회절 데이터 동남 지역 공동 액세스 팀 (SER-고양이) 22-ID와 22-BM beamlines에서 고급 광자 소스 (AP), Argonne 국립 연구소에서 수집 했다. SAXS 데이터 SIBYLS beamline에 사전 빛 소스 (ALS), 로렌스 버클리 국립 연구소에 수집 되었다. 우리는 직원에 대 한 그들의 원격 데이터 수집 및 처리 SIBYLS beamline에 감사 하 고 싶습니다. 우리는 국립 연구소의 환경 건강 과학 (NIEHS) 질량 분석 연구 및 지원 그룹 단백질 도메인 경계를 결정 하는 도움을 위한 감사. 이 작품으로 미국 국립 연구소의 건강 교내 연구 프로그램; 지원 미국 국립 연구소의 환경 건강 과학 (NIEHS)의 (R. E. S. 지아 ES103247)와 건강 연구 (CIHR, M.C.P에 146626)의 캐나다 학회. AP의 사용을 지원 했다 미국 에너지 부, 과학의 사무실, 사무실의 기본적인 에너지 과학 계약 번호에서 W-31-109-잉글랜드-38. 사용 고급 라이트 소스 (ALS)의 감독, 과학의 사무실, 사무실의 기본적인 에너지 과학, 계약 번호에서 미국 에너지 부의에 의해 지원 되었다 드-AC02-05CH11231입니다. 추가 지원 SIBYLS SAXS beamline 건강의 국립 연구소에서 유래에 대 한 프로젝트 노스 (R01GM105404)와 하이 엔드 계측 그랜트 S10OD018483. 우리는 또한이 원고에의 그들의 중요 한 독서에 대 한 안드레아 달과 박사 새 라 안 드레를 감사 하 고 싶습니다.

저자는 공개 없다.

이 프로토콜을 사용 하 여, S. cerevisiae 에서 재조합 Nsa1 엑스레이 결정학 및 SAXS에 의해 구조 연구에 대 한 생성 되었습니다. Nsa1은 솔루션에서 품행 되었고 여러 크리스탈 형태로 결정. 이러한 결정의 최적화 하는 동안 Nsa1의 C-말단 효소 저하에 과민 했다 발견 했다. 높은 해상도, orthorhombic 크리스탈 형태로 수만 중복 될 가능성이 Nsa1의 C-터미널 잘림 변형 Nsa1의 유연한 C terminus 크리스탈 패킹을 방해 하기 때문에. Nsa1의 구조는 높은 해상도, 엑스레이 결정학에 의해 해결 되었다 하지만 C-말단 수 하지 빌드할 수 중 크리스탈 형태로 하지 지시 했다. 그러나 결정학으로 어떤 방법으로, 결정학 몇 가지 한계는 Nsa1의 크기 주위 고분자의 원자 해결책 구조를 결정 하기 위한 초연 기술입니다. 결정학의 주요 한계 중 단백질40,41의 무질서 영역을 해결 하는 무 능력 이다.
Nsa1의 C-말단은10의 구조 공부 하는 필요를 강조는 단백질의 적절 한 nucleolar 지역화를 위해 중요 합니다. Nsa1의 C-말단은 SAXS, 보완 구조 생물학 기술 엑스레이 결정학에 의해 해결 되었습니다. SAXS 데이터 농도 시리즈에 걸쳐 전체 길이 Nsa1에 대 한 기록 했다. 이 농도 시리즈에서 Nsa1 SAXS 데이터 수집 및 처리에 대 한 최적의 농도 결정 했다. SAXS 데이터는 Nsa1에 대 한 6, 4.5, 및 3.0 mg/mL에서 기록 되었다. Guinier 지역, P(r) 기능 및 분자량 농도 시리즈에 걸쳐 샘플은 품행 및 하지 테스트 실험 조건 하에서 집계 되도록 결정 되었다. Nsa1의 전체 구조를 재구성, 이론적인 산란 진폭은 부분 결정 구조에서 결정 하 고 ab initio 방법은 유연한 C terminus를 모델링 하는 데 사용 되었다. 이 하이브리드 접근에서 그것은 Nsa1의 유연한 C terminus 정렬된 WD40 도메인에서 바깥쪽으로 확장을 결정 했다.
처리 도구에 진보는 고분자 구조 연구 SAXS의 인기를 주도 했다. SAXS는 분자 질량 및 전반적인 모양을 포함 하 여 저해상도 구조 정보를 제공 하는 솔루션에서 무작위로 지향 단백질에서 x-선 산란 패턴을 측정 합니다. 따라서, SAXS는 결정학에 대 한 강력한 직교 구조 유효성 검사 도구로 떠오르고 있다. 이것은 주로 원자 구조의 이론적인 분산 및 실험적인 SAXS 데이터37비교 계산 계산 방법의 개발. 이 방법은, 구조적 상태, 제 사기 구조와 결정 격자에서 관찰 하는 더 높은 순서 어셈블리를 사용 하 여 솔루션에서 입자의 구조적 특성을 비교할 수 있습니다. 또한, 무질서 루프와 테르미니 엑스레이 결정학에 의해 결정 하는 고해상도 구조에서 누락 된 수 있습니다 모델링 솔루션 분산 데이터를 사용 하 여. 하이브리드 구조 이렇게 누락 된 잔류물의 SAXS 기반 모델링을 위한 빌딩 블록으로 결정 구조를 사용 하 여 및 매핑 Nsa110, 인플루엔자 A 바이러스 m 1 같은 다른 고분자의 C-말단에 효과 입증 했다 매트릭스 단백질42와 죽은 상자 RNA 보호자43. 고급 SAXS 기반 모델링 소프트웨어 또한 함께 전체 산란에 기여 하는 conformers의 시리즈를 사용 하 여 이러한 시스템의 구조적 풍경에 매핑하여 본질적으로 무질서 단백질 같은 더 복잡 한 시스템을 해결할 수 있는 솔루션16,39에서 입자의 잠재력. SAXS 데이터 수집 및 처리 도구에 찍은 함께, 최근 진보 도전 생물 학적 시스템을 태 클을 위한 하이브리드 구조 생물학 접근의 성공에 기여 한다.
고해상도 구조 솔루션 산란의 조합 유연성과 고분자44의 역학에 대 한 중요 한 질문에 대답을 태세 이다. Nsa1, 같은 많은 단백질, 생물 학적 기능에 대 한 중요 한 동적 영역 있다. 이 원고 서식 파일 프로토콜은 엑스레이 결정학에 의해 어떤 세부 고해상도 구조 결정 SAXS의 함께 되어 제공 됩니다. X 선 결정학 SAXS NMR를 포함 한 다른 구조 생물학 기법을 칭찬 하는 데 사용도 수, 뿐만 아니라 전자 상자성 공명 (EPR), 및 형광 공명 에너지 (무서 워), SAXS의 중요성을 강조 추가 보완 구조 생물학 기술45,,4647.

