Name: cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model
Uploaded: 2014-09-06T15:00:00.000+00:00
Duration: 10 min 32 s
Description: Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

We would like to acknowledge the financial support from the Monash Larkins Program as well as from a NHMRC CDF and a NHMRC project grant. Furthermore, we would like to thank Sue Mei Lim for her constructive suggestions, Edwina McGlinn for her support and the Monash Flowcore team (in particular Adam Dinsdale) for their help in producing the video.

1. Instrument Settings/Reagent Preparation/Genotyping
<ol>
	<li>Prepare iPS cell medium: Supplement 500 ml Knockout DMEM media with 75 ml fetal bovine serum (FBS), 5 ml L-glutamine, 5 ml Non-essential amino acids, 500 &#181;l &#946;-Mercaptoethanol, 5 x 105 units Leukaemia inhibitory factor (LIF). Please refer to Materials List for product and purchasing information for reagents used in the context of this manuscript.</li>
	<li>Prepare MEF medium: Supplement 500 ml DMEM media with 50 ml FBS, 5 ml L-glutamine, 5 ml Non-essential amino acids, 5 ml Sodium pyruvate, 500 &#181;l &#946;-Mercaptoethanol.</li>
	<li>Prepare freezing medium: For 10 ml, combine 9 ml of FBS with 1 ml of DMSO.</li>
	<li>Prepare Gelatin coated dishes Add 3-5 ml 0.1% porcine gelatin solution to a T75 flask, incubate at RT for at least 10 min and aspirate right before use.</li>
	<li>Prepare FACS labeling medium: For 10 ml, combine 9.9 ml of PBS with 0.1 ml of FBS.</li>
	<li>Perform a genotyping PCR for the Rosa26 m2rtTA locus: Perform reactions with Taq DNA polymerase according to manufacturer&#8217;s instructions. Use a modified MgCl2-concentration of 3.5 mM and the following 3 primers: oIMR8052: 5&#8217; GCG AAG AGT TTG TCC TCA ACC 3&#8217;, oIMR8545: 5&#8217;AAA GTC GCT CTG AGT TGT TAT 3&#8217;, oIMR8546: 5&#8217; GGA GCG GGA GAA ATG GAT ATG 3&#8217;. Cycling conditions: 94 &#176;C for 3 min; 35 cycles of (94 &#176;C for 30 sec, 65 &#176;C for 1 min, 72 &#176;C for 1 min); 72 &#176;C for 2 min; hold at 12 &#176;C. Expected product size: 650 bp for wild type allele and 340 bp for the mutant allele.</li>
	<li>Perform a genotyping PCR for the Collagen-StemCa/OKSM locus: Perform reactions with Taq DNA polymerase as per instructions. Use a modified MgCl2-concentration of 2.5 mM and the following 3 primers: col/frt-B: 5&#8217; CCCTCCATGTGTGACCAAGG 3&#8217;, col/frtA1: 5&#8217; GCACAGCATTGCGGACATGC 3&#8217;, col/frtC1: 5&#8217; GCAGAAGCGCGGCCGTCTGG 3&#8217;. Cycling conditions: 95 &#176;C for 1 min: 2 cycles of (94 &#176;C for 30 sec, 70 &#176;C for 45 sec), 6 cycles of (94 &#176;C for 30 sec, 68 &#176;C for 45 sec) and 30 cycles of (94 &#176;C for 20 sec, 60 &#176;C for 1 min); 72 &#176;C for 5 min; hold at 12 &#176;C. Expected product size: 331 bp for wild type allele and 551 bp for mutant allele.</li>
	<li>Carry out all centrifugation steps at 400 x g for 3 min at 4 &#176;C.</li>
</ol>
2. Generation of Mouse Embryonic Fibroblasts
<ol>
	<li>Perform a timed mating between an animal of the OKSM strain with a member of the opposite gender of the m2rtTA strain. Harvest embryos at embryonic day 13.5 by culling the mother and removing the uterine horn. Prior to removal of the uterine horn, spray the abdominal region with an 80% ethanol solution, to avoid microbial contamination.</li>
	<li>Transfer the uterine horn into a 10 cm tissue culture dish containing 10 ml of sterile Phosphate Buffered Saline (PBS). Use sterilized surgical grade scissors to cut the uterine horn into pieces containing one embryo (see Figure 3A,B).</li>
	<li>Use a dissection microscope (ideally placed within a tissue culture hood) and sterilized forceps to carefully remove the uterine envelope and the extra-embryonic membranes surrounding each embryo. Transfer each embryo to a separate 10 cm dish with 10 ml of PBS.</li>
	<li>Proceed by removing the embryo&#8217;s head, limbs, tail and internal organs (heart, liver, intestine etc.) with the forceps (see Figure 3C). Transfer the embryo&#8217;s head into a 1.5 ml tube and freeze down so it can be used for genotyping if necessary.</li>
	<li>Transfer the embryo&#8217;s torso into an empty 10cm plate and use two surgical blades to mince the embryo for 2 min. Add 200 &#181;l of trypsin/EDTA solution on top of the minced embryo and incubate for 3-5 min at RT. Continue mincing for an additional 2 min, add 2 ml of MEF media to inactivate trypsin, and then transfer into a 15 ml tube.</li>
	<li>Use a 1,000 &#181;l pipette to further mechanically dissociate the tissue by gentle pipetting. Transfer to a gelatin coated 10 cm dish and add an additional 10 ml of MEF media. Note: Both normoxic and hypoxic incubators can be used for culture, refer to discussion for more information.</li>
	<li>After 24-48 hr the plate should be densely covered with MEFs.</li>
	<li>Alternatively, the cells can then be further propagated or frozen down. For the freezing of cells, remove the culture media, rinse the dish with 10 ml PBS to remove traces of media and overlay with 3 ml Trypsin/EDTA solution. Incubate for 3-5 min at 37 &#176;C, inactivate trypsin digestion by adding 5 ml of MEF media and transfer to a 15 ml centrifugation tube. Spin down and resuspend the pellet in 3 ml freezing media. Transfer to 3 cryovials and freeze down in a cell freezing container.</li>
</ol>
3. Reprogramming of MEFs
NOTE: Pellet cells by centrifugation at 200 x g for 5 min at 4 &#176;C and use normoxic tissue culture incubators for reprogramming. It can be beneficial to derive and expand MEFs under hypoxic conditions (5% oxygen, see discussion for more information).
<ol>
	<li>Quickly thaw a low passage cryovial (P0-P1, 2-3 Mio cells) in a water bath (37 &#176;C) and transfer the contents into a tube with 10 ml of pre-warmed MEF media. Pellet cells, resuspend in 12 ml fresh MEF media, transfer into a gelatin coated T75 culture vessel, and allow cells to recover for 24-48 hr before proceeding. Note: MEFs can also be used directly after derivation.</li>
	<li>Following the removal of culture media, wash MEFs with PBS and cellularize by overlaying with a Trypsin/EDTA solution (3 ml for 3-5 min at 37 &#176;C). Quench trypsin by adding 5 ml of MEF media and further dissociate cells by gentle mixing with a 10 ml pipette. Determine cell numbers using a hemocytometer.</li>
	<li>For reprogramming experiments, seed MEFs onto gelatin coated T75 flasks at densities of 6.7 x 103 cells/cm2 (~0.5 Mio cells per flask) in iPSC media containing 2 &#181;g/ml doxycycline. Refer to Table 1 regarding seeding recommendations to obtain around 2 Mio reprogramming intermediates for each time point. Note: Reprogramming commences with the addition of doxycycline (2 &#956;g/ml) supplemented media</li>
	<li>For the first 6 days replace media every other day with fresh doxycycline supplemented iPSC media (12 ml of media per T75 flask). Beyond this point renew media on a daily basis if there are high cell numbers. Double the culture volume if media changes can only be performed every alternate day.</li>
