The authors are funded from the Corus, MedSys Cell Entry, CHAIN and Resina projects.

The protocol is summarized in Fig. 4.
1. Collection of blood samples
<ol>
 <li>Collect at least 3 ml blood in EDTA tubes at the clinical site.</li>
 <li>The samples can be stored up to a week at 4&deg;C.</li>
 <li>Send the EDTA-blood samples as soon as possible to the laboratory by ordinary mail.</li>
</ol>
2. Isolation of HIV RNA and/or DNA
<ol>
 <li>Obtain viral RNA and/or DNA from 1000 &mu;l whole blood, serum or plasma, using the MagNA Pure Compact Nucleic Acid Isolation I kit I and the MagNA Pure Compact System.</li>
 <li>Elute the gained RNA or DNA in 50 &mu;l TE buffer. Alternatively, other nucleic acids purification procedures may be used.</li>
</ol>
3. Amplification of the env region
Amplify the env region (Figs. 2 and 4) from either plasma RNA or proviral DNA. A 1245 bp-long product, comprising the majority of the Env protein (nt 6556-7811 according to HXB2) is generated.
<ol>
 <li>RNA samples: RT-PCR reaction
 <ol>
 <li>Viral RNA presents a very complex secondary structure (Fig. 4) that may hinder the RT reaction. To avoid this problem, incubate 10 &mu;l RNA at 65&deg;C for 10 minutes (already in the PCR tube and in the PCR machine) and then reduce the temperature to 50&deg;C.</li>
 <li>Add 40 &mu;l of the PCR Master Mix including the primers Env-F and Env-R.
 Master Mix for RT-PCR In-House-System: 
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>RNase-free H2O</td>
 <td>14.4</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>5x Buffer (Qiagen OneStep RT-PCR Kit)</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>400 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Enzym-Mix (Qiagen OneStep RT-PCR Kit)</td>
 <td>2</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Primer Env-F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>RNase Inhibitor (RNasin)</td>
 <td>1</td>
 <td>5 units/reaction</td>
 </tr>
 </tbody>
 </table>
 Env-F: 5'- CAAAGCCTAAAGCCATGTGTAAA -3' (nt 6556&rarr;6586 according to HXB2)
 Env-R: 5'- AGTGCTTCCTGCTGCTCCTAAGAACCC -3' (nt 7785&larr;7811)</li>
 <li>Run the RT reaction at 50&deg;C for 30 minutes.</li>
 <li>Run the first PCR as follows:
 