리보솜 큰 ribonucleoprotein 기계 모든 살아있는 세포에 있는 단백질으로 번역 하는 mRNA의 필수적인 역할을 수행 하는. 리보솜 속1,2,,34나 복잡 한 과정에서 생산 되는 2 개의 소 단위 리보솜 구성 됩니다. 진 핵 리보솜 어셈블리 필수 ribosomal 어셈블리 요소2,,35의 수백의 도움에 의존합니다. Nsa1 (Nop7 관련 1)6큰 ribosomal 소 단위 생산에는 진 핵 리보솜 어셈블리 요소 이며 WD-반복으로 알려진 74 (WDR74) 더 높은 유기 체7에 포함 된입니다. WDR74 쥐8에서 blastocyst 형성에 필요한 것을 보여줘 왔다 그리고 WDR74 발기인은 자주 암 세포9에 돌연변이. 그러나, 함수 및 리보솜 어셈블리에 Nsa1/WDR74의 정확한 메커니즘 여전히 크게 불명 하다. 진 핵 리보솜 성숙 하는 동안 Nsa1/WDR74의 역할을 밝히기 시작, 여러 구조 분석 x 선 결정학 및 작은 각 엑스레이 뿌리기 (SAXS)10를 포함 하 여 수행 했다.
엑스레이 결정학, 핵 자기 공명 (NMR) 분광학, 전자 현미경, 고 SAXS 고분자 구조 공부를 위한 모든 중요 한 기술이 있습니다. 그러나 크기, 모양, 가용성, 및 구조 생물학 메서드는 특정 고분자 최고의 될 것입니다 적합 한 고분자 영향의 안정성, 지 고는 소위 "잡종" 접근 방식을 통해 여러 기술을 결합 한 점점 더 유익한 도구11. 특히 x 선 결정학 및 SAXS 고분자12의 구조 결정에 대 한 강력 하 고 상호 보완적인 방법이 있습니다.
결정학 고해상도 원자 구조 작은 분자에서 리보솜와 같은 큰 셀룰러 기계에 이르기까지 제공 하 고 단백질 등의 생물 학적 기능을 이해에서 수많은 혁신을 주도하 고 있다 고분자13. 또한, 구조 기반 약물 설계 약물 발견과 개발14에 중요 한 차원을 추가 하는 계산 방법으로 분자 도킹을 위한 크리스탈 구조의 힘을 하네스 랑. 그것의 광범위 한 적용에도 불구 하 고 유연 하 고 무질서 시스템은 결정학 크리스탈 패킹을 방해 수 있습니다 또는 전자 밀도 지도 완료 수 있습니다 이후 또는 품질의 평가에 도전. 반대로, SAXS 솔루션 기반 및 저해상도 구조적 접근 무질서 루프와 테르미니에서 본질적으로 무질서 단백질12,,1516에 이르기까지 유연한 시스템을 설명 하 수 이다. 그것은 광범위 한 입자 크기12와 호환을 고려, SAXS 작업할 수 있습니다 synergistically 결정학 구조 연구에 의해 해결 될 수 있는 생물 학적 질문의 범위를 확장.
Nsa1는 기능, 하지만 유연한 C-말단 엑스레이 결정학 방법을 의무가 아니다 뒤 체계적인된 WD40 도메인을 포함 하기 때문에 혼합 구조 방식을 위해 적당 하다. 다음은 복제, 표현, 그리고 하이브리드 구조 결정 엑스레이 결정학에 의해에 대 한 S. cerevisiae Nsa1 및 SAXS의 정화에 대 한 프로토콜. 이 프로토콜 순서와 무질서 지역 조합 구성 하는 다른 단백질의 구조 연구에 적응 될 수 있다.