	<li>Harvest reprogramming intermediates at the required time points (suggestion: Days 3, 6, 9, 12) by removing media, rinsing with appropriate volume of PBS (10 ml for a T75 flask) and overlaying with Trypsin-EDTA solution (3 ml for a T75 flask). Incubate for 3-5 min at 37 &#176;C and quench by adding 5 ml of iPSC media followed by gentle pipetting.</li>
	<li>Count cell suspension with a hemocytometer (see above), pellet by centrifugation, aspirate the supernatant and resuspend cells in 10 ml of PBS to remove any traces of trypsin. Pellet cells once again, aspirate supernatant and proceed with step 4.1 to isolate the reprogramming intermediates. Note: Cells undergoing reprogramming can be cryopreserved and thawed for FACS isolation at a later stage.</li>
	<li>To establish fully reprogrammed iPS cultures, grow cells in dox-free iPSC media for a further 4-7 days. Note: Successfully reprogramming cultures will contain a large number of colonies by day 12 (see Figure 4). During this time, aberrant iPS cells that still require OKSM expression will disappear.</li>
	<li>Alternatively, to propagate the remaining fully reprogrammed iPS cultures: initially, seed irradiated MEFs at a density of 15 x 103 cell/cm2 in 12 ml of iPSC media onto a gelatin coated T75 flask one day or 6 hr prior to experiments.</li>
	<li>Next, cellularize iPS cell cultures by removing media, rinsing the T75 flask with 10 ml of PBS, overlaying with 3 ml of Trypsin-EDTA solution and incubating for 3-5 min at 37 &#176;C. Quench trypsin by adding 5 ml of iPSC media followed by gentle mixing, transfer to a 15 ml conical tube, spin down and then resuspended in 10 ml iPS media.</li>
	<li>Transfer 500 &#181;l of this cell suspension onto the irradiated MEFs (T75 flask) and allow the cultures to grow for 4-5 days. Note: Established iPS cultures can be cryopreserved or used for experiments. Clonal cell lines can be derived by picking individual iPSC colonies under a dissecting microscope 22.</li>
	<li>Cryo preserve confluent iPSC cultures as described in 2.8 for MEFs.</li>
</ol>
4. Antibody Labeling
<ol>
	<li>Resuspend cell pellets of reprogramming cultures, as prepared in Section 3, in FACS labeling media supplemented with antibodies (anti-Thy-1.2 pacific blue 1:400, anti-Ssea-1 biotin 1:400 and anti-Epcam Fitc 1:400). Use 200 &#181;l of supplemented labeling mix per 5 million cells and incubate on ice.</li>
	<li>After 10 min gently tap the tube to resuspend the cells and incubate for an additional 10 min on ice. Add 10 ml of cold PBS per tube and spin down.</li>
	<li>For each tube to be stained prepare 200 &#181;l of labeling media supplemented with 1 &#181;l Streptavidin-PeCy7 (1:200) per 5 million cells. When cells have pelleted, carefully aspirate the supernatant and resuspend in an appropriate volume of labeling media supplemented with Streptavidin-PeCy7.</li>
	<li>Keep cells on ice for 10 min, tap to resuspend, incubate for another 10 min on ice, add 10 ml of cold PBS per tube, spin down and aspirate supernatant.</li>
	<li>Resuspend cell pellets in labeling media supplemented with propidium iodide (PI) (2 &#181;g/ml) at approximately 1 x 107 cells/ml. Remove cell clumps by passing the suspension through a 70 &#181;m strainer. Transfer cells to an appropriate FACS tube and keep them on ice.</li>
	<li>Prepare separate samples with individual antibodies (anti-Thy-1.2, anti-Ssea-1 and anti-Epcam). NOTE: These are required to perform color compensation in the three channels used in the analysis. In addition, unlabeled cells are needed to set voltages and gates for sorting. Ideally iPS cells are used for compensation: stocks of 0.5-1 x 106 iPS cells maintained on irradiated MEFs are stored in cryovials in liquid nitrogen. The presence of MEFs is essential to get a signal in the Thy-1.2 channel.</li>
	<li>Thaw a cryovial of iPS cells as described for MEFs (section 3). Following centrifugation, resuspend cells in 800 &#181;l of labeling buffer and 200 &#181;l of this sample is set aside as the unlabeled control.</li>
	<li>Use the remaining cells as compensation controls. Divide cells between three 15 ml tubes and add antibodies as follows: Pacific Blue compensation control: add 0.5 &#181;l of the anti-Thy-1.2 Pacific Blue antibody. Fitc compensation tube: add 0.5 &#181;l of the anti-Epcam-Fitc antibody. Pe-Cy7 compensation control: 0.5 &#181;l of the anti Ssea-1-Biotin antibody.</li>
	<li>Keep cell-antibody samples on ice for 10 min, mix by tapping and incubate for 10 min on ice.</li>
	<li>Wash samples with 10 ml cold PBS to remove unbound antibody, spin cells down and aspirate the supernatant. Resuspend cell pellets in 200 &#181;l of FACS labeling media.</li>
	<li>For anti-Ssea-1-Biotin labeled samples, add a Streptavidin-PeCy7 conjugate (1 &#181;l per 200 &#181;l cells). Label cells as described for primary antibody (Ssea-1-Biotin).</li>
	<li>Pass all samples including the unlabeled control through a 70 &#181;m strainer and add PI (2 &#181;g/ml). Transfer cells to FACS tubes and keep on ice until required.</li>
</ol>
5. FACS Isolation of Intermediates
NOTE: Cells are sorted using a Fluorescence Activated Cell Sorter with 405 nm, 488 nm and 560 nm excitation lasers and a 100 &#181;m nozzle.
<ol>
	<li>Set up voltages for forward and side scatter so that the cell population is properly visualized. Draw a gate around cells as indicated in Figure 5A to exclude debris. Note: The correct set up of voltages on the cell sorter can be complex and requires an experienced FACS operator.</li>
	<li>Use Forward scatter (FSC) height versus FSC area to exclude aggregates (Figure 5B).</li>
	<li>Visualize the PI channel versus FSC to gate in on the PI negative live cells (Figure 5C).</li>
	<li>Use the unlabeled cells to adjust the voltages for the fluorescent channels of PB, Fitc/GFP, Pe-Cy7. Ideally position the cell population at the lower end of the respective channel.</li>
	<li>Set gates with the unlabeled control cells as shown in Figure 6A,B to sub fraction the reprogramming cultures into day 3, 6 and 9 populations: Ssea-1-/Thy-1.2+ cells; Ssea-1-/Thy-1.2- cells; and the reprogramming intermediates Ssea-1+/Thy-1.2- cells.</li>
	<li>Further subdivide the Day 9 Ssea-1+/Thy-1.2- fraction using the Pe-Cy7 versus Fitc blot; draw gates around the Sse-a1+/Epcam+ cells and the Ssea-1+/Epcam- cells. Set gates with the unlabeled control cells as shown in Figure 6C,D.</li>
	<li>Prefill appropriate collection tubes with iPS cell media (1-2 ml) before sorting the desired subpopulations (see Figure 7 for representative FACS profiles for MEFs, Day 3/Day 6/Day 9/Day 12 cultures and iPS cells).</li>
	<li>Perform FACS sorting according to manufactures protocol.</li>
	<li>After FACS isolation submit cells to molecular profiling (RNA/ protein extraction, chromatin immunoprecipitation, DNA methylome analysis etc.). Alternatively, the various cell fractions may be cultured.</li>
</ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

