This work was supported by the Else Kr&#246;ner-Fresenius Foundation (EKFS) Research Training Group Translational Research Innovation - Pharma (TRIP) and by the "Landesoffensive zur Entwicklung wissenschaftlich-&#246;konomischer Exzellenz (LOEWE), Schwerpunkt: Anwendungsorientierte Arzneimittelforschung" of the State of Hesse.

윤리 선언문 : 우리의 실험 절차는 Regierungspräsidium 다름슈타트 (독일)의 윤리위원회의 승인을 국내 및 유럽 규정을 확인하고 있습니다. 모든 노력이 동물의 고통을 최소화하고 사용하는 동물의 수를 줄이기 위해 만들어졌다. 1. EAE 모델 <ol><li> EAE 모델의 유도 <ol><li> EAE의 유도를 위해 10 13 주령 여성 129S4 / SvJae × C57BL / 6 마​​우스를 사용합니다. </li><li> 상단에, 쥐에게 피하 주사를주고 encephalitogenic MOG (35), 허리 - 400 μg의 결핵균이 포함 된 200 ㎕를 완료 Freund`s 보조제 (CFA)에서 유화 55 (수초의 희소 돌기 아교 세포 당 단백질) 펩티드 (200 μg의). 주 : 음이 아닌 질환 유발 허위 대조군으로 같은 부피, 같은 경로에 의해 결핵균을 함유하는 프로 인트 불완전 보조제를 사용할 수있다. </li><li> THEReafter, 다시 24 시간 후, 마우스에게 (200 ㎕를 인산염 완충 식염수, PBS에 희석 총 0.2 μg의에서) 백일해 독소의 복강 내 주사를 제공합니다. 건강한 동물 질병 비교할 수 있도록, 대조군으로 처리되지 않은 마우스를 사용합니다. 참고 : (200) EAE를 유도하는 것도 가능하다 - 300 μg의의 MOG 35-55 펩타이드, 300 - CFA에서 결핵균의 500 μg의 0.2 - 주입 당 0.2 ml의 - 0.3 μg의 백일해 독소를 0.1 볼륨. </li><li> 마우스는 임상 증상 매일, 주입 후 일주를 조사 시작 (단계 1.2.1 참조) 참고 : 질병 발병의 날은 다른 실험에서 다양하지만 우리의 실험실 조건 하에서,이 날 11 주위 따라서, 여기에 14 일 3 일 질병 발병 이후로 정의된다. 본 연구의 모든 마우스는 임상 증상을 개발했다. </li></ol></li><li> 쥐의 점수 <ol><li> 다음과 같이 임상 점수에 의한 임상 증상을 분류 :0) 아무 표시도없고, 꼬리 0.5) 말단 마비, 1) 꼬리의 완전한 마비, 1.5) 맥 빠진 꼬리와 뒷다리의 약한 약점, 2) 다리를 저는 꼬리와 뒷다리의 심각한 약점, 2.5) 맥 빠진 꼬리의 마비 하나의 뒷다리, 3) 다리를 저는 꼬리와 두 뒷다리 마비, 뒷다리 하나 앞 사지의 약점 모두 3.5) 마비 (이 점수를 달성 마우스) 지역 윤리 가이드 라인을 유지, 안락사시켰다. </li></ol></li></ol> 유동 세포 계측법 분석을위한 단일 세포의 2. 준비 참고 : 항체 혼합물 1 ㎕의 CD45-Vioblue, 2 μL CD8-eFluor650, 0.5 ㎕를 CD11b를-eFluor605, 0.5 μL F4 / 80-PE-Cy7, 1 μL CD3-PE-CF594, CD4-V500, 0.5 μL의 중 CD11c 구성 -AlexaFluor700, 1 ㎕의 CD19-APC-H7 1 μL Ly6G-APC-Cy7. 참고 : 혈액, 림프절, 비장 및 척수을 다음과 같이 다음 절차는 : 마우스가 깊이 isofl의 조합으로 마취하고 있습니다urane 및 케타민 (100 ㎎ / ㎏ 체중) (분당 carbogen 2 %). 다음으로, 가슴을 열고 intracardial 막대기로 혈액을 제거하고 차가운 PBS로 intracardially 마우스를 관류. 