<table>
	<tbody>
		<tr>
			<td>Molecular Cloning of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP2 parallel vector</td>
			<td>Sheffield et al, Protein Expression and Purification 15, 34-39 (1999)</td>
			<td></td>
			<td>We used a modified version of pMBP2 which included an N-terminal His-tag (pHMBP)</td>
		</tr>
		<tr>
			<td>S. cerevisiae genomic DNA</td>
			<td>ATCC</td>
			<td>204508D-5</td>
			<td></td>
		</tr>
		<tr>
			<td>Primers for cloning Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLFw</td>
			<td>IDT</td>
			<td></td>
			<td>CGC CAA AGG CCT 
			ATGAGGTTACTAGTCAGCTGTGT 
			GGATAG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_FLRv</td>
			<td>IDT</td>
			<td></td>
			<td>AATGCAGCGGCCGCTCAAATTTT 
			GCTTTTCTTACTGGCTTTAGAAGC 
			AGC</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCFw</td>
			<td>IDT</td>
			<td></td>
			<td>GGGCGCCATGGGATCCATGAGG 
			TTACTAGTCAGCTGTGTGG</td>
		</tr>
		<tr>
			<td>SC_Nsa1_DeltaCRv</td>
			<td>IDT</td>
			<td></td>
			<td>GATTCGAAAGCGGCCGCTTAAAC 
			CTTCCTTTTTTGCTTCCC</td>
		</tr>
		<tr>
			<td>Recombinant Protein Production and Purification of Nsa1</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Escherichia coli BL21 (DE3) Star Cells</td>
			<td>Invitrogen</td>
			<td>C601003</td>
			<td></td>
		</tr>
		<tr>
			<td>pMBP- NSA1 and various truncations</td>
			<td>Lo et al., 2017</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Selenomethionine</td>
			<td>Molecular Dimensions</td>
			<td>MD12-503B</td>
			<td></td>
		</tr>
		<tr>
			<td>IPTG, Dioxane-Free</td>
			<td>Promega</td>
			<td>V3953</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA Free Protease Inhibitor Cocktail</td>
			<td>Sigma-Aldrich</td>
			<td>4693159001</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Chloride</td>
			<td>Caledon Laboratory Chemicals</td>
			<td>7560-1-80</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride hexahydrate</td>
			<td>Sigma-Aldrich</td>
			<td>M2670</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris Buffer, 1 M pH7.5</td>
			<td>KD Medical</td>
			<td>RGF-3340</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Invitrogen</td>
			<td>15514-029</td>
			<td></td>
		</tr>
		<tr>
			<td>beta-mercaptoethanol</td>
			<td>Sigma</td>
			<td>M6250</td>
			<td></td>
		</tr>
		<tr>
			<td>1M Imidazole, pH 8.0</td>
			<td>Teknova</td>
			<td>I6980-06</td>
			<td></td>
		</tr>
		<tr>
			<td>Talon Affinity Resin</td>
			<td>Clonetech</td>
			<td>635503</td>
			<td></td>
		</tr>
		<tr>
			<td>Amicon Ultra 15 mL Centrifugal Filter (MWCO 10K)</td>
			<td>Millipore</td>
			<td>UFC901024</td>
			<td></td>
		</tr>
		<tr>
			<td>HiLoad 16/600 Superdex 200 Prep Grade Gel Filtration Column</td>
			<td>GE-Healthcare</td>
			<td>28989335</td>
			<td></td>
		</tr>
		<tr>
			<td>TEV Protease</td>
			<td>Prepared by NIEHS Protein Expression Core</td>
			<td>Expression plasmid provided by NCI (Tropea et al. Methods Mol Biology, 2009)</td>
			<td></td>
		</tr>
		<tr>
			<td>4-15% Mini-PROTEAN TGX Precast Protein Gels</td>
			<td>BioRad</td>
			<td>456-8056</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystallization, Proteolytic Screening</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen</td>
			<td>Hampton Research</td>
			<td>HR2-110</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Screen 2</td>
			<td>Hampton Research</td>
			<td>HR2-112</td>
			<td></td>
		</tr>
		<tr>
			<td>Salt Rx</td>
			<td>Hampton Research</td>
			<td>HR2-136</td>
			<td></td>
		</tr>
		<tr>
			<td>Index&#160; Screen</td>
			<td>Hampton Research</td>
			<td>HR2-144</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG/Ion Screen</td>
			<td>Hampton Research</td>
			<td>HR2-139</td>
			<td></td>
		</tr>
		<tr>
			<td>JCSG+</td>
			<td>Molecular Dimensions</td>
			<td>MD1-37</td>
			<td></td>
		</tr>
		<tr>
			<td>Wizard Precipitant Synergy&#160;</td>
			<td>Molecular Dimensions</td>
			<td>MD15-PS-T</td>
			<td></td>
		</tr>
		<tr>
			<td>Swissci 96-well 3-drop UVP sitting drop plates</td>
			<td>TTP Labtech</td>
			<td>4150-05823</td>
			<td></td>
		</tr>
		<tr>
			<td>3inch Wide Crystal Clear Sealing Tape</td>
			<td>Hampton Research</td>
			<td>HR4-506</td>
			<td></td>
		</tr>
		<tr>
			<td>Proti-Ace Kit</td>
			<td>Hampton Research</td>
			<td>HR2-429</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 1500</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-6</td>
			<td></td>
		</tr>
		<tr>
			<td>PEG 400</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-3</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES/sodium hydroxide pH 7.5</td>
			<td>Molecular Dimensions</td>
			<td>MD2-011-</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Citrate tribasic</td>
			<td>Molecular Dimensions</td>
			<td>MD2-100-127</td>
			<td></td>
		</tr>
		<tr>
			<td>22 mm x 0.22 mm Siliconized Coverslides</td>
			<td>Hampton Research</td>
			<td>HR3-231</td>
			<td></td>
		</tr>
		<tr>
			<td>24 Well Plates with sealant (VDX Plate with Sealant)</td>
			<td>Hampton Research</td>
			<td>HR3-172</td>
			<td></td>
		</tr>
		<tr>
			<td>&#160;18 mM Mounted Nylon Loops (0.05 mm to 0.5 mM)</td>
			<td>Hampton Research</td>
			<td>HR4-945, HR4-947, HR4-970, HR4-971</td>
			<td></td>
		</tr>
		<tr>
			<td>Seed Bead Kit</td>
			<td>Hampton Research</td>
			<td>HR2-320</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Crystal Caps</td>
			<td>Hampton Research</td>
			<td>HR4-779</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnetic Cryo Wand</td>
			<td>Hampton Research</td>
			<td>HR4-729</td>
			<td></td>
		</tr>
		<tr>
			<td>Cryogenic Foam Dewar</td>
			<td>Hampton Research</td>
			<td>HR4-673</td>
			<td></td>
		</tr>
		<tr>
			<td>Crystal Puck System</td>
			<td>MiTeGen</td>
			<td>M-CP-111-021</td>
			<td></td>
		</tr>
		<tr>
			<td>Full Skirt 96 well Clear Plate</td>
			<td>VWR</td>
			<td>10011-228</td>
			<td></td>
		</tr>
		<tr>
			<td>AxyMat Sealing Mat</td>
			<td>VWR</td>
			<td>10011-130</td>
			<td></td>
		</tr>
		<tr>
			<td>Equipment</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>UVEX-m</td>
			<td>JAN Scientific, Inc.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Nanodrop Lite Spectrophotometer</td>
			<td>Thermo-Fisher</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Mosquito Robot</td>
			<td>TTP Labtech</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Software/Websites</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HKL2000</td>
			<td>Otwinoski and Minor, 1997</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Phenix</td>
			<td>Adams et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Coot</td>
			<td>Emsley et al., 2010</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>ATSAS</td>
			<td>Petoukhov et al., 2012</td>
			<td></td>
			<td>https://www.embl-hamburg.de/biosaxs/atsas-online/</td>
		</tr>
		<tr>
			<td>Scatter</td>
			<td>Rambo and Tainer, 2013</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Pymol</td>
			<td>The PyMOL Molecular Graphics System, Version 1.8 Schr&#246;dinger, LLC.</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>BUNCH</td>
			<td>Petoukhov and Svergun, 2005</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>CRYSOL</td>
			<td>Svergun et al, 1995</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PRIMUS</td>
			<td>Konarev et al, 2003</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>EOM</td>
			<td>Tria et al, 2015</td>
			<td></td>
			<td></td>
		</tr>
	</tbody>
</table>