The authors have nothing to disclose.

In order to successfully reprogram MEFs into iPS cells and to purify reprogramming intermediates at high quantity it is essential to be aware of factors that have an impact on the overall efficiency. In particular the batch of FBS used to supplement iPS media can have a detrimental effect. In general positive experiences were made with Embryonic stem (ES) cell qualified FBS but batch testing of sera from a variety of vendors might identify a cheaper alternative.
Another factor that impacts on reprogramming efficiency is the genotype of MEFs 15,20. Although MEFs derived from mice heterozygous (het) for both the OKSM and the m2rtTA locus do reprogram, homozygousity at one or both loci results in higher reprogramming efficiencies. Indeed, MEFs derived from the offspring of OKSM and m2rtTA crosses show an increase in reprogramming efficiency in the following order (OKSM/m2rtTA): het/het &#60; homo/het &#60; het/homo &#60; homo/homo (please note that the numbers given in Table 1 are for het/het animals). On the rare occasion a male homo/homo animal is identified, a harem mating with multiple m2rtTA females can be set up. All offspring from these crosses will be het/homo for the OKSM/m2rtTA loci, respectively. In addition, the rapid genotyping of litters is recommended as larger litters are obtained when using younger mice for breeding (6-15 weeks of age).
Moreover, the use of low passage MEFs for reprogramming is emphasized 23. If MEFs were derived and expanded in a normoxic tissue culture incubator we strongly recommend to only use these cells up to passage 2. However, if the experimenter has access to a low oxygen incubator (5% oxygen) for the derivation and expansion of MEFs, passage numbers as high as 3 will still yield good results 23.
In case the experimenter encounters problems associated with reprogramming, as outlined, the most likely explanations are high passage numbers at the time of dox addition, incorrect genotype of the mice or the use of FBS that is not conducive for iPS cell generation. However, in rare cases we observed that MEFs were not able to reprogram even under ideal conditions. In these cases a spontaneous de novo deletion within the m2rtTA&#8217;s open reading frame was identified as the underlying reason.
This methodology was successfully adapted to extract Ssea-1+ intermediates via magnetic cell isolation (MACS). There is a clear time advantage in using MACS, however, the Ssea-1+ cell populations&#8217; purity is reduced to 80-90%, rather than more than 95%, which depending on the type of experiment the cells are destined for might pose a problem. Thus, an option is to use MACS to enrich for Ssea-1+ cells followed by FACS to increase purity and/or fraction them into Ssea-1+/Epcam+ and Ssea-1+/Epcam- cells.
While the iPS cells produced by the outlined protocol and mouse model have been shown to be pluripotent and effectively contribute to all tissues of chimeric animals 15,20, a reduced capacity to produce embryos entirely composed of these iPS cells via tetraploid complementation has been demonstrated 24. Aberrant methylation patterns at the Dlk-Dio3 gene cluster have been identified as the underlying cause 24. However, addition of ascorbic acid at a concentration of 50 &#181;g/ml to the media during reprogramming will produce tetraploid complementation competent iPS cells 24. Please be advised that an alternative reprogrammable mouse model engineered to express the reprogramming factors at a different stoichiometry can produce tetraploid competent iPS cells even in the absence of ascorbic acid treatment 25. However, in our hands cells from this strain reprogram at considerably lower frequency compared to the herein used mouse model.
The methodology described in this manuscript allows the separation of reprogramming intermediates from the refractory bulk of the population and should be seen as valuable tool to dissect and understand the reprogramming process, removing the previous limitations of having to use an unfractioned population for profiling (e.g., high signal noise from the refractory cells). The antibody combination described herein allows isolation of intermediates from mouse cells at high purity, however it is possible that additional cell surface markers will be uncovered in the future that will allow to obtain intermediates at even higher purity. Please note that Ssea-1 expression is not a hallmark of human induced pluripotent stem cells and as such this protocol cannot be used on reprogramming cells of human origin. In conclusion, reprogramming intermediates once isolated with the described method can be used for molecular analyses including expression profiling, chromatin immunoprecipitation, methylome analysis, and protein assays.