 <table border="1">
 <tbody>
 <tr>
 <td>95&deg;C, 15min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 50&deg;C, 30 sec 
 72&deg;C, 2 min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 56&deg;C, 30 sec 
 72&deg;C, 2 min</td>
 <td>38 x</td>
 </tr>
 <tr>
 <td>72&deg;C, 10 min 
 4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
 </ol>
 </li>
 <li>DNA samples: PCR reaction
 For proviral DNA samples, no initial RT reaction is needed, and the PCR reaction can directly start.
 <ol>
 <li>Add 40 &mu;l of PCR Master Mix to 10 &mu;l of provial DNA. 
 Master Mix for PCR In-House-System: 
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>RNase-free H2O</td>
 <td>15.4</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>5x Buffer (HotStarTaq DNA Polymerase)</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>400 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Enzym-Mix (HotStarTaq DNA Polymerase)</td>
 <td>2</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>Primer Env-F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 </tbody>
 </table>
 Env-F: 5'- CAAAGCCTAAAGCCATGTGTAAA -3' (nt 6556&rarr;6586)
 Env-R: 5'- AGTGCTTCCTGCTGCTCCTAAGAACCC -3' (nt 7785&larr;7811)</li>
 <li>Run the PCR conditions as previously described for RNA samples (Step 3.1.4).</li>
 </ol>
 </li>
</ol>
4. Amplification of the V3 region: nested PCR
<ol>
 <li>For the nested PCR, use 5 &mu;l from the first PCR reaction (without previous analysis in agarose gel) as template and add 95 &mu;l of PCR Master Mix.
 Master Mix for Nested-In-House PCR
 <table border="1">
 <tbody>
 <tr>
 <td>&nbsp;</td>
 <td>volume/reaction (&mu;l)</td>
 <td>final concentration</td>
 </tr>
 <tr>
 <td>H2O</td>
 <td>61.9</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>10x PCR Buffer</td>
 <td>10</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>5x Q-Solution</td>
 <td>20</td>
 <td>1x</td>
 </tr>
 <tr>
 <td>dNTP Mix (10 mM each)</td>
 <td>2</td>
 <td>200 &mu;M of each dNTP</td>
 </tr>
 <tr>
 <td>Primer Env-2F (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>Primer Env-2R (100 &mu;M)</td>
 <td>0.3</td>
 <td>0.6 &mu;M</td>
 </tr>
 <tr>
 <td>HotStarTaq DNA Polymerase</td>
 <td>0.5</td>
 <td>2,5 units/reaction</td>
 </tr>
 </tbody>
 </table>
 Env-2F: 5'- GTCCAAAGGTATCCTTTGAGCCAATTC -3' (nt 6838&rarr;6864)
 Env-2R: 5'- CACCACTCTTCTCTTTGCCTTGGTGGGTGC -3' (nt 7712&larr;7742)</li>
 <li>Run the PCR as follows:
 <table border="0">
 <tbody>
 <tr>
 <td> 
 93&deg;C, 15min</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 50&deg;C, 30 sec 
 72&deg;C, 90 sec</td>
 <td>1 x</td>
 </tr>
 <tr>
 <td>95&deg;C, 30 sec 
 56&deg;C, 30 sec 
 72&deg;C, 90 sec</td>
 <td>43 x</td>
 </tr>
 <tr>
 <td>72&deg;C, 10 min 
 4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
 <li>Analyze the PCR product on a 1% agarose gel (Fig. 4). The expected product is 902 bp-long.</li>
 <li>Purification of the sequencing samples.
 <ol>
 <li>Purify the PCR product with the Qiagen PCR-Purification kit, using the protocol, solutions and micro-columns provided by the supplier. Elute in 30-100 &mu;l PE buffer, depending on band intensity.</li>
 <li>Alternatively, the samples can be purified using Exonuclease I and Fast AP (Thermo alkaline phosphatase). For this purpose, add 6 &mu;l Exo-AP Mix to 15 &mu;l PCR product and incubate 15 minutes at 37&deg;C.
 <table border="1">
 <tbody>
 <tr>
 <td>580 &mu;l H2O</td>
 </tr>
 <tr>
 <td>66 &mu;l fast AP</td>
 </tr>
 <tr>
 <td>13.4 &mu;l Exo I</td>
 </tr>
 </tbody>
 </table>
 </li>
 </ol>
 </li>
</ol>
5. Sequence reaction of the V3 amplicon
<ol>
 <li>The sequence reaction consists of a PCR reaction using only one of the following primers:
 Env-2: 5'- GTACAATGYACACATGGAATTAGGC -3 (nt 6959&rarr;6980) 
 Env-5: 5'- AAAATTCCCCTCCACAATTA - 3' (nt 7352&larr;7371) 
 Env-6: 5'- GGCCAGTAGTATCAACTCAAC - 3' (nt 6979&rarr;7000) 
 Env-7: 5'- TGTCCACTGATGGGAGGGGC - 3' (nt 7530&larr;7549) 
 Env-10: 5' - GCAGAATAAAACAAATTATAAACATGTGGC - 3' (nt 7478&larr;7507) 
 Env-11: 5' - TACATTGCTTTTCCTACTTTCTGCCAC - 3' (nt 7638&larr;7664) 
 First choice primers are: Env-2, Env-6 or Env-7, Env-11</li>
 <li>Use 1 &mu;l from the purified V3 amplicon as template and add 9 &mu;l of PCR master-mix.
 Sequencing Master Mix:
 <table border="1">
 <tbody>
 <tr>
 <td>4 &mu;l sequence mix (HIV-Genotyping Kit)</td>
 </tr>
 <tr>
 <td>4 &mu;l H2O</td>
 </tr>
 <tr>
 <td>1 &mu;l Primer (100 pmol/&mu;l)</td>
 </tr>
 </tbody>
 </table>
 </li>
 <li>Run the sequence reaction as follows:
 <table border="0">
 <tbody>
 <tr>
 <td>96&deg;C, 10 sec</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>50&deg;C, 10 sec</td>
 <td>36 x</td>
 </tr>
 <tr>
 <td>60&deg;C, 45 sec</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>4&deg;C &infin;</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
 </table>
 </li>
</ol>
6. Purification of the sequencing samples
Purify sequences using Sephadex G-50 superfine.
<ol>
 <li>Fill the appropriate number of wells in the "column loader" with Sephadex G-50 superfine. Transfer the Sephadex to the filter plate MAHVN4510 by turning over.</li>
 <li>Add 300 &mu;l Milli-Q H2O to each well in the filter plate, and incubate it for at least 3h at 2-8&deg;C.</li>
 <li>Centrifuge the plates for 5 min at 910Xg and 4-15&deg;C. Discard the flow-through.</li>
 <li>Add 10 &mu;l H2O to the sequence product and then pipet the sequence on the swelled Sephadex plate.</li>
 <li>To gain the purified product, centrifuge the plate for 5 min. at 910Xg and 4-15&deg;C and collect the flow-through.</li>
</ol>
7. Sequencing the purified samples on the sequencer ABI Prism 3130 XL
<ol>
 <li>Before each run, change the buffer and check the volume of the polymer (POP7). If needed, replace the old polymer flask by a new one.</li>
 <li>Use the saved run conditions, including an injection time of 18 seconds.</li>
 <li>In this machine, the collection of the signal data of one run with 16 sequence samples takes about 60 min (36 cm capillary) or 150 min (50 cm capillary).</li>
</ol>
8. Sequence editing
<ol>
 <li>Use the program Lasergene (DNA-Star) to align and edit the sequences (Fig. 5). Other sequence editing programs may be used. Use a "V3-Consensus B" and the env consensus sequence as references.</li>
 <li>Lasergene creates a consensus sequence of the analysed sample using all the raw data available and store it as FASTA file. The FASTA file is a text file that includes a header with the name of the sample and the nucleotide sequence.</li>
</ol>
9. Sequencing data interpretation and tropism prediction
<ol>
 <li>Sequencing data interpretation is performed by the web-based interpretation system geno2pheno[coreceptor] (<a href="http://coreceptor.bioinf.mpi-inf.mpg.de/index.php">http://coreceptor.bioinf.mpi-inf.mpg.de/index.php</a>). For the tropism prediction, different FPR settings can be selected. The default setting is according to the German-Austrian therapy guidelines. For FPR &ge; 20%, the virus is classified as R5 when FPR &ge; 20% and X4 for FPR &lt; 12.5%.</li>
 <li>Upload the FASTA file into the server. This server translates the nucleotide sequence into amino acids, aligns it with the V3-Consensus B sequence and produces a subtype classification. In addition, it generates a prediction of the coreceptor usage (Fig. 4) expressed as false positive rate (FPR).</li>
</ol>
10. Representative Results
The geno2pheno[coreceptor] output shows a graded interpretation of the tropism. Depending on the likelihood of the coreceptor usage, the interpretation text and background color varies from green (&lt;20% FPR), suggesting a safe administration for MVC, to yellow, suggesting a possible, low risk and finally to red. Red is the color suggesting not to prescribe MVC. In addition, the server generates a pdf report that can be printed, filled in with patient's and sample data, and sent to the physician. Examples of geno2pheno[coreceptor] output are depicted in Fig. 6.
<img alt="Figure 1" src="/files/ftp_upload/3264/3264fig1.jpg" /> 
Figure. 1. Schematic replication of HIV. The virion must bind to the cellular CD4 as receptor and to either the CCR5 or CXCR4 as coreceptor. The coreceptor CCR5 can be blocked with CCR5 antagonists like Maraviroc (MVC, Celsentri, Selzentry). After fusion of the viral and cellular membranes, the viral nucleocapsid is released in the cytoplasm. The nucleocapsid disassembles and the viral RNA complex is liberated into the cytoplasm. The viral reverse transcriptase (RT) transcribes the genomic RNA into proviral DNA, that is then transported to the nucleus and integrated into the host genome by the HIV integrase. Cellular RNA polymerases transcribe viral genomic and messenger RNAs from the proviral genome. The viral proteins are produced in the cytoplasm and transported to the cell surface. The virus particles bud as immature, non-infectious virions from the cells. The HIV protease cleaves the proteins producing to infectious particles. Inhibition of one of the steps leads to an interruption of the replication cycle.
The antiretroviral drugs and the replication step that they inhibit are marked in red.
The viral RNA and proviral DNA (material used for tropism or resistance analysis) are marked in green.