combining x-ray crystallography with small angle x-ray scattering to model unstructured regions of nsa1 from s. cerevisiae

리보솜 어셈블리 요소 Nsa1 Saccharomyces cerevisiae (S. cerevisiae) 에서 전체 길이 구조 결정은 무질서 때문에 도전 이다 고 정한 효소 단백질의 C-터미널. 이 원고는 엑스레이 결정학 및 SAXS에 의해 구조 분석에 대 한 S. cerevisiae 에서 재조합 Nsa1 정화 방법을 설명 합니다. X 선 결정학은 Nsa1의 정돈된 N 맨끝 WD40 도메인의 구조를 해결 하기 위해 활용 하 고 있다 그리고 SAXS 솔루션에서 Nsa1의 C-말단의 구조를 해결 하기 위해 사용 되었다. 솔루션 분산 데이터 솔루션에서 전체 길이 Nsa1에서 수집 되었다. 이론적인 산란 진폭 WD40 도메인의 고해상도 결정 구조에서 계산 그리고 경직 된 몸과 ab initio 모델링의 조합 Nsa1의 C-터미널. 이 하이브리드 접근 방식을 통해 전체 단백질의 제 사기 구조 개축 되었다. 여기에 제시 된 방법의 구조화 및 구조화 되지 않은 도메인의 혼합으로 구성 된 다른 단백질의 하이브리드 구조 결정에 대 한 일반적으로 적용 해야 합니다.