그런 다음 비장 한 다음 림프절 마지막으로 척수를 제거합니다. 당신이 intracardially 쥐를 관류 할 필요가없는 경우 다음 목의 탈구에 의해 깊은 마취에서 쥐를 안락사. <ol><li> 비장 세포의 분리 <ol><li> 이소 플루 란 (분당 carbogen 2 %) 및 ​​케타민 (100 ㎎ / ㎏ 체중)의 조합으로 쥐를 마취. </li><li> 80 % 이소프로판올 젖은 절개 지역은 가위를 사용하여 머리카락과 함께 모든 오염을 방지하고 깊은 조직을 천공하지 않고, 길이 방향으로 흉부를 엽니 다. </li><li> 차가운 PBS 산도 7.0 23 intracardially 마우스를 관류. 참고 : 비장이 흉곽 아래의 왼쪽 우수한 복부 사분면에 위치해 있습니다. 비장이 연구 될 경우에만,이 기관은 Retai 무료 뉴스하기 위해 관류 전에 제거 될 수있다관심의 n은 모든 세포 유형. </li><li> 비장을 제거하고 약 1/8을 차단하고 무게. 얼음에 PBS에서 샘플을 저장합니다. </li><li> 2 mL의 주사기의 플런저를 사용하여 (50 ㎖의 튜브 위에 위치)은 70 ㎛의 메쉬 체로 비장 조직을 짠다. </li><li> 5 ml의 PBS와 메쉬를 씻으십시오. 3 분 동안 1,800 XG에 원심 분리기. 솔루션을 용균 500 μL에 펠렛을 재현 탁. 주의 :이 단계에서는, 그 후, 대안 FACS 분석법 비즈 (섹션 3 참조)를 사용하지 않는 것을 사용하고, 경우에 차동 셀 카운트 할 필요가있을 수있다. </li><li> 실온 (RT)에서 10 분 동안 품어 500 μl의 PBS를 추가합니다. 실온에서 650 XG (RT)에서 6 분 동안 원심 분리기. </li><li> 500 ㎕의 PBS로 세척 단계를 반복합니다. 100 ㎕의 0.2 % 소 혈청 알부민 (BSA)에서 세포 펠렛을 재현 탁, 상층 액을 제거 / PBS 2 μL Fc 수용체 -1 (FcRI) 블로킹 버퍼를 추가하고 어두운 곳에서 실온에서 15 분 동안 배양한다. </li><li> 13 μL 추가tibody 혼합물은, 어둠 속에서 실온에서 15 분을 품어 RT에서 650 XG에 6 분 동안 500 ㎕의 PBS와 원심 분리기를 추가합니다. 상층 액을 버린다. 주 : 제조업체의 염색 방법은 하나의 세척을 권장하지만 배경 얼룩의 추가적인 감소는 임의로 세척 단계를 하나 또는 두 번 이상 반복함으로써 달성 될 수있다. </li><li> (잠재적으로 세포 응집을 감소시키기 위해, 단백질 분리 또는 아마도 런닝 버퍼) 및 튜브 유세포로 전송 세포 500 ㎕의 PBS에 펠렛을 재현 탁. 얼음에 세포를 유지합니다. </li></ol></li><li> 림프절 세포의 분리 <ol><li> 이소 플루 란 (분당 carbogen 2 %) 및 ​​케타민 (100 ㎎ / ㎏ 체중)의 조합으로 쥐를 마취. </li><li> 80 % 이소프로판올 젖은 절개 영역과 가위를 사용하여 길이 방향으로 흉부를 엽니 다. 차가운 PBS 산도 7.0 23 intracardially 마우스를 관류. </li><li> 사타구니 림프절을 분리 신중 하이의 영역에서 피부를 제거p와는 집게와 지방 조직에서 조심스럽게 림프 노드를 선택합니다. 사타구니 림프절을 달아 얼음에 PBS에서 샘플을 저장합니다. 참고 : 우리는 우리의 연구 때문에 O`Connor 등의 알에서 서혜부 림프절을 사용했다. 활성화 된 단핵 세포, 대 식세포, 호중구 및 T 세포의 높은 숫자는 모든 EAE 유도 24 후 서혜부 림프절에 존재하는 것을 발견했다. </li><li> 2 mL의 주사기의 플런저를 사용하여 (50 ㎖의 튜브 위에 위치)은 70 ㎛의 메쉬 체로 림프절을 짠다. </li><li> 5 ml의 PBS와 메쉬를 씻으십시오. 