<img alt="Figure 2" src="/files/ftp_upload/3264/3264fig2.jpg" /> 
Figure 2. HIV proviral genome. The HIV particle is built with different structural proteins and houses various enzymes and proteins both from viral and cellular origin. The figure shows the location of the genes within the viral genome. The surface proteins gp120 and gp41 constitute spikes on the surface of the virion and contact the human cell to perform the membrane fusion. In the lower part of the figure, the PCR amplification products and the primers used in our protocol are shown.
<img alt="Figure 3" src="/files/ftp_upload/3264/3264fig3.jpg" /> 
Figure 3. Proportion of patients with low viral load (VL) measurements analyzed for drug-resistance or tropism determination at the Institute of Virology, University of Cologne (Germany).


<img alt="Figure 4" src="/files/ftp_upload/3264/3264fig4.jpg" /> 
Figure 4. Overall scheme of the experiment.. Please <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/3264/3264fig4_lg.jpg">click here</a> to see a larger version of this figure.
<img alt="Figure 5" src="/files/ftp_upload/3264/3264fig5.jpg" /> 
Figure 5. Sequence editing with Lasergene. The V3 amplicon is sequenced with at least one forward and one reverse primer. Lasergene alignes the ".abi" files obtained from the sequencer with the reference sequences "V3-Consensus B" and env. Lasergene creates a consensus sequence using all the row data available. The reference sequences can be marked (and are then displayed in grey) so that they do not contribute to the sample consensus sequence.
<img alt="Figure 6" src="/files/ftp_upload/3264/3264fig6.jpg" /> 
Figure 6. Tropism prediction reports generated by the geno2pheno[coreceptor] tool.The reports are generated as pdf files that can be saved and completed in the computer. Additional data such us patient's name, date of blood extraction, etc., can be manually included using a pdf writer program. Specific comments can be also added. These data are exclusively on the user's computer and not on the geno2pheno[coreceptor] server. Please <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/3264/3264fig6_lg.jpg">click here</a> to see a larger version of this figure.

