effects35. The MCH&#8217;s thiol group allows for self-assembly onto the gold and the hydroxyl group reduces non-specific adsorption of the ssDNA in solution. The high TCEP concentration is used to reduce the thiol groups that may have oxidized to form disulfide bonds. Without the high TCEP content in the buffer, the MCH would form unstable monolayers and the impedance data would vary accordingly due to variations with the surface charge. The MCH has another important function when using it as passivation with ssDNA molecules. The oxidative adsorption process of the MCH injects electrons into the electrode and reduces the surface potential. This causes an electrostatic effect with the anionic probe ssDNA already immobilized and the ssDNA stands upright away from the electrode36. Upright probes greatly increase the hybridization efficiency since the target ssDNA strands have much easier access to the entire length of the probe sequence. This passivation step is crucial for establishing a stable impedance baseline measurement of the sensor, reducing false positive signals and removing any weakly bound molecules from the surface.
The biosensing mechanism of DNA hybridization events is based on repulsion forces between negatively charged DNA and other electro-active molecules. When a hybridization event occurs, stronger repulsion forces between the hybridized DNA and the electro-active molecules make it harder for the electro-active species to diffuse towards the electrode37. Here we use a ferricyanide/ferrocyanide couple as the redox species indicator for these repulsion forces, which are measured using electrochemical impedance spectroscopy (EIS). We utilize this biosensing mechanism in the microfluidic-based electrochemical biochip, and demonstrate its ability to detect DNA hybridization events33. Figure 3 shows the selectivity of the biosensor by illustrating impedance variations as a result of hybridization events between three ssDNA probes and their complementary ssDNA target. A 13% cross-reactivity with other non-complementary ssDNA following 20 min&#160;of incubation has been demonstrated. These results show the feasibility of the microfabricated device to measure DNA hybridization events in a reproducible and high-throughput manner. We also have demonstrated the sensitivity of the biosensor by introducing different concentrations of complementary ssDNA target to the sensing probe. Figure 4 shows the functionality of the biosensor with a trend of increasing impedance values for higher ssDNA target concentrations. Following calculations of the restricted diffusional resistance33 for different concentrations of complementary ssDNA target, a linear regression analysis resulted in a theoretical limit of detection of 3.8 nM by the calculation of the corresponding ssDNA target concentration for the background signal. Overall, the biochip shows the ability to rapidly sense the presence of DNA hybridization events.
<img alt="Figure 1" fo:content-width="5in" src="/files/ftp_upload/51797/51797fig1highres.jpg" width="500" /> 
Figure 1.&#160;Photograph of packaged device under test (chip dimensions: 3.5 cm x 3.5 cm; microchannel height is 100 &#956;m and 500 &#956;m in width). 
<img alt="Figure 2" fo:content-width="5in" src="/files/ftp_upload/51797/51797fig2highres.jpg" width="500" /> 
Figure 2.&#160;Electrochemical validation. Cyclic voltammograms of 9 (3 x 3 grid) working electrodes in the presence of ferrocyanide/ferricyanide redox couple. The reproducibility among the patterned electrodes is shown by the similar shape, peak heights, and peak separation for all electrodes. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51797/51797fig2highres.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" fo:content-width="5in" src="/files/ftp_upload/51797/51797fig3highres.jpg" width="500" /> 
Figure 3.&#160;Specificity of the biosensor. The impact of hybridization events between different ssDNA targets and three different ssDNA probes on the charge transfer resistance. Upon DNA hybridization event, the stronger repulsion force between the negatively charged double stranded DNA and the negatively charged ferrocyanide/ferricyanide molecules results in higher charge transfer resistance.
<img alt="Figure 4" fo:content-width="5in" src="/files/ftp_upload/51797/51797fig4highres.jpg" width="500" /> 
Figure 4.&#160;Functionality of the biosensor. Nyquist plot of electrochemical impedance spectroscopy measurements following the introduction of 0.01, 0.1, 1, and 1 &#956;M target ssDNA (Arrow indicates increasing ssDNA target concentrations). The increased impedance values at low frequencies (~15 Hz) for higher target ssDNA concentrations are due to the stronger repulsion forces between the dsDNA and the ferrocyanide/ferricyanide molecules.

Watch this Scientific Journal Video about A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis at JoVE.com

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

We present a microfluidic-based electrochemical biochip for DNA hybridization detection. Following ssDNA probe functionalization, the specificity, sensitivity, and detection limit are studied with complementary and non-complementary ssDNA targets. Results illustrate the influence of the DNA hybridization events on the electrochemical system, with a detection limit of 3.8 nM.