Embryonic stem (ES) cells are derived from the inner cell mass of blastocyst stage embryos1. Under appropriate culture conditions they self-renew and remain pluripotent. In 2006 Yamanaka and colleagues demonstrated that mature cells can be reprogrammed into so called induced pluripotent stem (iPS) cells by forced expression of the transcription factors Oct-4, Klf-4, Sox-2, c-Myc (OKSM) 2. iPS cells, like ES cells, can give rise to all cell types of the body, however, they are free of the ethical constraints surrounding the generation of ES cells3. Furthermore, iPS cells carry the promise of personalized regenerative medicine and hold tremendous potential for applications like disease modeling and in vitro drug screening4,5. In order for reprogramming technology to fulfill this potential, the basic mechanism of nuclear reprogramming needs to be fully understood. However, efforts to dissect the reprogramming pathway have been hampered by the fact that only a very small number of cells reprogram (0.1-1%). Successfully reprogramming fibroblasts have been reported to undergo a distinct series of events including a mesenchymal to epithelial transition 6-10 and, in the final stages of reprogramming, activation of the endogenous core pluripotency network 11-14. We and others 12,13,15-17 have recently identified a set of cell surface markers that allows for the separation of rare intermediates from the refractory bulk population. Reprogramming mouse embryonic fibroblasts (MEFs) undergo changes in the expression of Thy-1.2, Ssea1 and Epcam (among others) during the 2-week-long reprogramming process15. Early during reprogramming a subset of MEFs down-regulate expression of fibroblast identity marker (Thy-1.2) and then start expressing the pluripotency-associated marker Ssea-112. During the final stages of reprogramming Ssea1-positive cells reactivate endogenous pluripotency genes such as Oct-410-13,15. This last transition is marked on the cell surface by detectable expression of Epcam (see Figure 1) or in a later stage Pecam 15. Recently, O&#8217;Malley et al. reported the use of CD44 and iCAM1 as alternatives or complementary to Thy-1.2 and Ssea-1 for the identification of reprogramming intermediates.&#160;We have previously FACS extracted reprogramming intermediates from Day 0, Day 3, Day 6, Day 9 and Day 12 reprogramming cultures, as well as from established iPS cell lines based on these cell surface markers 15,18. For the below described reprogramming system and conditions we have shown at the single cell level that although the populations are quiet homogenous, there is a certain degree of heterogeneity in the identified intermediate populations. It should be noted that only a subset of cells within these populations are able to progress to the respective next stage of the reprogramming process and give rise to iPS cell colonies at different efficiencies, which have been extensively characterized previously15,19. Moreover, the reprogramming efficiency of these populations will depend as well on the re-plating and culture conditions. To increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and a polycistronic OKSM cassette under control of a doxycycline responsive promoter20,21. Using this mouse model circumvents the unwanted side effects of traditional viral methods of iPS cell generation, i.e., a heterogeneous starting population with cell to cell variability in number and location of integration sites of viral inserts. Two transgenic mouse strains (OKSM, m2rtTA), available as homozygous founder animals at the Jackson Laboratory, have to be crossed in order to establish the reprogrammable mouse model (see Figure 2). In this manuscript we describe in detail how to derive MEFs, generate iPS cells, and isolate the reprogramming intermediates at various stages of the conversion process by FACS.