<ol><li>Heger, E., Schuelter, E., Klimkait, T., Lengauer, T., Kaiser, R., Walter, H., Sierra, S. European coreceptor proficiency panel test. 9th European Workshop on HIV & Hepatitis Treatment Strategies & Antiviral Drug Resistance, Paphos, Cyprus, , (2011).</li>
<li>Lengauer, T., Sander, O., Sierra, S., Thielen, T., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Bioinformatic+prediction+of+HIV+coreceptor+usage%5BTitle%5D)+AND+%22Nature+Biotech%22%5BJournal%5D)">Bioinformatic prediction of HIV coreceptor usage.</a> Nature Biotech. 25 (12), 1407-1410 (2007).</li>
<li>McGovern, R., Dong, W., Zhong, X., Knapp, D., Thielen, A., Chapman, D., Lewis, M., James, I., Valdez, H., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Population-based+Sequencing+of+the+V3-loop+Is+Comparable+to+the+Enhanced+Sensitivity+Trofile+Assay+in+Predicting+Virologic+Response+to+Maraviroc+of+Treatment-na+ve+Patients+in+the+MERIT+Trial%5BTitle%5D)+AND+%22%22%5BJournal%5D)">Population-based Sequencing of the V3-loop Is Comparable to the Enhanced Sensitivity Trofile Assay in Predicting Virologic Response to Maraviroc of Treatment-na ve Patients in the MERIT Trial.</a> 17th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, , (2010).</li>
<li>Reuter, S., Braken, P., Jensen, B., Sierra-Aragon, S., Oette, M., Balduin, M., Kaiser, R., Haussinger, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Maraviroc+in+treatment-experienced+patients+with+HIV-1+infection+-+experience+from+routine+clinical+practice%5BTitle%5D)+AND+%22Eur.+J.+Med.+Res%22%5BJournal%5D)">Maraviroc in treatment-experienced patients with HIV-1 infection - experience from routine clinical practice.</a> Eur. J. Med. Res. 15 (6), 231-237 (2010).</li>
<li>Recordon-Pinson, P., Soulie, C., Flandre, P., Descamps, D., Lazrek, M., Charpentier, C., Montes, B., Trabaud, M. A., Cottalorda, J., Schneider, V., Morand-Joubert, L., Tamalet, C., Desbois, D., Mace, M., Ferre, V., Vabret, A., Ruffault, A., Pallier, C., Raymond, S., Izopet, J., Reynes, J., Marcelin, A. G., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Evaluation+of+the+genotypic+prediction+of+HIV-1+coreceptor+use+versus+a+phenotypic+assay+and+correlation+with+the+virological+response+to+maraviroc%3A+the+ANRS+GenoTropism+study%5BTitle%5D)+AND+%22Antimicrob.+Agents.+Chemother%22%5BJournal%5D)">Evaluation of the genotypic prediction of HIV-1 coreceptor use versus a phenotypic assay and correlation with the virological response to maraviroc: the ANRS GenoTropism study.</a> Antimicrob. Agents. Chemother. 54 (8), 3335-3340 (2010).</li>
<li>Swenson, L. C., Knapp, D., Harrigan, P. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Calibration+and+accuracy+of+the+geno2pheno+co-receptor+algorithm+for+predicting+HIV+tropism+for+single+and+triplicate+measurements+of+V3+genotype%5BTitle%5D)+AND+%22%22%5BJournal%5D)">Calibration and accuracy of the geno2pheno co-receptor algorithm for predicting HIV tropism for single and triplicate measurements of V3 genotype.</a> 10th International Congress on Drug Therapy in HIV Infection, Glasgow, UK, , (2010).</li>
<li>Macartney, M. J., Cameron, J., Strang, A., García, A., Booth, C., Marshall, N., Johnson, M., Geretti, A. M. Use of a genotypic assay for the prediction of HIV-1 coreceptor tropism and guiding the use of CCR5 antagonists in clinical practice. 8th European HIV Drug Resistance Workshop, Sorrento, Italy, , (2010).</li>
<li>Sierra, S., Thielen, A., Reuter, S., Jensen, B., Esser, S., Fätkenheuer, G., Lengauer, T., Pfister, H., Sichtig, N., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tropism+determination+and+clinical+outcome+of+61+patients+under+MVC+treatment%5BTitle%5D)+AND+%22%22%5BJournal%5D)">Tropism determination and clinical outcome of 61 patients under MVC treatment.</a> 8th European HIV Drug Resistance Workshop, Sorrento, Italy, , (2010).</li>
<li>Obermeier, M., Carganico, A., Bieniek, B., Schleehauf, D., Dupke, S., Fischer, K., Freiwald, M., Neifer, S., Schuler, C., Mayr, C., Klausen, G., Köppe, S., üünsche, T., Berg, T., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Tropism+testing+from+proviral+DNA+-+analysis+of+a+subgroup+from+the+Berlin+Maraviroc+cohort%5BTitle%5D)+AND+%22%22%5BJournal%5D)">Tropism testing from proviral DNA - analysis of a subgroup from the Berlin Maraviroc cohort.</a> 8th European HIV Drug Resistance Workshop, Sorrento, Italy, , (2010).</li>
<li>Vandekerckhove, L. P., Wensing, A. M., Kaiser, R., Brun-Vezinet, F., Clotet, B., De Luca, A., Dressler, S., Garcia, F., Geretti, A. M., Klimkait, T., Korn, K., Masquelier, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((European+guidelines+on+the+clinical+management+of+HIV-1+tropism+testing%5BTitle%5D)+AND+%22Lancet+Infect+Dis%22%5BJournal%5D)">European guidelines on the clinical management of HIV-1 tropism testing.</a> Lancet Infect Dis. 11 (5), 394-407 (2011).</li>
<li>Walter, H., Eberle, J., Möller, H., Noah, C., Wolf, E., St rmer, M., Braun, P., Krn, K., D umer, M., Berg, T., Obermeier, M., Thielen, A., Kaiser, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Empfehlung+zur+Bestimmung+des+HIV-1-Korezeptor-Gebrauchs+%28DAIG+Recommendations+for+the+HIV-1+tropism+testing%29%5BTitle%5D)+AND+%22%22%5BJournal%5D)">Empfehlung zur Bestimmung des HIV-1-Korezeptor-Gebrauchs (DAIG Recommendations for the HIV-1 tropism testing).</a> , (2011).</li>
<li>Obermeier, M. J., Carganico, A., Dupke, S., Schranz, D., Cordes, C., Freiwald, M., Klausen, G., Köppe, S., Schuler, C., Mayr, C., Schleehauf, D., Berg, T., Krznaric, I., Baumgarten, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/pubmed?term=((Clinical+application+of+genotypic+co-receptor+tropism+testing+from+viral+RNA+and+proviral+DNA%3A+week+24+analysis+of+the+Berlin+maraviroc+cohort%5BTitle%5D)+AND+%22Journal+of+the+International+AIDS+Society%22%5BJournal%5D)">Clinical application of genotypic co-receptor tropism testing from viral RNA and proviral DNA: week 24 analysis of the Berlin maraviroc cohort.</a> Journal of the International AIDS Society. 13, Suppl . 4. 129-129 (2010).</li>
<li>Toma, J., Frantzell, A., Hoh, R., Martin, J., Deeks, S., Petropoulos, C., Huang, W. Determining HIV-1 Co-receptor Tropism Using PBMC Proviral DNA Derived from Aviremic Blood Samples. 18th Conference on Retroviruses and Opportunistic Infections, San Francisco, USA, , (2010).</li>
</ol>

This video article is sponsored by ViiV Healthcare and GlaxoSmithKline.