Miniaturization of analytical benchtop procedures into the micro-scale provides significant advantages in regards to reaction time, cost, and integration ...

a-microfluidic-based-electrochemical-biochip-for-label-free-dna

Nanyang Technological University

Research

JoVE Journal

Bioengineering

17.1K Views.  University of Maryland.  We presenteren een microfluidic gebaseerde elektrochemische biochip voor DNA hybridisatie detectie. Na ssDNA probe functionalisering, de specificiteit, gevoeligheid en detectielimiet bestudeerd met complementaire en niet complementaire ssDNA targets. De resultaten tonen de invloed van de DNA hybridisatie aan het elektrochemische systeem, met een detectielimiet van 3,8 nM. 

Video: A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Fabrication of Electrochemical-DNA Biosensors for the Reagentless Detection of Nucleic Acids, Proteins and Small Molecules

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. Many patients would be better served by rapid, bedside tests. To this end our laboratory and others have developed a versatile, reagentless 
biosensor platform that supports the quantitative, reagentless, electrochemical detection of nucleic acids (DNA, RNA), proteins (including antibodies) and small 
molecules analytes directly in unprocessed clinical and environmental samples. In this video, we demonstrate the preparation and use of several biosensors in this 
"E-DNA" class. In particular, we fabricate and demonstrate sensors for the detection of a target DNA sequence in a polymerase chain reaction mixture, an HIV-specific antibody and the drug cocaine. The preparation procedure requires only three hours of hands-on effort followed by an overnight incubation, and their use requires only minutes.

"E-DNA" sensors, reagentless, electrochemical biosensors that perform well even when challenged directly in blood and other complex matrices, have been adapted to the detection of a wide range of nucleic acid, protein and small molecule analytes. Here we present a general procedure for the fabrication and use of such sensors.

As medicine is currently practiced, doctors send specimens to a central laboratory for testing and thus must wait hours or days to 
receive the results. ...

Microfluidic Chip Fabrication and Method to Detect Influenza

Fast and effective diagnostics play an important role in controlling infectious disease by enabling effective patient management and treatment. Here, we present an integrated microfluidic thermoplastic chip with the ability to amplify influenza A virus in patient nasopharyngeal (NP) swabs and aspirates. Upon loading the patient sample, the microfluidic device sequentially carries out on-chip cell lysis, RNA purification and concentration steps within the solid phase extraction (SPE), reverse transcription (RT) and polymerase chain reaction (PCR) in RT-PCR chambers, respectively. End-point detection is performed using an off-chip Bioanalyzer (Agilent Technologies, Santa Clara, CA). For peripherals, we used a single syringe pump to drive reagent and samples, while two thin film heaters were used as the heat sources for the RT and PCR chambers. The chip is designed to be single layer and suitable for high throughput manufacturing to reduce the fabrication time and cost. The microfluidic chip provides a platform to analyze a wide variety of virus and bacteria, limited only by changes in reagent design needed to detect new pathogens of interest.

An integrated microfluidic thermoplastic chip has been developed for use as a molecular diagnostic. The chip performs nucleic acid extraction, reverse transcriptase, and PCR. Methods for fabricating and running the chip are described.

Fast  and effective diagnostics play an important role in controlling infectious  disease by enabling effective patient management and treatment. Here, we ...

A Microfluidic Chip for the Versatile Chemical Analysis of Single Cells

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this purpose, the cells are passively trapped in the middle of a microchamber. Upon activation of the control layer, the cell is isolated from the surrounding volume in a small chamber. The surrounding volume can then be exchanged without affecting the isolated cell. However, upon short opening and closing of the chamber, the solution in the chamber can be replaced within a few hundred milliseconds. Due to the reversibility of the chambers, the cells can be exposed to different solutions sequentially in a highly controllable fashion, e.g. for incubation, washing, and finally, cell lysis. The tightly sealed microchambers enable the retention of the lysate, minimize and control the dilution after cell lysis. Since lysis and analysis occur at the same location, high sensitivity is retained because no further dilution or loss of the analytes occurs during transport. The microchamber design therefore enables the reliable and reproducible analysis of very small copy numbers of intracellular molecules (attomoles, zeptomoles) released from individual cells. Furthermore, many microchambers can be arranged in an array format, allowing the analysis of many cells at once, given that suitable optical instruments are used for monitoring. We have already used the platform for proof-of-concept studies to analyze intracellular proteins, enzymes, cofactors and second messengers in either relative or absolute quantifiable manner.

In this article we present a microfluidic chip for single cell analysis. It allows the quantification of intracellular proteins, enzymes, cofactors, and second messengers by means of fluorescent assays or immunoassays.&#160;

We present a microfluidic device that enables the quantitative determination of intracellular biomolecules in multiple single cells in parallel. For this ...