<table><tbody><tr><td>Anti-mouse CD90.2 (Thy1.2) Pacific Blue&amp;nbsp;</td><td>eBioscience&amp;nbsp;</td><td>48-0902-82&amp;nbsp;</td><td></td></tr><tr><td>Anti-Human/Mouse SSEA-1 Biotin&amp;nbsp;</td><td>eBioscience&amp;nbsp;</td><td>13-8813&amp;nbsp;</td><td></td></tr><tr><td>Streptavidin PE-Cy 7&amp;nbsp;</td><td>eBioscience&amp;nbsp;</td><td>25-4317-82&amp;nbsp;</td><td></td></tr><tr><td>Anti-Mouse CD326(Epcam) Fitc&amp;nbsp;</td><td>eBioscience&amp;nbsp;</td><td>48-5791-82&amp;nbsp;</td><td></td></tr><tr><td>Sodium pyruvate&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>11360-070&amp;nbsp;</td><td></td></tr><tr><td>MEM Non-Essential Amino Acids (NEAA)&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>11140-050&amp;nbsp;</td><td></td></tr><tr><td>Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>10439024</td><td></td></tr><tr><td>Trypsin-EDTA (0.25%)&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>25200-056&amp;nbsp;</td><td></td></tr><tr><td>GlutaMAX</td><td>Life Technologies&amp;nbsp;</td><td>35050-070&amp;nbsp;</td><td></td></tr><tr><td>&amp;beta;-Mercaptoethanol&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>21985-023&amp;nbsp;</td><td></td></tr><tr><td>DMSO (Dimethyl Sulfoxide)&amp;nbsp;</td><td>Sigma-Aldrich&amp;nbsp;</td><td>D8418&amp;nbsp;</td><td></td></tr><tr><td>Penicillin/streptomycin&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>15140</td><td></td></tr><tr><td>Propidium Iodide solution (PI)&amp;nbsp;</td><td>Sigma-Aldrich&amp;nbsp;</td><td>P4864-10ML&amp;nbsp;</td><td></td></tr><tr><td>Gelatine from porcine skin&amp;nbsp;</td><td>Sigma-Aldrich&amp;nbsp;</td><td>G1890&amp;nbsp;</td><td></td></tr><tr><td>Doxycyclin hyclate&amp;nbsp;</td><td>Sigma-Aldrich&amp;nbsp;</td><td>33429-100MG-R&amp;nbsp;</td><td></td></tr><tr><td>Leukemia Inhibitory Factor (LIF)&amp;nbsp;</td><td>Millipore&amp;nbsp;</td><td>ESG1107&amp;nbsp;</td><td></td></tr><tr><td>DMEM High Glucose&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>11960-044&amp;nbsp;</td><td></td></tr><tr><td>DPBS (Dulbecco&#039;s phosphate buffer saline)&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>14190-144&amp;nbsp;</td><td></td></tr><tr><td>KnockOut DMEM&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>10829-018&amp;nbsp;</td><td></td></tr><tr><td>Irradiated MEFs&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>S1520-100&amp;nbsp;</td><td></td></tr><tr><td>75-cm&lt;sup&gt;2&lt;/sup&gt; Tissue culture flasks&amp;nbsp;</td><td>Corning/BD Bioscience&amp;nbsp;</td><td>430641</td><td></td></tr><tr><td>15-ml centrifuge tubes&amp;nbsp;</td><td>Corning/BD Bioscience&amp;nbsp;</td><td>430791</td><td></td></tr><tr><td>50-ml centrifuge tubes&amp;nbsp;</td><td>Corning/BD Bioscience&amp;nbsp;</td><td>430829</td><td></td></tr><tr><td>Disposable surgical blades&amp;nbsp;</td><td>Clifford Hallam</td><td>SM0501</td><td></td></tr><tr><td>Cryogenic vials&amp;nbsp;</td><td>Corning/BD Bioscience&amp;nbsp;</td><td>430487</td><td></td></tr><tr><td>70 &amp;micro;m Cell strainer&amp;nbsp;</td><td>BD Bioscience&amp;nbsp;</td><td>352340</td><td></td></tr><tr><td>Taq DNA Polymerase&amp;nbsp;</td><td>Life Technologies&amp;nbsp;</td><td>10342-020&amp;nbsp;</td><td></td></tr></tbody></table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

After the dissection, disaggregation and plating of an E13.5 mouse embryo, a 10 cm dish is expected to reach confluency in approximately 1 to 2 days. At this stage, it is normal for the culture to contain some adherent pieces of tissue that have not been cellularized properly. These will disappear after passaging.
Upon doxycycline induction, reprogramming MEFs undergo distinct morphological changes. Around day 6, early colony-like patches should start to emerge (Figure 4C). These will continue to grow in size upon further culture (see Figure 4D,E). A good reprogramming experiment should result in &#62;500 colonies per T75 that was initially seeded with 5 x 105 cells (Figure 4E). Established iPS cultures possess characteristic dome shaped colonies and should mostly be devoid of differentiated cells (Figure 4F). Occasionally, additional passaging of iPS cultures may be required to remove undifferentiated/partially reprogrammed cells; a confluent flask of cells can be split at a ratio of 1:10 onto a feeder layer of irradiated MEFs.
As mentioned above, morphological and molecular changes during reprogramming are reflected by changes in the FACS profiles for Thy-1.2, Ssea-1 and ultimately Epcam (see Figure 7A-F). As reported previously12,15, while MEFs are predominantly positive for Thy-1.2 and negative for the other markers, Day 3 cultures already look markedly different. A large proportion of cells have started to down-regulate the expression of Thy-1.2 and a very small subset of these Thy-1.2 negative cells have become positive for Ssea-1, the actual reprogramming intermediate for this time point. The number of reprogramming intermediates that can be extracted from Day 3 cultures is very unpredictable as the percentage of Ssea-1+/Thy-1.2- usually lies in a range between 1-10% of viable cells. On Days 6 and 9 an increased percentage of Ssea-1+ cells, usually well above 10%, can be detected. Around day 12 a subset of Ssea-1 positive cells can be detected that also label positive for Epcam. Day 12 cultures, like Day 3 cultures, represents a bottleneck in the purification of intermediates, as the percentage of Ssea-1.2+/Epcam+ cells is variable and usually falls in the range of only 2-4% of all live cells. The expected number of reprogramming intermediates presented in Table 1 only serves as a rough approximation. Established bona fide iPS cell cultures will be strongly positive for Ssea-1 and Epcam.
<img alt="Figure 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> 
Figure 1. Surface marker changes during the reprogramming pathway: Down-regulation of fibroblast identity marker Thy-1.2 is followed by up-regulation of Ssea-1. The transition of a subset of Ssea-1 positive cells towards a pluripotent state is indicated by acquisition of Epcam around day 12. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> 
Figure 2. Schematic representation of the reprogrammable mouse model: m2rtTA expression is under control of the ubiquitously active Rosa26 locus. In the presence of doxycycline (dox) the m2rtTA protein binds to a tetracycline dependent promoter (tetOP) at the Collagen 1a1 (Col1a1) locus resulting in the expression of the four-factor cassette. Two bicistronic cassettes are linked by an internal ribosome entry site (IRES). Open reading frames for Oct-4/Klf-4 and Sox-2/c-Myc are fused by self-cleaving F2A and E2A sequences, respectively. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> 
Figure 3. Embryo dissection: (A) Transfer uterine horn into a 10 cm dish filled with 10 ml PBS and (B) cut into pieces containing one embryo. (C) Using forceps free the embryos from extra embryonic tissue and remove head, limbs, tail and internal organs. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig4highres.jpg" width="500" /> 
Figure 4. Morphological changes during reprogramming. Colony-like patches become apparent in the cultures from day 6 onwards. Bona fide iPSCs are characterized by a domed shaped morphology. (A) Day 0/MEFs, (B) Day 3, (C) Day 6, (D) Day 9, (E) Day 12, (F) iPS cell culture. Scale bar: 200 &#181;m. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> 
Figure 5. Basic FACS setup. (A) Exclude debris with Side Scatter versus Forward Scatter Area blot. (B) Exclude aggregates from non-debris by gating on single cell population with Forward Scatter Area versus Forward Scatter High blot. (C) Exclude dead cells from single cell population by gating on PI low events with PI channel versus Forward Scatter Area blot. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> 
Figure 6. Gating. (A, B) Using the unlabeled control cells set up gates for Thy-1.2+/Ssea-1- cells, Thy-1.2-/Ssea-1- cells and Thy-1.2-/Ssea-1+ cells. (C) Use the unlabeled control cells to set gates for Epcam positive and Epcam negative cells. (D) Ssea-1+/Thy-1.2- cells can be separated into an Epcam positive and into an Epcam negative population. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> 
Figure 7. Thy-1.2 versus Ssea-1 FACS blots at various stages of the reprogramming process. (A) Day 0/MEFs, (B) Day 3, (C) Day 6, (D) Day 9, (E) Day 12, (F) iPS cell culture.
Table 1. Suggested seeding density, flask number and expected outcome for P1 MEFs of an embryo heterozygous for OKSM and m2rtTA. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Day </td>
			<td>Number of T75 flasks seeded on day 0</td>
			<td>Total number of Ssea1+ cells after FACS </td>
			<td>Total number of Ssea1+/Epcam+ cells after FACS </td>
		</tr>
		<tr>
			<td>3</td>
			<td>8</td>
			<td>2 million </td>
			<td></td>
		</tr>
		<tr>
			<td>6</td>
			<td>4</td>
			<td>2 million </td>
			<td></td>
		</tr>
		<tr>
			<td>9</td>
			<td>4</td>
			<td>2 million </td>
			<td></td>
		</tr>
		<tr>
			<td>12</td>
			<td>10</td>
			<td>10 million </td>
			<td>2 million </td>
		</tr>
	</tbody>
</table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Nanyang Technological University