The V3 sequence permits a reliable viral tropism prediction, as shown in clinical studies3-9. In fact, genotypic determination is contemplated in the current European and German-Austrian guidelines10. 
Compared to phenotypic testing, not only is the turnover time shorter (equivalent to resistance testing), but also are the costs. In addition, a major advantage of genotypic testing is that the results are graded as FPR and therefore can be adapted to the patients' needs. Trofile results, on the other hand, are simply R5 or X4 reports, and access to the raw data is not given.
Currently, The European guidelines suggest a FPR cut-off of 20%10, while the Austrian-German guidelines allow adapting the FPR cut-off specifically to each patient's needs11. In this line, for patients with a broad range of antiretroviral drugs options, higher FPR cut-offs (&gt; 20%) are recommended. Conversely, for heavily pre-treated patients with limited therapeutic options, lower FPR cut-offs (&gt; 5%) may be used. This kind of therapy guidance is currently ongoing by the resistance testing to NRTIs, NNRTIs, PIs, and INIs, where partially-active drugs may be included in the treatment for patients with reduced therapeutic options. In addition, with growing numbers of genotypically-guided therapy changes, the clinically-relevant FPR cut-offs are constantly being adjusted by a panel of bioinformaticians, virologists and clinicians.
Another important advantage of the genotypic tropism testing is the possibility of analyzing clinical samples with very low or even undetectable viral load (VL). In this cases, when plasma RNA is not amplifiable, the proviral DNA can be sequenced and used for reliable predictions9,12. Of note, the number of patients with low or undetectable viral load has sharply increased in the latest years. To date, the Trofile assay only allows the analysis of samples from patients with VL&lt;1000 copies/ml. However, preliminary studies have shown that proviral DNA may be also adecuate to be tested by Trofile13.

<table><tbody><tr><td>MagNA Pure Compact Nucleic Acid Isolation Kit I</td><td>Roche Group</td><td>04 802 993 001</td><td></td></tr><tr><td>MagNA Pure Compact System</td><td>Roche Group</td><td>03731146001</td><td></td></tr><tr><td>T3000 Thermocycler</td><td>Biometra</td><td>050-723</td><td></td></tr><tr><td>One Step RT-PCR Kit</td><td>Qiagen</td><td>210215</td><td></td></tr><tr><td>HotStarTaq Master Mix Kit</td><td>Qiagen</td><td>203445</td><td></td></tr><tr><td>QIAquick PCR Purification Kit</td><td>Qiagen</td><td>28106</td><td></td></tr><tr><td>Exonuclease I (Exo I)</td><td>Fermentas</td><td>EN0582</td><td></td></tr><tr><td>FastAP Thermosensitive Alkaline Phosphatase</td><td>Fermentas</td><td>EF0651</td><td></td></tr><tr><td>BigDye Terminator v3.1 Cycle Sequencing Kit</td><td>Applied Biosystems</td><td>4337457</td><td></td></tr><tr><td>Sephadex G-50 Superfine</td><td>GE Healthcare</td><td>17-0041-01</td><td></td></tr><tr><td>ABI Prism &lt;em&gt;3130 XL&lt;/em&gt; capillary sequencer</td><td>Applied Biosystems</td><td>3130XL</td><td></td></tr></tbody></table>

prediction of hiv-1 coreceptor usage (tropism) by sequence analysis using a genotypic approach

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by the majority of HIV strains in order to infect the human immune cells (Fig. 1). Other HIV isolates use a different coreceptor, the CXCR4. Which receptor is used, is determined in the virus by the Env protein (Fig. 2). Depending on the coreceptor used, the viruses are classified as R5 or X4, respectively. MVC binds to the CCR5 receptor inhibiting the entry of R5 viruses into the target cell. During the course of disease, X4 viruses may emerge and outgrow the R5 viruses. Determination of coreceptor usage (also called tropism) is therefore mandatory prior to administration of MVC, as demanded by EMA and FDA. 
The studies for MVC efficiency MOTIVATE, MERIT and 1029 have been performed with the Trofile assay from Monogram, San Francisco, U.S.A. This is a high quality assay based on sophisticated recombinant tests. The acceptance for this test for daily routine is rather low outside of the U.S.A., since the European physicians rather tend to work with decentralized expert laboratories, which also provide concomitant resistance testing. These laboratories have undergone several quality assurance evaluations, the last one being presented in 20111.
For several years now, we have performed tropism determinations based on sequence analysis from the HIV env-V3 gene region (V3)2. This region carries enough information to perform a reliable prediction. 
The genotypic determination of coreceptor usage presents advantages such as: shorter turnover time (equivalent to resistance testing), lower costs, possibility to adapt the results to the patients' needs and possibility of analysing clinical samples with very low or even undetectable viral load (VL), particularly since the number of samples analysed with VL&lt;1000 copies/&mu;l roughly increased in the last years (Fig. 3).
The main steps for tropism testing (Fig. 4) demonstrated in this video: 
1. Collection of a blood sample 
 2. Isolation of the HIV RNA from the plasma and/or HIV proviral DNA from blood mononuclear cells 
 3. Amplification of the env region 
 4. Amplification of the V3 region 
 5. Sequence reaction of the V3 amplicon 
 6. Purification of the sequencing samples 
 7. Sequencing the purified samples 
 8. Sequence editing 
 9. Sequencing data interpretation and tropism prediction

Watch this Scientific Journal Video about Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach at JoVE.com

Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

The prediction of the coreceptor usage of HIV-1 is required for the administration of a new class of antiretroviral drugs, i.e. coreceptor antagonists. It can be performed by sequence analysis of the env gene and subsequent interpretation through an internet based interpretation system (geno2pheno[coreceptor]).