Nsa1 PCR S. cerevisiae genomic DNA에서 증폭 하 고 MBP와 TEV 프로 테아 제 사이트는 N 맨끝 6 x-히스티딘 선호도 태그를 포함 하는 벡터에 subcloned 이었다. Nsa1 대장균 BL21(DE3) 세포로 변형 되었다 고 단백질 식의 높은 수율 IPTG로 유도 및 25 ° C에서 하룻밤 (그림 1A) 성장을 가져온. Nsa1 고정된 코발트 선호도 수 지, TEV protease와 MBP 분열에 의해 그리고 마침내 크기 배제 크로마토그래피 (그림 1B)에 의해 해결에 친 화력 정화 했다. Nsa1를 포함 하는 크기 배제 크로마토그래피에서 분수 풀링, 8 mg/mL에 집중 되었고 결정 화 로봇 결정 화 실험에 대 한 사용. 초기 스파스 매트릭스 크리스탈 스크린의 2 개의 다른 크리스탈 모양 Nsa1, 입방 및 orthorhombic (그림 2A) 나왔고.
입방 및 orthorhombic 결정의 최적화 하는 동안 orthorhombic 크리스탈 Nsa1의 분해 분열의 결과로 발생 했다 발견 했다. 제한 된 베이스와 질량 분석 베이스, 민감한 Nsa1의 영역을 결정 하는 데 사용 했다 그리고 Nsa1는 효소 elastase (그림 2B)의 농도 기온 변화도에 민감한 관찰 되었다. 이후 질량 분석 분석 확인이 저하 Nsa1의 C-말단의 손실에서 유래 했다. 일련의 Nsa1의 C-터미널 잘림 제거를 위하여 중요 한 C-말단 (그림 2C) 생성 되었다. Orthorhombic 결정 궁극적으로 슬픈 구조 결정을 위해 사용 되었다 Nsa1ΔC (잔류물 1-434) 자르기와 반복 될 수 있습니다. Orthorhombic 결정 또한 Nsa1를 치료 하 여 반복 수 크리스탈 트레이를 설정 하기 전에 4 ° C에서 1 시간 동안 elastase와플로리다 .
큐빅 Nsa1 결정 했다 Nsa1를 사용 하 여 최적화 된플로리다 나트륨 시트르산 그라디언트의 결합을 통해 결합 microseeding (그림 3A). 이 나왔고 약 2.8의 회절 한계 대형, 재현할 수 입방 결정, Å의 해상도 (그림 3C, 왼쪽). Orthorhombic 결정만 최적화할 수 1500 말뚝과 말뚝 400, microseeding, 약 1.25의 회절 제한 큰 결정을 굴복과 결합의 농도 기울기 변화 하 여 Nsa1의 C-터미널 잘림 이체를 사용 하 여 Å 해상도 (그림 3A-C). Nsa1의 실험 단계는 SeMet-SeMet-Nsa1ΔC10의 파생에서 슬픈에 의해 결정 되었다.
그러나 Nsa1의 N 맨끝 7 날 β-프로 펠 러 WD40 도메인 두 구조 Nsa1의 C-말단에 대 한 전자 밀도 부족 모두는 입방과 orthorhombic 크리스탈 구조에 잘 해결 되었습니다. SAXS 다음 솔루션에서 Nsa1의 누락 C 터미널 도메인의 위치를 결정 하기 위해 사용 되었다. 데이터 컬렉션에 대 한 샘플 농도의 최적화, 후 부분 원자 구조는 리 짓 바디 모델링을 수행 하 고 누락 된 구성 요소의 ab initio 재건 생성 하 사용 되었다. 모델 실험 데이터 (그림 4, 센터 파이프라인) 계산 된 분산 곡선에 대 한 적합의 미 덕의 점에서 평가 했다. Nsa1 혼자의 WD40 도메인은 이론적인 분산 곡선으로, 결정 구조 PDB ID 5SUM에서에서 생성 된 실험적인 산란 곡선 사이의 불일치에 의해 입증 실험 SAXS 데이터의 좋은 적합 하지 않습니다 (그림 4, 왼쪽된 파이프라인)입니다. 리 짓 바디 모델링, 뿐만 아니라 앙상블 모델링도 이루어졌다. Nsa1의 3 ~ 4 conformers의 앙상블 생산과 낮은 χ2 값 (그림 4, 오른쪽 파이프라인) 귀착되 었 다. 모델 불일치 (χ2) 앙상블 모델링을 사용 하 여 감소 솔루션에서 Nsa1 C 맨끝 꼬리의 구조적 샘플링을 밝혔다.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/56953/56953fig1.jpg"> 그림 1입니다. 식 및 6 X 그의 MBP 융합 태그와 Nsa1의 정화. (A) SDS 페이지 분석 BL21에 단백질 식의 하룻밤과 코발트 선호도 수 지를 사용 하 여 첫 번째 정화 단계 (DE3) 25 ° C에서 세포. (B) 대표 크기 배제 크로마 TEV 분열 다음. 크기 배제 크로마토그래피에서 분수 SDS-PAGE로 분석 되었다. 피크 1 포함 Nsa1 수집 되었고 구조 분석을 위한 사용에서 분수. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56953/56953fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/56953/56953fig2.jpg"> 그림 2입니다. Nsa1의 C-말단은 베이스에 과민 하다. (Nsa1의 A) 초기 결정 화 실험 나왔고 두 개의 다른 결정 형태: 입방 및 orthorhombic. 자외선 현미경 결정 단백질 포함 확인 사용 되었다. Vi: 가시광선, 자외선: 자외선 현미경. 눈금 막대 각 창에서 50 µ m =. (B) 분해 심사 SDS-PAGE로 분석. 각 효소 주식 (0.1, 0.01, 0.001 mg/mL)에 대 한 3 개의 희석 (1시 10분, 1: 100, 1:1000)는 상영 될 단백질 (1 mg/mL)의 aliquots와 결합 했다. 프로 테아 제 저항 도메인 분석 했다는 SDS 페이지와 60 분 Nsa1-플로리다에 대 한 37 ° C 배양 후 질량 분석: 신선한 정화 단백질, Nsa1Δ: 단백질의 타락된 형태 관찰 후 3 주 동안 4 ° C에서 저장 된 단백질을 정화. Nsa1 전체 길이 (위)의 (C) 도식 다이어그램 및 C 터미널 잘림 (낮은) 생성합니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56953/56953fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/56953/56953fig3.jpg"> 그림 3입니다. Nsa1 결정 화 최적화. (A) 씨 주식 초기 작은 결정에서 준비 하 고 희석 시리즈를 만드는 데 사용 되었다 (1 x ~ 1/104x) (microseeding). 희석 씨 주식 1 µ L로 단백질의 1 µ L를 혼합 하 여 더 큰 단일 결정 주 내에서 성장 했다. (B) precipitant 농도 그라데이션 orthorhombic 크리스탈 최적화에 대 한. (C) 데이터 수집을 위해 사용 하는 입방 및 orthorhombic 결정 최적화. 녹색 원형 크리스탈 쟁반 굴복 데이터 수집 품질 결정의 일반적인 영역을 나타냅니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56953/56953fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/56953/56953fig4.jpg"> 그림 4입니다. Nsa1 SAXS 분석의 회로도 SAXS 데이터를 처리 하 고 무리 (센터)와 엄 (오른쪽) 모델을 생성 하는 데 사용 하는 파이프라인의 개요. 왼쪽된 파이프라인 실험 산란 곡선 사이의 불일치를 보여 줍니다 (빨간색 원, 단백질 농도: 6 mg/mL) 이론적인 분산 곡선 (파란색 선), 결정 구조 PDB ID 5SUM에서에서 생성 했다. 모델 실험 SAXS 산란 곡선을 비교 하 여 평가 했다 (빨간색 원, 단백질 농도: 6 mg/mL) Nsa1의 무리 모델에서 파생 된 산란 곡선 (검은 선) 또는 Nsa1의 엄 conformers (검은 선). 각 모델에 WD40 도메인 유연한 C-말단 개별 엄 conformers 무리 고, 마젠타색, 청록색, 녹색과 노란색에 대 한 빨간색에서 컬러 영역에 표시 됩니다 (PDB ID 5SUM), 녹색의 색깔 만화에 표시 됩니다. 각 conformer 엄에서 파생 된 일부 모델에 표시 됩니다. <a href="https://cloudflare-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56953/56953fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.</a>

Watch this Scientific Journal Video about Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae at JoVE.com

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

이 방법은 엑스레이 결정학 및 소 각 x 선 산란 (SAXS), 복제, 표현, 및 구조 결심을 위한 재조합 Nsa1의 정화를 설명 하 고 다른 단백질의 하이브리드 구조 분석에 대 한 적용 둘 다를 포함 하는 주문 하 고 도메인을 난잡.