Combining QD-FRET and Microfluidics to Monitor DNA Nanocomplex Self-Assembly in Real-Time

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically functional inside the cell, nucleic acid-based therapeutics require an efficient intracellular delivery system. One widely adopted approach is to complex DNA with a gene carrier to form nanocomplexes via electrostatic self-assembly, facilitating cellular uptake of DNA while protecting it against degradation. The challenge lies in the rational design of efficient gene carriers, since premature dissociation or overly stable binding would be detrimental to the cellular uptake and therapeutic efficacy. Nanocomplexes synthesized by bulk mixing showed a diverse range of intracellular unpacking and trafficking behavior, which was attributed to the heterogeneity in size and stability of nanocomplexes. Such heterogeneity hinders the accurate assessment of the self-assembly kinetics and adds to the difficulty in correlating their physical properties to transfection efficiencies or bioactivities. We present a novel convergence of nanophotonics (i.e. QD-FRET) and microfluidics to characterize the real-time kinetics of the nanocomplex self-assembly under laminar flow. QD-FRET provides a highly sensitive indication of the onset of molecular interactions and quantitative measure throughout the synthesis process, whereas microfluidics offers a well-controlled microenvironment to spatially analyze the process with high temporal resolution (~milliseconds). For the model system of polymeric nanocomplexes, two distinct stages in the self-assembly process were captured by this analytic platform. The kinetic aspect of the self-assembly process obtained at the microscale would be particularly valuable for microreactor-based reactions which are relevant to many micro- and nano-scale applications. Further, nanocomplexes may be customized through proper design of microfludic devices, and the resulting QD-FRET polymeric DNA nanocomplexes could be readily applied for establishing structure-function relationships. 

We present a novel and powerful integration of nanophotonics (QD-FRET) and microfluidics to investigate the formation of polyelectrolyte polyplexes, which is expected to provide better control and synthesis of uniform and customizable polyplexes for future nucleic acid-based therapeutics.

Advances in genomics continue to fuel the development of therapeutics that can target pathogenesis at the cellular and molecular level. Typically ...

Biology

Microfluidic Platform with Multiplexed Electronic Detection for Spatial Tracking of Particles

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to spatially fractionate the sample based on a biological property of interest. For the resultant spatial distribution to be used as the assay readout, microfluidic devices are often subjected to microscopic analysis requiring complex instrumentation with higher cost and reduced portability. To address this limitation, we have developed an integrated electronic sensing technology for multiplexed detection of particles at different locations on a microfluidic chip. Our technology, called Microfluidic CODES, combines Resistive Pulse Sensing with Code Division Multiple Access to compress 2D spatial information into a 1D electrical signal. In this paper, we present a practical demonstration of the Microfluidic CODES technology to detect and size cultured cancer cells distributed over multiple microfluidic channels. As validated by the high-speed microscopy, our technology can accurately analyze dense cell populations all electronically without the need for an external instrument. As such, the Microfluidic CODES can potentially enable low-cost integrated lab-on-a-chip devices that are well suited for the point-of-care testing of biological samples.

We demonstrate a microfluidic platform with an integrated surface electrode network that combines resistive pulse sensing (RPS) with code division multiple access (CDMA), to multiplex detection and sizing of particles in multiple microfluidic channels.

Microfluidic processing of biological samples typically involves differential manipulations of suspended particles under various force fields in order to ...

Dry Film Photoresist-based Electrochemical Microfluidic Biosensor Platform: Device Fabrication, On-chip Assay Preparation, and System Operation

In recent years, biomarker diagnostics became an indispensable tool for the diagnosis of human disease, especially for the point-of-care diagnostics. An easy-to-use and low-cost sensor platform is highly desired to measure various types of analytes (e.g., biomarkers, hormones, and drugs) quantitatively and specifically. For this reason, dry film photoresist technology - enabling cheap, facile, and high-throughput fabrication - was used to manufacture the microfluidic biosensor presented here. Depending on the bioassay used afterwards, the versatile platform is capable of detecting various types of biomolecules. For the fabrication of the device, platinum electrodes are structured on a flexible polyimide (PI) foil in the only clean-room process step. The PI foil serves as a substrate for the electrodes, which are insulated with an epoxy-based photoresist. The microfluidic channel is subsequently generated by the development and lamination of dry film photoresist (DFR) foils onto the PI wafer. By using a hydrophobic stopping barrier in the channel, the channel is separated into two specific areas: an immobilization section for the enzyme-linked assay and an electrochemical measurement cell for the amperometric signal readout.
The on-chip bioassay immobilization is performed by the adsorption of the biomolecules to the channel surface. The glucose oxidase enzyme is used as a transducer for electrochemical signal generation. In the presence of the substrate, glucose, hydrogen peroxide is produced, which is detected at the platinum working electrode. The stop-flow technique is applied to obtain signal amplification along with rapid detection. Different biomolecules can quantitatively be measured by means of the introduced microfluidic system, giving an indication of different types of diseases, or, in regard to therapeutic drug monitoring, facilitating a personalized therapy.