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

Maraviroc (MVC) is the first licensed antiretroviral drug from the class of coreceptor antagonists. It binds to the host coreceptor CCR5, which is used by ...

<a class="grey_button" href="https://www-jove-com.remotexs.ntu.edu.sg/video/4153"> Espa&ntilde;ol </a>

prediction-hiv-1-coreceptor-usage-tropism-sequence-analysis-using

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

13.3K Views.  University of Cologne.  Español 

Video: Prediction of HIV-1 Coreceptor Usage Tropism by Sequence Analysis using a Genotypic Approach

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' surface envelope glycoprotein. We previously proposed that the crown of the V3 loop, although dynamic and sequence variable, is constrained throughout the population of HIV-1 viruses to an immunologically relevant &beta;-hairpin tertiary structure. Importantly, there are thousands of different V3 loop crown sequences in circulating HIV-1 viruses, making 3D structural characterization of trends across the diversity of viruses difficult or impossible by crystallography or NMR. Our previous successful studies with folding of the V3 crown1, 2 used the ab initio algorithm 3 accessible in the ICM-Pro molecular modeling software package (Molsoft LLC, La Jolla, CA) and suggested that the crown of the V3 loop, specifically from positions 10 to 22, benefits sufficiently from the flexibility and length of its flanking stems to behave to a large degree as if it were an unconstrained peptide freely folding in solution. As such, rapid ab initio folding of just this portion of the V3 loop of any individual strain of the 60,000+ circulating HIV-1 strains can be informative. Here, we folded the V3 loop of the R2 strain to gain insight into the structural basis of its unique properties. R2 bears a rare V3 loop sequence thought to be responsible for the exquisite sensitivity of this strain to neutralization by patient sera and monoclonal antibodies4, 5. The strain mediates CD4-independent infection and appears to elicit broadly neutralizing antibodies. We demonstrate how evaluation of the results of the folding can be informative for associating observed structures in the folding with the immunological activities observed for R2.

Assessment of Immunologically Relevant Dynamic Tertiary Structural Features of the HIV-1 V3 Loop Crown R2 Sequence by ab initio Folding

The crown region of different V3 loop sequences of the surface envelope glycoprotein (gp120) of HIV-1 can be structurally characterized in many cases by in silico folding of positions 10 to 22 of the loop using a state-of-the-art ab initio folding algorithm. Here we demonstrate the folding and evaluation of this region of the V3 loop from the R2 strain of HIV-1, a uniquely neutralization sensitive strain with puzzling functional properties.

The antigenic diversity of HIV-1 has long been an obstacle to vaccine design, and this variability is especially pronounced in the V3 loop of the virus' ...

Genotypic Inference of HIV-1 Tropism Using Population-based Sequencing of V3

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her viral population uses the CCR5 coreceptor for cellular entry, and not an alternative coreceptor. One approach to tropism testing is to examine the sequence of the V3 region of the HIV envelope, which interacts with the coreceptor.
Methods: Viral RNA is extracted from blood plasma. The V3 region is amplified in triplicate with nested reverse transcriptase-PCR. The amplifications are then sequenced and analyzed using the software, RE_Call. Sequences are then submitted to a bioinformatic algorithm such as geno2pheno to infer viral tropism from the V3 region. Sequences are inferred to be non-R5 if their geno2pheno false positive rate falls below 5.75%. If any one of the three sequences from a sample is inferred to be non-R5, the patient is unlikely to respond to a CCR5-antagonist.

HIV tropism can be inferred from the V3 region of the viral envelope. V3 is PCR amplified in triplicate using nested RT-PCR, sequenced, and interpreted using bioinformatic software. Samples with with 1 or more sequence(s) with low g2P scores are classified as non-R5 virus.

Background: Prior to receiving a drug from CCR5-antagonist class in HIV therapy, a patient must undergo an HIV tropism test to confirm that his or her ...

Amplifying and Quantifying HIV-1 RNA in HIV Infected Individuals with Viral Loads Below the Limit of Detection by Standard Clinical Assays

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below 50-75 copies/ml) is necessary to gain insight to viral dynamics and virus host interactions in patients who naturally control the infection and those who are on combination antiretroviral therapy (cART). 
Here we describe how to amplify viral genomes by single genome sequencing (the SGS protocol) 13, 19 and how to accurately quantify HIV-1 RNA in patients with low viral loads (the single-copy assay (SCA) protocol) 12, 20. 
The single-copy assay is a real-time PCR assay with sensitivity depending on the volume of plasma being assayed. If a single virus genome is detected in 7 ml of plasma, then the RNA copy number is reported to be 0.3 copies/ml. The assay has an internal control testing for the efficiency of RNA extraction, and controls for possible amplification from DNA or contamination. Patient samples are measured in triplicate.
The single-genome sequencing assay (SGS), now widely used and considered to be non-labor intensive 3, 7, 12, 14, 15,is a limiting dilution assay, in which endpoint diluted cDNA product is spread over a 96-well plate. According to a Poisson distribution, when less than 1/3 of the wells give product, there is an 80% chance of the PCR product being resultant of amplification from a single cDNA molecule. SGS has the advantage over cloning of not being subjected to resampling and not being biased by PCR-introduced recombination 19. However, the amplification success of SCA and SGS depend on primer design. Both assays were developed for HIV-1 subtype B, but can be adapted for other subtypes and other regions of the genome by changing primers, probes, and standards.