S. Cerevisiae 에서 Nsa1의 구조화 되지 않은 영역을 모델링 하는 데 작은 각 x 선 산란 된 x-선 결정학을 결합

Determination of the full-length structure of ribosome assembly factor Nsa1 from Saccharomyces cerevisiae (S. cerevisiae) is challenging because of the ...

combining-x-ray-crystallography-with-small-angle-x-ray-scattering-to

Nanyang Technological University

Research

JoVE Journal

Biochemistry

Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

9.8K 조회수.  National Institutes of Health. 이 방법은 엑스레이 결정학 및 소 각 x 선 산란 (SAXS), 복제, 표현, 및 구조 결심을 위한 재조합 Nsa1의 정화를 설명 하 고 다른 단백질의 하이브리드 구조 분석에 대 한 적용 둘 다를 포함 하는 주문 하 고 도메인을 난잡.

비디오: Combining X-Ray Crystallography with Small Angle X-Ray Scattering to Model Unstructured Regions of Nsa1 from S. Cerevisiae

Characterization of Glycoproteins with the Immunoglobulin Fold by X-Ray Crystallography and Biophysical Techniques

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of these glycoproteins possess immunoglobulin (Ig) folds and are central to immune recognition and regulation. Here, we present a platform for the design, expression and biophysical characterization of the extracellular domain of human B cell receptor CD22. We propose that these approaches are broadly applicable to the characterization of mammalian glycoprotein ectodomains containing Ig domains. Two suspension human embryonic kidney (HEK) cell lines, HEK293F and HEK293S, are used to express glycoproteins harbouring complex and high-mannose glycans, respectively. These recombinant glycoproteins with different glycoforms allow investigating the effect of glycan size and composition on ligand binding. We discuss protocols for studying the kinetics and thermodynamics of glycoprotein binding to biologically relevant ligands and therapeutic antibody candidates. Recombinant glycoproteins produced in HEK293S cells are amenable to crystallization due to glycan homogeneity, reduced flexibility and susceptibility to endoglycosidase H treatment. We present methods for soaking glycoprotein crystals with heavy atoms and small molecules for phase determination and analysis of ligand binding, respectively. The experimental protocols discussed here hold promise for the characterization of mammalian glycoproteins to give insight into their function and investigate the mechanism of action of therapeutics.

We present approaches for the biophysical and structural characterization of glycoproteins with the immunoglobulin fold by biolayer interferometry, isothermal titration calorimetry, and X-ray crystallography.

X 선 결정학 및 생물 기술에 의해 면역 글로불린 겹와 Glycoproteins의 특성

Glycoproteins on the surface of cells play critical roles in cellular function, including signalling, adhesion and transport. On leukocytes, several of ...

연구

생화학

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the investigation of biological materials, biofuel processing, and bio-inspired materials covering nanometer to micrometer length scales. The methods presented here for investigating physical properties (i.e., size and shape) of membrane proteins (here, MmIAP, an intramembrane aspartyl protease from Methanoculleus marisnigri) in solutions of micelle-forming detergents are well-suited for this small-angle neutron scattering instrument, among others. Other biophysical characterization techniques are hindered by their inability to address the detergent contributions in a protein-detergent complex structure. Additionally, access to the Bio-Deuteration Lab provides unique capabilities for preparing large-scale cultivations and expressing deuterium-labeled proteins for enhanced scattering signal from the protein. While this technique does not provide structural details at high-resolution, the structural knowledge gap for membrane proteins contains many addressable areas of research without requiring near-atomic resolution. For example, these areas include determination of oligomeric states, complex formation, conformational changes during perturbation, and folding/unfolding events. These investigations can be readily accomplished through applications of this method.

Contrast-Matching Detergent in Small-Angle Neutron Scattering Experiments for Membrane Protein Structural Analysis and Ab Initio Modeling

This protocol demonstrates how to obtain a low-resolution ab initio model and structural details of a detergent-solubilized membrane protein in solution using small-angle neutron scattering with contrast-matching of the detergent.

막 단백질 구조 분석 및 Ab 론 적 모델링 작은 각 중성자 산란 실험에서 일치 하는 대비 세제

The biological small-angle neutron scattering instrument at the High-Flux Isotope Reactor of Oak Ridge National Laboratory is dedicated to the ...

Structural Studies of Macromolecules in Solution using Small Angle X-Ray Scattering

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and how the domains are oriented/positioned. Here, a protocol with the potential for elucidating which specific domains mediate interactions in multicomponent system through ab initio modeling is described. A method for calculating solution structures of macromolecules and their assemblies is provided that involves integrating data from small angle X-ray scattering (SAXS), chromatography, and atomic resolution structures together in a hybrid approach. A specific example is that of the complex of full-length nidogen-1, which assembles extracellular matrix proteins and forms an extended, curved nanostructure. One of its globular domains attaches to laminin &#947;-1, which structures the basement membrane. This provides a basis for determining accurate structures of flexible multidomain protein complexes and is enabled by synchrotron sources coupled with automation robotics and size exclusion chromatography systems. This combination allows rapid analysis in which multiple oligomeric states are separated just prior to SAXS data collection. The analysis yields information on the radius of gyration, particle dimension, molecular shape and interdomain pairing. The protocol for generating 3D models of complexes by fitting high-resolution structures of the component proteins is also given.

Here, we present how Small Angle X-Ray Scattering (SAXS) can be utilized to obtain information on low-resolution envelopes representing the macromolecular structures. When used in conjunction with high-resolution structural techniques such as X-Ray Crystallography and Nuclear Magnetic Resonance, SAXS can provide detailed insights into multidomain proteins and macromolecular complexes in-solution.

작은 각 엑스레이 뿌리기를 사용 하 여 솔루션에서 고분자의 구조 연구

Protein-protein interactions involving proteins with multiple globular domains present technical challenges for determining how such complexes form and ...