Research

JoVE Journal

Biology

12.2K Views.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Video: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

A Quick and Efficient Method for the Purification of Endoderm Cells Generated from Human Embryonic Stem Cells

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell replacement therapies. Terminally differentiated cell types could be used for the treatment of various degenerative diseases. In vitro differentiation of these cells towards tissues of the lung, liver and pancreas requires as a first step the generation of definitive endodermal cells. This step is rate-limiting for further differentiation towards terminally matured cell types such as insulin-producing beta cells, hepatocytes or other endoderm-derived cell types. Cells that are committed towards the endoderm lineage highly express a multitude of transcription factors such as FOXA2, SOX17, HNF1B, members of the GATA family, and the surface receptor CXCR4. However, differentiation protocols are rarely 100% efficient. Here, we describe a method for the purification of a CXCR4+ cell population after differentiation into the DE by using magnetic microbeads. This purification additionally removes cells of unwanted lineages. The gentle purification method is quick and reliable and might be used to improve downstream applications and differentiations.

Here, we describe a method for the purification of differentiated human embryonic stem cells that are committed towards the definitive endoderm for the improvement of downstream applications and further differentiations.

The differentiation capabilities of pluripotent stem cells such as embryonic stem cells (ESCs) allow a potential therapeutic application for cell ...

Developmental Biology

Generating iPS Cells from MEFS through Forced Expression of Sox-2, Oct-4, c-Myc, and Klf4

Pluripotency can be induced in differentiated murine by viral transduction of Oct4, Sox2, Klf4, and c-Myc (Takahashi and Yamanaka, 2006; Wernig, et al., 2007; Okita, et al., 2007; Maherali, et al., 2007). We have devised a reprogramming strategy in which these four transcription factors are expressed from doxycycline (dox)-inducible lentiviral vectors (Brambrink et al., 2008). Using these inducible constructs, we can derive induced pluripotent stem (iPS) cells from mouse embryonic fibroblasts (MEFs). In this video, we demonstrate the procedure for the generation of inducible lentiviruses that express the four transcription factors and show how to infect MEFs with these viruses in order to produce iPS cells. By using inducible lentiviruses, the expression of the four factors in controlled by the addition of doxycyline to the culture medium. The advantage of this system over the traditional retroviral infection is the ability to turn the genes on and off so that the kinetics of reprogramming and gene expression requirements can be analyzed in detail.

This video shows the procedure for generating induced pluripotent stem cells using inducible lentivirus that express Oct4, Sox2, c-Myc and Klf4.

Pluripotency can be induced in differentiated murine by viral transduction of Oct4, Sox2, Klf4, and c-Myc (Takahashi and Yamanaka, 2006;  Wernig, et al., ...