Quantifying levels of HIV-1 RNA in plasma and sequencing single HIV-1 genomes from individuals with viral loads below the limit of detection (50-75 copies/ml) is difficult. Here we describe how to extract and quantify plasma viral RNA using a real time PCR assay that reliably measures HIV-1 RNA down to 0.3 copies/ml and how to amplify viral genomes by single genome sequencing, from samples with very low viral loads.

Amplifying viral genes and quantifying HIV-1 RNA in HIV-1 infected individuals with viral loads below the limit of detection by standard assays (below ...

In vitro Uncoating of HIV-1 Cores

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is composed of CA protein arranged as a lattice of hexagon. The capsid is closed by 7 pentamers at the broad end and 5 at the narrow end of the cone1, 2. Encased in this capsid shell is the viral ribonucleoprotein complex, and together they comprise the core.
Following fusion of the viral membrane with the target cell membrane, the HIV-1 is released into the cytoplasm. The capsid then disassembles releasing free CA in the soluble form3 in a process referred to as uncoating. The intracellular location and timing of HIV-1 uncoating are poorly understood. Single amino-acid substitutions in CA that alter the stability of the capsid also impair the ability of HIV-1 to infect cells4. This indicates that the stability of the capsid is critical for HIV-1 infection.
HIV-1 uncoating has been difficult to study due to lack of availability of sensitive and reliable assays for this process. Here we describe a quantitative method for studying uncoating in vitro using cores isolated from infectious HIV-1 particles. The approach involves isolation of cores by sedimentation of concentrated virions through a layer of detergent and into a linear sucrose gradient, in the cold. To quantify uncoating, the isolated cores are incubated at 37&deg;C for various timed intervals and subsequently pelleted by ultracentrifugation. The extent of uncoating is analyzed by quantifying the fraction of CA in the supernatant. This approach has been employed to analyze effects of viral mutations on HIV-1 capsid stability4, 5, 6. It should also be useful for studying the role of cellular factors in HIV-1 uncoating.

In vitro Uncoating of HIV-1 Cores

Uncoating is an essential step in the early phase of the HIV-1 life cycle and is defined as the disassembly of the capsid shell and the release of the viral ribonucleoprotein complex (vRNP). Here, we demonstrate techniques for isolating intact cores from HIV-1 virions and for quantifying their uncoating in vitro.

The genome of the retroviruses is encased in a capsid surrounded by a lipid envelope. For lentiviruses, such as HIV-1, the conical capsid shell is ...

Amplification of Near Full-length HIV-1 Proviruses for Next-Generation Sequencing

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near full-length (intact and defective), HIV-1 proviruses. FLIPS allows determination of the genetic composition of integrated HIV-1 within a cell population. Through identifying defects within HIV-1 proviral sequences that arise during reverse transcription, such as large internal deletions, deleterious stop codons/hypermutation, frameshift mutations, and mutations/deletions in cis acting elements required for virion maturation, FLIPS can identify integrated proviruses incapable of replication. The FLIPS assay can be utilized to identify HIV-1 proviruses that lack these defects and are&#160;therefore potentially replication-competent. The FLIPS protocol involves: lysis of HIV-1 infected cells, nested PCR of near full-length HIV-1 proviruses (using primers targeted to the HIV-1 5&#39; and 3&#39; LTR), DNA purification and quantification, library preparation for Next-generation Sequencing (NGS), NGS, de novo assembly of proviral contigs, and a simple process of elimination for identifying replication-competent proviruses. FLIPS provides advantages over traditional methods designed to sequence integrated HIV-1 proviruses, such as single-proviral sequencing. FLIPS amplifies and sequences near full-length proviruses enabling replication competency to be determined, and also uses fewer amplification primers, preventing the consequences of primer mismatches. FLIPS is a useful tool for understanding the genetic landscape of integrated HIV-1 proviruses, especially within the latent reservoir, however, its utilization can extend to any application in which the genetic composition of integrated HIV-1 is required.

Full-length individual proviral sequencing (FLIPS) provides an efficient and high-throughput method for the amplification and sequencing of single, near full-length (intact and defective) HIV-1 proviruses and allows for determination of their potential replication-competency. FLIPS overcomes limitations of previous assays designed to sequence the latent HIV-1 reservoir.

The Full-Length Individual Proviral Sequencing (FLIPS) assay is an efficient and high-throughput method designed to amplify and sequence single, near ...

Genetics

Determining 3'-Termini and Sequences of Nascent Single-Stranded Viral DNA Molecules during HIV-1 Reverse Transcription in Infected Cells

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and host cell proteins on viral DNA synthesis. Here we address the lack of a cell-based, high-coverage, and high-resolution assay that is capable of defining retroviral reverse transcription intermediates within the physiological context of virus infection. The described method captures the 3'-termini of nascent complementary DNA (cDNA) molecules within HIV-1 infected cells at single nucleotide resolution. The protocol involves harvesting of whole cell DNA, targeted enrichment of viral DNA via hybrid capture, adaptor ligation, size fractionation by gel purification, PCR amplification, deep sequencing, and data analysis. A key step is the efficient and unbiased ligation of adaptor molecules to open 3'-DNA termini. Application of the described method determines the abundance of reverse transcripts of each particular length in a given sample. It also provides information about the (internal) sequence variation in reverse transcripts and thereby any potential mutations. In general, the assay is suitable for any questions relating to DNA 3'-extension, provided that the template sequence is known.