8 분 동안 2,400 XG에 원심 분리기. 100 ㎕의 0.2 % BSA / PBS에서 세포 펠렛을 재현 탁 2 μL FcRI 블로킹 버퍼를 추가하고 어두운 곳에서 실온에서 15 분 동안 배양한다. </li><li> 13 μL에게 항체 혼합물을 추가 어둠 속에서 실온에서 15 분을 품어, 실온에서 650 XG에서 6 분 동안 500 ㎕의 PBS와 원심 분리기를 추가합니다. </li><li> 상등액을 버리고 300 ㎕의 PBS에서 세포 펠릿 (또는 적절한 주행 완충액)을 재현 탁하고 전송할유동 세포 계측법 튜브. </li></ol></li><li> 혈액 세포의 단리 <ol><li> (EDTA 안정화) 50 μl의 혈액 50 μl를 20 mM의 HEPES를 추가하고 솔루션을 용균 500 μl를 추가합니다. 실온에서 10 분 동안 품어 500 μl의 PBS를 추가합니다. 실온에서 650 XG에 6 분 동안 원심 분리기. 뜨는을 취소하고 세척 단계를 반복합니다. </li><li> 100 ㎕의 0.2 % BSA / PBS에서 세포 펠렛을 재현 탁 2 μL FcRI 블로킹 버퍼를 추가하고 어두운 곳에서 실온에서 15 분 동안 배양한다. </li><li> 13 μL에게 항체 혼합물을 추가 어둠 속에서 실온에서 15 분을 품어, 실온에서 650 XG에서 6 분 동안 500 ㎕의 PBS와 원심 분리기를 추가합니다. 상등액을 버리고 PBS 300 ㎕를 상기 세포 펠렛을 재현 탁하고 유세포 튜브로 옮긴다. </li></ol></li><li> 척수 세포의 분리 <ol><li> 이소 플루 란 (분당 carbogen 2 %) 및 ​​케타민 (100 ㎎ / ㎏ 체중)의 조합으로 쥐를 마취. </li><li> 젖은 절개 80 % 이소프로판올과 영역과 길이 방향으로 흉부를 엽니 다가위를 사용하여. 차가운 PBS 산도 7.0 23 intracardially 마우스를 관류. </li><li> 뒷면의 절개 영역을 적시고 다시 메스와 길이 절단하고 피부를 제거합니다. </li><li> (뒷다리 사지를 innervates) 척추의 요추 부분을 잘라 척수를 추출하기 위해 PBS 채워진 주사기로 세척합니다. , 요추 코드의 약 1/3을 잘라이 무게와 얼음에 PBS에서 샘플을 저장합니다. </li><li> 4 ℃에서 2 분 250 XG에 원심 분리기. , 상층 액을 버리고 500 ㎕의 세포 분리 솔루션 및 HBSS 추가 (1 : 1). 3 ㎎ / ㎖의 콜라게나 A와 1 단위 / ㎖의 DNase I을 추가까지 반복 상하 피펫 팅하여 세포를 목을 베다 400 rpm으로 37 ℃에서 진탕하면서 30 분간 배양한다. 주 : 바람직한 경우, 세포 현탁액은 배경 형광도의 저감하여, 유세포 측정의 감도를 향상시킬 수 밀도 구배 원심 분리에 의해 미엘린 및 세포 파편을 오염 지울 수취득해야 할 이벤트의 수를 D (섹션 3.5 참조). </li><li> 실온에서 2 분 동안 250 XG에 원심 분리기. 상등액을 버리고 1 ml의 10 % 소 태아 혈청 (FCS)에 펠렛을 재현 탁 / 둘 베코 최소 필수 배지 (DMEM) 및 최대 반복 상하 피펫 팅하여 다시 세포를 목을 베다. </li><li> 실온에서 2 분 동안 250 XG에 원심 분리기. 세척 단계를 반복합니다. </li><li> 1 ㎖의 PBS에서 세포 펠렛을 재현 탁하고, 2 mL의 주사기의 플런저를 사용하여 (50 ㎖의 튜브 위에 위치)은 70 ㎛의 메쉬 체로 척수 짠다. </li><li> 4 ml의 PBS와 메쉬를 씻으십시오. RT에서 3 분 동안 1,800 XG에 원심 분리기. , 상층 액을 버리고 100 ㎕를 0.2 % BSA에서 세포 펠렛을 재현 탁 / PBS는 2 μL FcRI 차단 시약을 추가하고 어둠 속에서 실온에서 15 분 동안 품어. </li><li> 13 μL에게 항체 혼합물을 추가 어둠 속에서 실온에서 15 분을 품어, 실온에서 650 XG에서 6 분 동안 500 ㎕의 PBS와 원심 분리기를 추가합니다. </li><li> , 상층 액을 버린다 셀 PELLE를 재현 탁500 ㎕의 PBS에서 t (또는 적절한 주행 완충액) 및 튜브 유동 세포 계측법에 옮긴다. </li></ol></li></ol> 3. 