Directed Differentiation of Induced Pluripotent Stem Cells towards T Lymphocytes

Adoptive cell transfer (ACT) of antigen-specific CD8+ cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of malignancies 1. CTLs can recognize malignant cells by interacting tumor antigens with the T cell receptors (TCR), and release cytotoxins as well as cytokines to kill malignant cells. It is known that less-differentiated and central-memory-like (termed highly reactive) CTLs are the optimal population for ACT-based immunotherapy, because these CTLs have a high proliferative potential, are less prone to apoptosis than more differentiated cells and have a higher ability to respond to homeostatic cytokines 2-7. However, due to difficulties in obtaining a high number of such CTLs from patients, there is an urgent need to find a new approach to generate highly reactive Ag-specific CTLs for successful ACT-based therapies.
TCR transduction of the self-renewable stem cells for immune reconstitution has a therapeutic potential for the treatment of diseases 8-10. However, the approach to obtain embryonic stem cells (ESCs) from patients is not feasible. Although the use of hematopoietic stem cells (HSCs) for therapeutic purposes has been widely applied in clinic 11-13, HSCs have reduced differentiation and proliferative capacities, and HSCs are difficult to expand in in vitro cell culture 14-16. Recent iPS cell technology and the development of an in vitro system for gene delivery are capable of generating iPS cells from patients without any surgical approach. In addition, like ESCs, iPS cells possess indefinite proliferative capacity in vitro, and have been shown to differentiate into hematopoietic cells. Thus, iPS cells have greater potential to be used in ACT-based immunotherapy compared to ESCs or HSCs.
Here, we present methods for the generation of T lymphocytes from iPS cells in vitro, and in vivo programming of antigen-specific CTLs from iPS cells for promoting cancer immune surveillance. Stimulation in vitro with a Notch ligand drives T cell differentiation from iPS cells, and TCR gene transduction results in iPS cells differentiating into antigen-specific T cells in vivo, which prevents tumor growth. Thus, we demonstrate antigen-specific T cell differentiation from iPS cells. Our studies provide a potentially more efficient approach for generating antigen-specific CTLs for ACT-based therapies and facilitate the development of therapeutic strategies for diseases.

Generation of T lymphocytes from induced pluripotent stem (iPS) cells gives an alternative approach of using embryonic stem cells for T cell-based immunotherapy. The method shows that by utilizing either in vitro or in vivo induction system, iPS cells are able to differentiate into both conventional and antigen-specific T lymphocytes.

Adoptive cell transfer (ACT) of antigen-specific CD8+  cytotoxic T lymphocytes (CTLs) is a promising treatment for a variety of  malignancies 1. CTLs can  ...

Immunology and Infection

Integration Free Derivation of Human Induced Pluripotent Stem Cells Using Laminin 521 Matrix

Xeno-free and fully defined conditions are key parameters for robust and reproducible generation of homogenous human induced pluripotent stem (hiPS) cells. Maintenance of hiPS cells on feeder cells or undefined matrices are susceptible to batch variances, pathogenic contamination and risk of immunogenicity. Utilizing the defined recombinant human laminin 521 (LN-521) matrix in combination with xeno-free and defined media formulations reduces variability and allows for the consistent generation of hiPS cells. The Sendai virus (SeV) vector is a non-integrating RNA-based system, thus circumventing concerns associated with the potential disruptive effect on genome integrity integrating vectors can have. Furthermore, these vectors have demonstrated relatively high efficiency in the reprogramming of dermal fibroblasts. In addition, enzymatic single cell passaging of cells facilitates homogeneous maintenance of hiPS cells without substantial prior experience of stem cell culture. Here we describe a protocol that has been extensively tested and developed with a focus on reproducibility and ease of use, providing a robust and practical way to generate defined and xeno-free human hiPS cells from fibroblasts.

Robust derivation of human induced pluripotent stem (hiPS) cells was achieved by using non-integrating Sendai virus (SeV) vector mediated reprogramming of dermal fibroblasts. hiPS cell maintenance and clonal expansion was performed using xeno-free and chemically defined culture conditions with recombinant human laminin 521 (LN-521) matrix and Essential E8 (E8) Medium.

Xeno-free and fully defined conditions are key parameters for robust and reproducible generation of homogenous human induced pluripotent stem (hiPS) ...

Subretinal Transplantation of MACS Purified Photoreceptor Precursor Cells into the Adult Mouse Retina

Vision impairment and blindness due to the loss of the light-sensing cells of the retina, i.e. photoreceptors, represents the main reason for disability in industrialized countries. Replacement of degenerated photoreceptors by cell transplantation represents a possible treatment option in future clinical applications. Indeed, recent preclinical studies demonstrated that immature photoreceptors, isolated from the neonatal mouse retina at postnatal day 4, have the potential to integrate into the adult mouse retina following subretinal transplantation. Donor cells generated a mature photoreceptor morphology including inner and outer segments, a round cell body located at the outer nuclear layer, and synaptic terminals in close proximity to endogenous bipolar cells. Indeed, recent reports demonstrated that donor photoreceptors functionally integrate into the neural circuitry of host mice. For a future clinical application of such cell replacement approach, purified suspensions of the cells of choice have to be generated and placed at the correct position for proper integration into the eye. For the enrichment of photoreceptor precursors, sorting should be based on specific cell surface antigens to avoid genetic reporter modification of donor cells. Here we show magnetic-associated cell sorting (MACS) - enrichment of transplantable rod photoreceptor precursors isolated from the neonatal retina of photoreceptor-specific reporter mice based on the cell surface marker CD73. Incubation with anti-CD73 antibodies followed by micro-bead conjugated secondary antibodies allowed the enrichment of rod photoreceptor precursors by MACS to approximately 90%. In comparison to flow cytometry, MACS has the advantage that it can be easier applied to GMP standards and that high amounts of cells can be sorted in relative short time periods. Injection of enriched cell suspensions into the subretinal space of adult wild-type mice resulted in a 3-fold higher integration rate compared to unsorted cell suspensions.

Cell transplantation represents a strategy for the treatment of retinal degeneration characterized by photoreceptor loss. Here we describe a method for enrichment of transplantable photoreceptors and their subretinal grafting into adult mice.

Vision impairment and blindness due to the loss of the light-sensing cells of the retina, i.e. photoreceptors, represents the main reason for disability ...