Here we present a deep sequencing approach that provides an unbiased determination of nascent 3&#39;-termini as well as mutational profiles of single-stranded DNA molecules. The main application is the characterization of nascent retroviral complementary DNAs (cDNAs), the intermediates generated during the process of retroviral reverse transcription.

Monitoring of nucleic acid intermediates during virus replication provides insights into the effects and mechanisms of action of antiviral compounds and ...

Next-generation Viral RNA/DNA in situ Hybridization Applications in Human Immunodeficiency Virus/Simian Immunodeficiency Virus Research

In situ hybridization is a powerful technique to identify specific RNA or DNA sequences within individual cells in tissue sections, providing important insights into physiological processes and disease pathogenesis. In situ hybridization (ISH) has been used for many years to assess the location of cells infected by viruses, but recently a next-generation ISH approach was developed with a unique probe design strategy that allows simultaneous signal amplification and background suppression to achieve single-molecule visualization while preserving tissue morphology. This next-generation ISH is based on an approach like branched PCR, but performed in situ and is more facile, sensitive, and reproducible than classical ISH methods or in situ PCR approaches in routinely detecting RNA or DNA in formalin-fixed paraffin embedded (FFPE) tissues. For the last several years our laboratory has been applying this ISH platform for the detection of human immunodeficiency (HIV) and simian immunodeficiency (SIV) viral RNA (vRNA) and/or viral DNA (vDNA) positive cells within a multitude of FFPE tissues. With this detailed technical manuscript, we would like to share our knowledge and advice with all individuals interested in using next-generation ISH in their research.

Here we present a next-generation in situ hybridization assay to identify specific viral RNA or DNA sequences in formalin-fixed paraffin embedded (FFPE) tissues. This approach allows visualization of low copies of RNA and DNA in less than 24 h with very high sensitivity and specificity.

In situ hybridization is a powerful technique to identify specific RNA or DNA sequences within individual cells in tissue sections, providing important ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target conserved portions of the HIV-1 genome that escape with difficulty. Sequence changes attributed to cellular immune pressure arise across the genome during infection, and if found within conserved regions of the genome such as Gag, can affect the ability of the virus to replicate in vitro. Transmission of HLA-linked polymorphisms in Gag to HLA-mismatched recipients has been associated with reduced set point viral loads. We hypothesized this may be due to a reduced replication capacity of the virus. Here we present a novel method for assessing the in vitro replication of HIV-1 as influenced by the gag gene isolated from acute time points from subtype C infected Zambians. This method uses restriction enzyme based cloning to insert the gag gene into a common subtype C HIV-1 proviral backbone, MJ4. This makes it more appropriate to the study of subtype C sequences than previous recombination based methods that have assessed the in vitro replication of chronically derived gag-pro sequences. Nevertheless, the protocol could be readily modified for studies of viruses from other subtypes. Moreover, this protocol details a robust and reproducible method for assessing the replication capacity of the Gag-MJ4 chimeric viruses on a CEM-based T cell line. This method was utilized for the study of Gag-MJ4 chimeric viruses derived from 149 subtype C acutely infected Zambians, and has allowed for the identification of residues in Gag that affect replication. More importantly, the implementation of this technique has facilitated a deeper understanding of how viral replication defines parameters of early HIV-1 pathogenesis such as set point viral load and longitudinal CD4+ T cell decline.

A Restriction Enzyme Based Cloning Method to Assess the In vitro Replication Capacity of HIV-1 Subtype C Gag-MJ4 Chimeric Viruses

HIV-1 pathogenesis is defined by both viral characteristics and host genetic factors. Here we describe a robust method that allows for reproducible measurements to assess the impact of the gag gene sequence variation on the in vitro replication capacity of the virus.

The protective effect of many HLA class I alleles on HIV-1 pathogenesis and disease progression is, in part, attributed to their ability to target ...

An Affordable HIV-1 Drug Resistance Monitoring Method for Resource Limited Settings

HIV-1 drug resistance has the potential to seriously compromise the effectiveness and impact of antiretroviral therapy (ART). As ART programs in sub-Saharan Africa continue to expand, individuals on ART should be closely monitored for the emergence of drug resistance. Surveillance of transmitted drug resistance to track transmission of viral strains already resistant to ART is also critical. Unfortunately, drug resistance testing is still not readily accessible in resource limited settings, because genotyping is expensive and requires sophisticated laboratory and data management infrastructure. An open access genotypic drug resistance monitoring method to manage individuals and assess transmitted drug resistance is described. The method uses free open source software for the interpretation of drug resistance patterns and the generation of individual patient reports. The genotyping protocol has an amplification rate of greater than 95% for plasma samples with a viral load &#62;1,000 HIV-1 RNA copies/ml. The sensitivity decreases significantly for viral loads &#60;1,000 HIV-1 RNA copies/ml. The method described here was validated against a method of HIV-1 drug resistance testing approved by the United States Food and Drug Administration (FDA), the Viroseq genotyping method. Limitations of the method described here include the fact that it is not automated and that it also failed to amplify the circulating recombinant form CRF02_AG from a validation panel of samples, although it amplified subtypes A and B from the same panel.

Drug resistance testing for HIV-1 infected individuals failing antiretroviral therapy (ART) can guide future therapies and improve treatment outcomes. Optimizing individual and population health outcomes in high HIV prevalence but resource-limited settings will ultimately require affordable and accessible drug resistance genotyping and interpretation methods.

Prediction of HIV-1 Coreceptor Usage (Tropism) by Sequence Analysis using a Genotypic Approach

Transcript

Samenvatting

Meer video's verkennen