Ion Exchange Chromatography (IEX) Coupled to Multi-angle Light Scattering (MALS) for Protein Separation and Characterization

Ion-exchange chromatography with multi-angle light scattering (IEX-MALS) is a powerful method for protein separation and characterization. The combination of the high-specificity separation technique IEX with the accurate molar mass analysis achieved by MALS allows the characterization of heterogeneous protein samples, including mixtures of oligomeric forms or protein populations, even with very similar molar masses. Therefore, IEX-MALS provides an additional level of protein characterization and is complementary to the standard size-exclusion chromatography with multi-angle light scattering (SEC-MALS) technique.
Here we describe a protocol for a basic IEX-MALS experiment and demonstrate this method on bovine serum albumin (BSA). IEX separates BSA to its oligomeric forms allowing a molar mass analysis by MALS of each individual form. Optimization of an IEX-MALS experiment is also presented and demonstrated on BSA, achieving excellent separation between BSA monomers and larger oligomers. IEX-MALS is a valuable technique for protein quality assessment since it provides both fine separation and molar mass determination of multiple protein species that exist in a sample.

Ion Exchange Chromatography IEX Coupled to Multi-angle Light Scattering MALS for Protein Separation and Characterization

This protocol describes the use of high-specificity ion-exchange chromatography with multi-angle light scattering for an accurate molar mass determination of proteins, protein complexes, and peptides in a heterogeneous sample. This method is valuable for quality assessment, as well as for the characterization of native oligomers, charge variants, and mixed-protein samples.

단백질 분리 및 특성에 대 한 다 각 산란 (MALS)를 결합 하는 이온 교환 크로마토그래피 (전류 구동)

Ion-exchange chromatography with multi-angle light scattering (IEX-MALS) is a powerful method for protein separation and characterization. The combination ...

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering (SEC-MALS)

Analytical size-exclusion chromatography (SEC), commonly used for the determination of the molecular weight of proteins and protein-protein complexes in solution, is a relative technique that relies on the elution volume of the analyte to estimate molecular weight. When the protein is not globular or undergoes non-ideal column interactions, the calibration curve based on protein standards is invalid, and the molecular weight determined from elution volume is incorrect. Multi-angle light scattering (MALS) is an absolute technique that determines the molecular weight of an analyte in solution from basic physical equations. The combination of SEC for separation with MALS for analysis constitutes a versatile, reliable means for characterizing solutions of one or more protein species including monomers, native oligomers or aggregates, and heterocomplexes. Since the measurement is performed at each elution volume, SEC-MALS can determine if an eluting peak is homogeneous or heterogeneous and distinguish between a fixed molecular weight distribution versus dynamic equilibrium. Analysis of modified proteins such as glycoproteins or lipoproteins, or conjugates such as detergent-solubilized membrane proteins, is also possible. Hence, SEC-MALS is a critical tool for the protein chemist who must confirm the biophysical properties and solution behavior of molecules produced for biological or biotechnological research. This protocol for SEC-MALS analyzes the molecular weight and size of pure protein monomers and aggregates. The data acquired serve as a foundation for further SEC-MALS analyses including those of complexes, glycoproteins and surfactant-bound membrane proteins.

Characterization of Proteins by Size-Exclusion Chromatography Coupled to Multi-Angle Light Scattering SEC-MALS

This protocol describes the combination of size exclusion chromatography with multi-angle light scattering (SEC-MALS) for absolute characterization of proteins and complexes in solution. SEC-MALS determines the molecular weight and size of pure proteins, native oligomers, heterocomplexes and modified proteins such as glycoproteins.

다각형 광 산란에 결합된 크기 배제 크로마토그래피에 의한 단백질의 특성 (SEC-MALS)

Analytical size-exclusion chromatography (SEC), commonly used for the determination of the molecular weight of proteins and protein-protein complexes in ...

An All-in-one Sample Holder for Macromolecular X-ray Crystallography with Minimal Background Scattering

Macromolecular X-ray crystallography (MX) is the most prominent method to obtain high-resolution three-dimensional knowledge of biological macromolecules. A prerequisite for the method is that highly ordered crystalline specimen need to be grown from the macromolecule to be studied, which then need to be prepared for the diffraction experiment. This preparation procedure typically involves removal of the crystal from the solution, in which it was grown, soaking of the crystal in ligand solution or cryo-protectant solution and then immobilizing the crystal on a mount suitable for the experiment. A serious problem for this procedure is that macromolecular crystals are often mechanically unstable and rather fragile. Consequently, the handling of such fragile crystals can easily become a bottleneck in a structure determination attempt. Any mechanical force applied to such delicate crystals may disturb the regular packing of the molecules and may lead to a loss of diffraction power of the crystals. Here, we present a novel all-in-one sample holder, which has been developed in order to minimize the handling steps of crystals and hence to maximize the success rate of the structure determination experiment. The sample holder supports the setup of crystal drops by replacing the commonly used microscope cover slips. Further, it allows in-place crystal manipulation such as ligand soaking, cryo-protection and complex formation without any opening of the crystallization cavity and without crystal handling. Finally, the sample holder has been designed in order to enable the collection of in situ X-ray diffraction data at both, ambient and cryogenic temperature. By using this sample holder, the chances to damage the crystal on its way from crystallization to diffraction data collection are considerably reduced since direct crystal handling is no longer required.

A novel sample holder for macromolecular X-ray crystallography along with a suitable handling protocol is presented. The system allows crystal growth, crystal soaking and in situ diffraction data collection at both, ambient and cryogenic temperature without the need of any crystal manipulation or mounting.

최소한의 배경 산란을 갖춘 거대 분자 X선 결정학을 위한 올인원 샘플 홀더

Macromolecular X-ray crystallography (MX) is the most prominent method to obtain high-resolution three-dimensional knowledge of biological macromolecules. ...