A microfluidic biosensor platform was designed and fabricated using low-cost dry film photoresist technology for the rapid and sensitive quantification of various analytes. This single-use system allows for the electrochemical readout of on-chip-immobilized enzyme-linked assays by means of the stop-flow technique.

In recent years, biomarker diagnostics became an indispensable tool for the diagnosis of human disease, especially for the point-of-care diagnostics. An ...

Electrowetting-based Digital Microfluidics Platform for Automated Enzyme-linked Immunosorbent Assay

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits the dielectric properties of thin insulator films to enhance the charge density and hence boost the electrowetting effect. The presence of charges results in an electrically induced spreading of the droplet which permits purposeful manipulation across a hydrophobic surface. Here, we demonstrate EWOD-based protocol for sample processing and detection of four categories of antigens, using an automated surface actuation platform, via two variations of an Enzyme-Linked Immunosorbent Assay (ELISA) methods. The ELISA is performed on magnetic beads with immobilized primary antibodies which can be selected to target a specific antigen. An antibody conjugated to HRP binds to the antigen and is mixed with H2O2/Luminol for quantification of the captured pathogens. Assay completion times of between 6 and 10 min were achieved, whilst minuscule volumes of reagents were utilized.

Electrowetting-based digital microfluidic is a technique that utilizes a voltage-driven change in the apparent contact angle of a microliter-volume droplet to facilitate its manipulation. Combining this with functionalized magnetic beads enables the integration of multiple laboratory unit operations for sample preparation and identification of pathogens using Enzyme-linked Immunosorbent Assay (ELISA).

Electrowetting is the effect by which the contact angle of a droplet exposed to a surface charge is modified. Electrowetting-on-dielectric (EWOD) exploits ...

Simple Bulk Readout of Digital Nucleic Acid Quantification Assays

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are still not routinely applied, due to the cost and specific equipment associated with commercially available methods. Here we present a simplified method for readout of digital droplet assays using a conventional real-time PCR instrument to measure bulk fluorescence of droplet-based digital assays.
We characterize the performance of the bulk readout assay using synthetic droplet mixtures and a droplet digital multiple displacement amplification (MDA) assay. Quantitative MDA particularly benefits from a digital reaction format, but our new method&#160;applies to any digital assay. For established digital assay protocols such as digital PCR, this method serves to speed up and simplify assay readout.
Our bulk readout methodology brings the advantages of partitioned assays without the need for specialized readout instrumentation. The principal limitations of the bulk readout methodology are reduced dynamic range compared with droplet-counting platforms and the need for a standard sample, although the requirements for this standard are less demanding than for a conventional real-time experiment. Quantitative whole genome amplification (WGA) is used to test for contaminants in WGA reactions and is the most sensitive way to detect the presence of DNA fragments with unknown sequences, giving the method great promise in diverse application areas including pharmaceutical quality control and astrobiology.

We describe an endpoint digital assay for quantifying nucleic acids with a simplified (analog) readout. We measure bulk fluorescence of droplet-based digital assays using a standard qPCR machine rather than specialized instrumentation and confirm our results by microscopy.

Digital assays are powerful methods that enable detection of rare cells and counting of individual nucleic acid molecules. However, digital assays are ...

Microfluidic Capillary Electrophoresis for Fragment Sizing of PCR Products: A Microchip-Based Electrophoretic Separation Technique to Separate DNA Fragments Based on Size

Source: Wang, H., Zhu et al. <a href="https://www-jove-com.remotexs.ntu.edu.sg/v/59963">A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X Mental Retardation-1 Gene</a>. J. Vis. Exp. (2019).
This video describes the microfluidic capillary electrophoresis technique to separate PCR amplicons based on their size. This technique helps in fragment sizing using fluorescent dyes and standard molecular size markers.

Source: Wang, H., Zhu et al. A Robust Polymerase Chain Reaction-based Assay for Quantifying Cytosine-guanine-guanine Trinucleotide Repeats in Fragile X ...

JoVE Encyclopedia of Experiments

Biological Techniques

Electrophoresis Techniques

Chip-Based Digital PCR to Detect Rare Transcript Variants Using a Nanofluidic Chip

Source: Molinari, C., et al. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/57066">Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR.</a> J. Vis. Exp. (2018).
This video demonstrates chip-based digital PCR &#8212; a variation of the digital PCR technique that is useful in detecting rare transcript variants. The PCR reaction is partitioned into the chambers of a nanofluidic chip, each of which acts as an independent reaction. The detection of fluorescence signals from the chambers with amplified targets confirms the presence of rare transcript variants in the sample.

Source: Molinari, C., et al. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. ...

A Microfluidic-based Electrochemical Biochip for Label-free DNA Hybridization Analysis

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video