Medicine

Generation of Induced Pluripotent Stem Cells by Reprogramming Mouse Embryonic Fibroblasts with a Four Transcription Factor, Doxycycline Inducible Lentiviral Transduction System

Using a defined set of transcription factors and cell culture conditions, Yamanaka and colleagues demonstrated that retrovirus-mediated delivery and expression of Oct4, Sox2, c-Myc, and Klf4 is capable of inducing pluripotency in mouse fibroblasts.1 Subsequent reports have demonstrated the utility of the doxycycline (DOX) inducible lentiviral delivery system for the generation of both primary and secondary iPS cells from a variety of other adult mouse somatic cell types.2,3
Induced pluripotent stem (iPS) cells are similar to embryonic stem (ES) cells in morphology, proliferation and ability to induce teratoma formation. Both types of cell can be used as the pluripotent starting material for the generation of differentiated cells or tissues in regenerative medicine.4-6 iPS cells also have a distinct advantage over ES cells as they exhibit key properties of ES cells without the ethical dilemma of embryo destruction.
Here we demonstrate the protocol for reprogramming mouse embryonic fibroblast (MEF) cells with the Stemgent DOX Inducible Mouse TF Lentivirus Set. We also demonstrate that the Stemgent DOX Inducible Mouse TF Lentivirus Set is capable of expressing each of the four transcription factors upon transduction into MEFs thereby inducing a pluripotent stem cell state that displays the pluripotency markers characteristic of ES cells.

The Stemgent Dox Inducible Mouse TF Lentivirus Set can reprogram mouse embryonic fibroblasts (MEFs) to induced pluripotent stem (iPS) cells. Here we demonstrate the protocol for DOX-inducible expression of mouse reprogramming transcription factors Oct4, Sox2, Klf4 and c-Myc to generate iPS colonies that express common mES pluripotency markers.

Using a defined set of transcription factors and cell culture conditions, Yamanaka and colleagues demonstrated that retrovirus-mediated delivery and ...

Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with muscular dystrophy is an invaluable cellular source for in&#160;vitro disease model systems and can be used for drug screening studies. Patient-derived urine cells have been used in successful reprogramming into induced pluripotent stem cells in order to model dystrophic cardiomyopathy1. Addressing the safety concerns of integrating vector systems, we present a protocol using a non-integrating Sendai virus vector for transduction of Yamanaka factors into urine cells collected from patients with muscular dystrophy. This protocol generates fully reprogrammed clones within 2&#8211;3 weeks. The pluripotent cells are vector-free by passage-13. These dystrophic iPSCs can be differentiated into cardiomyocytes and used either to study disease mechanisms or for drug screening.

This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction.

Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with ...

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells (iPSCs) Using Retroviral Vector with GFP

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has been previously shown that human somatic cells can be reprogrammed to pluripotency by ectopic expression of four transcription factors (Oct4, Sox2, Klf4 and Myc) and become induced pluripotent stem cells (iPSCs)2-4 . Like hESCs, human iPSCs are pluripotent and a potential source for autologous cells. Here we describe the protocol to reprogram human fibroblast cells with the four reprogramming factors cloned into GFP-containing retroviral backbone4. Using the following protocol, we generate human iPSCs in 3-4 weeks under human ESC culture condition. Human iPSC colonies closely resemble hESCs in morphology and display the loss of GFP fluorescence as a result of retroviral transgene silencing. iPSC colonies isolated mechanically under a fluorescence microscope behave in a similar fashion as hESCs. In these cells, we detect the expression of multiple pluripotency genes and surface markers.

Reprogramming Human Somatic Cells into Induced Pluripotent Stem Cells iPSCs Using Retroviral Vector with GFP

A method to generate human induced pluripotent stem cells (iPSCs) via retrovirus-mediated ectopic expression of OCT4, SOX2, KLF4 and MYC is described. A practical way to identify human iPSC colonies based on GFP expression is also discussed.

Human embryonic stem cells (hESCs) are pluripotent and an invaluable cellular sources for in vitro disease modeling and regenerative medicine1. It has ...

Enrichment and Purging of Human Embryonic Stem Cells by Detection of Cell Surface Antigens Using the Monoclonal Antibodies TG30 and GCTM-2

Human embryonic stem cells (hESC) can self-renew indefinitely in vitro, and with the appropriate cues can be induced to differentiate into potentially all somatic cell lineages. Differentiated hESC derivatives can potentially be used in transplantation therapies to treat a variety of cell-degenerative diseases. However, hESC differentiation protocols usually yield a mixture of differentiated target and off-target cell types as well as residual undifferentiated cells. For the translation of differentiated hESC-derivatives from the laboratory to the clinic, it is important to be able to discriminate between undifferentiated (pluripotent) and differentiated cells, and generate methods to separate these populations. Safe application of hESC-derived somatic cell types can only be accomplished with pluripotent stem cell-free populations, as residual hESCs could induce tumors known as teratomas following transplantation. Towards this end, here we describe a methodology to detect pluripotency associated cell surface antigens with the monoclonal antibodies TG30 (CD9) and GCTM-2 via fluorescence activated cell sorting (FACS) for the identification of pluripotent TG30Hi-GCTM-2Hi hESCs using positive selection. Using negative selection with our TG30/GCTM-2 FACS methodology, we were able to detect and purge undifferentiated hESCs in populations undergoing very early-stage differentiation (TG30Neg-GCTM-2Neg). In a further study, pluripotent stem cell-free samples of differentiated TG30Neg-GCTM-2Neg cells selected using our TG30/GCTM-2 FACS protocol did not form teratomas once transplanted into immune-compromised mice, supporting the robustness of our protocol. On the other hand, TG30/GCTM-2 FACS-mediated consecutive passaging of enriched pluripotent TG30Hi-GCTM-2Hi hESCs did not affect their ability to self-renew in vitro or their intrinsic pluripotency. Therefore, the characteristics of our TG30/GCTM-2 FACS methodology provide a sensitive assay to obtain highly enriched populations of hPSC as inputs for differentiation assays and to rid potentially tumorigenic (or residual) hESC from derivative cell populations.

We describe the use of the monoclonal antibodies TG30 (CD9) and GCTM-2 for the combined detection of cell surface antigens via fluorescence activated cell sorting (FACS) for the identification and enrichment of live human embryonic stem cells (hESC) using positive selection&#160;and also the use of negative selection to purge hESCs from a mixed cell population.

Human embryonic stem cells (hESC) can self-renew indefinitely in vitro, and with the appropriate cues can be induced to differentiate into potentially all ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video