Cell Culture on Silicon Nitride Membranes and Cryopreparation for Synchrotron X-ray Fluorescence Nano-analysis

Very little is known about the distribution of metal ions at the subcellular level. However, those chemical elements have essential regulatory functions and their disturbed homeostasis is involved in various diseases. State-of-the-art synchrotron X-ray fluorescence nanoprobes provide the required sensitivity and spatial resolution to elucidate the two-dimensional (2D) and three-dimensional (3D) distribution and concentration of metals inside entire cells at the organelle level. This opens new exciting scientific fields of investigation on the role of metals in the physiopathology of the cell. The cellular preparation is a key and often complex procedure, particularly for basic analysis. Although X-ray fluorescence techniques are now widespread and various preparation methods have been used, very few studies have investigated the preservation of the elemental content of cells at best, and no stepwise detailed protocol for the cryopreparation of adherent cells for X-ray fluorescence nanoprobes has been released so far. This is a description of a protocol that provides the stepwise cellular preparation for fast cryofixation to enable synchrotron X-ray fluorescence nano-analysis of cells in a frozen hydrated state when a cryogenic environment and transfer is available. In case nano-analysis has to be performed at room temperature, an additional procedure for freeze-drying the cryofixed adherent cellular preparation is provided. The proposed protocols have been successfully used in previous works, most recently in studying the 2D and 3D intracellular distribution of an organometallic compound in breast cancer cells.

Presented here is a protocol for cell culture on silicon nitride membranes and plunge-freezing prior to X-ray fluorescence imaging with a synchrotron cryogenic X-ray nanoprobe. When only room temperature nano-analysis is provided, the frozen samples can be further freeze-dried. These are critical steps to obtain information on the intracellular elemental composition.

싱크로트론 X선 형광 나노 분석을 위한 실리콘 질화물 멤브레인의 세포 배양 및 저온 준비

Very little is known about the distribution of metal ions at the subcellular level. However, those chemical elements have essential regulatory functions ...

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of biological membranes, energy storage and production, cellular signaling, vesicular transport of proteins, organelle biogenesis, and regulated cell death. Because the budding yeast Saccharomyces cerevisiae is a unicellular eukaryote amenable to thorough molecular analyses, its use as a model organism helped uncover mechanisms linking lipid metabolism and intracellular transport to complex biological processes within eukaryotic cells. The availability of a versatile analytical method for the robust, sensitive, and accurate quantitative assessment of major classes of lipids within a yeast cell is crucial for getting deep insights into these mechanisms. Here we present a protocol to use liquid chromatography coupled with tandem mass spectrometry (LC-MS/MS) for the quantitative analysis of major cellular lipids of S. cerevisiae. The LC-MS/MS method described is versatile and robust. It enables the identification and quantification of numerous species (including different isobaric or isomeric forms) within each of the 10 lipid classes. This method is sensitive and allows identification and quantitation of some lipid species at concentrations as low as 0.2 pmol/&#181;L. The method has been successfully applied to assessing lipidomes of whole yeast cells and their purified organelles. The use of alternative mobile phase additives for electrospray ionization mass spectrometry in this method can increase the efficiency of ionization for some lipid species and can be therefore used to improve their identification and quantitation.

Quantitative Analysis of the Cellular Lipidome of Saccharomyces Cerevisiae Using Liquid Chromatography Coupled with Tandem Mass Spectrometry

We present a protocol using liquid chromatography coupled with tandem mass spectrometry to identify and quantify major cellular lipids in Saccharomyces cerevisiae. The described method for a quantitative assessment of major lipid classes within a yeast cell is versatile, robust, and sensitive.

탠덤 질량 분석과 결합 된 액체 크로마토그래피를 사용하여 사카로 미세화세세비시아의 세포 지질의 정량분석

Lipids are structurally diverse amphipathic molecules that are insoluble in water. Lipids are essential contributors to the organization and function of ...

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion cofactors triggering a dimer-dodecamer transition. Upon metal ion binding, several structural modifications occur in the active site and at the interaction interface, shaping dimers to promote the self-assembly. To observe such modifications, stable oligomers must be isolated prior to structural study. Reported here is a method that allows the purification of stable dodecamers and dimers of TmPep1050, an M42 aminopeptidase of T. maritima, and their structure determination by X-ray crystallography. Dimers were prepared from dodecamers by removing metal ions with a chelating agent. Without their&#160;cofactor, dodecamers became less stable and were fully dissociated upon heating. The oligomeric structures were solved by the straightforward molecular replacement approach. To illustrate the methodology, the structure of a TmPep1050 variant, totally impaired in metal ion binding, is presented showing no further breakdown of dimers to monomers.

X-Ray Crystallography to Study the Oligomeric State Transition of the Thermotoga maritima M42 Aminopeptidase TmPep1050

This protocol has been developed to study the dimer-dodecamer transition of TmPep1050, an M42 aminopeptidase, at the structural level. It is a straightforward pipeline starting from protein purification to X-ray data processing. Crystallogenesis, data set indexation, and molecular replacement have been emphasized through a case of study, TmPep1050H60A H307A variant.

열토가 마리티마 M42 아미노펩티다제 TmPep1050의 올리고메릭 상태 전환을 연구하는 엑스레이 결정학

The M42 aminopeptidases form functionally active complexes made of 12 subunits. Their assembly process appears to be regulated by their metal ion ...

Fixed Target Serial Data Collection at Diamond Light Source

Serial data collection is a relatively new technique for synchrotron users. A user manual for fixed target data collection at I24, Diamond Light Source is presented with detailed step-by-step instructions, figures, and videos for smooth data collection.

We present a comprehensive guide to fixed target sample preparation, data collection, and data processing for serial synchrotron crystallography at Diamond beamline I24.

다이아몬드 광원의 대상 시리얼 데이터 수집 수정

Serial data collection is a relatively new technique for synchrotron users. A user manual for fixed target data collection at I24, Diamond Light Source is ...