유세포 분석 <ol><li> Olesch 외. (25)에 의해 기술 된 바와 같이 최적의 농도를 결정하기 위해 미리 모든 항체 적정한다. </li><li> 제조자의 지시에 따라 여러 색 보정 매트릭스를 만들기 위해 단일 ​​색 보정 항체 캡쳐 보상 비드를 사용한다. </li><li> 매일 제조자의 지침에 따라 특정 비드를 사용하여 기기 조정을 제어한다. </li><li> 직접 측정 유동 세포 계측법 전에, 세포를 30 μl를 유세포 절대 카운트 표준을 추가 절대 세포 수를 결정하는 (격리 절 2.1, 2.2, 2.3, 2.4 참조). 대신 카운트 비드를 사용하는 세포를 카운트 할 수있다. </li><li> 사이토 흐름으로 샘플 (50 이벤트 : 10 만 이벤트, 척수, 비장, 림프절, 혈액에서 세포)를 차지ND 특정 유동 세포 계측법 소프트웨어를 사용하여 분석한다. <ol><li> 유동 세포 계측법 소프트웨어를 열고 버튼 &quot;샘플을 추가&quot;를 눌러 FCS 3.0 파일을 추가합니다. </li><li> 두 번 클릭하여 추가 파일을 엽니 다. X 축 및 Y 축에 대한 채널을 조정한다. 관심의 세포 인구는 게이트를 만들 선택합니다 (그림 4 참조). </li></ol></li></ol> 4. 정량 PCR 분석 <ol><li> cDNA를로의 mRNA의 분리 및 전사 <ol><li> 페놀 - 클로로포름에 의해 요추 척수 (1/3), 비장 (1/8) 및 서혜부 림프절에서의 mRNA를 추출하고 에탄올 (26) 침전. <ol><li> 이를 위해, 10 분간 배양하고, 1 ㎖의 구 아니 디늄 티오 시아 네이트 - 페놀 혼합물 조직을 균질화. 200 μl의 클로로포름을 추가하고 10 분 동안 다시 품어. </li><li> 원심 분리 단계 후 (4 ° C에서 15 분 동안 18,000 XG), 위 수성 위상을 씻어 500 μl의 이소프로판올 및 원심 분리기 (4시 8 분 동안 18,000 XG 함께기음). </li><li> 500 ㎕를 에탄올로하고 원심 분리 단계 (4 ℃에서 5 분 동안 18,000 XG) 후 펠렛을 세척, 진공 농축기에서 펠렛 (30​​ ° C에서 5 분)을 건조. 그 후, 30 ㎕의 물에 펠렛을 재현 탁. </li></ol></li><li> 혈액에서의 mRNA를 추출하기 위해, 원심 분리기 500 μL의 EDTA 안정화 혈액 (300 XG에 10 분 4 ° C). <ol><li> 상기 버피 코트를 받아 백혈구를 함유 한 용액 (150 mM의 NH 4 CL 100 밀리미터의 NaHCO3, 0.1 mM의 EDTA 나트륨-의 pH 7.4) 1 ㎖에 용해시키기 희석. </li><li> RT에서 10 분 동안 배양 한 후 6 분 동안 650 XG에서 세포를 원심 분리 후 PBS로 두 번 세척 하였다. </li><li> 제조업체의 지침에 따라 RNA 추출을위한 키트를 사용하여 백혈구 (백혈구)에서 mRNA의 압축을 풉니 다. </li></ol></li><li> 제조업체의 지침에 따라 임의의 헥사을 포함하여 cDNA 합성을위한 키트를 사용하여 cDNA 합성을 수행합니다. CDN에 200 NG의 mRNA를 사용하여합성. </li></ol></li><li> 정량 PCR <ol><li> 특정 mRNA의 양을 정량화하기 위해, 1 ㎕의 cDNA를, 1 μM 역방향 / 정방향 프라이머 및 제조업체의 지침 27에 따라 염료를 결합 형광 DNA를 사용합니다. 프라이머 세트의 서열은 표 1을 참조하십시오. , IL-1β의 CT 값을 측정 IL-6, IL-23, 정량적 PCR 시스템을 이용 IFNγ, TNFα 및 PPIA (펩 티딜 프 롤릴 이성화 효소). </li><li> 상대 mRNA 발현을 비교 CT (사이클 임계 값) 방법 (27)을 사용하여 결정합니다. <ol><li> (이전의 연구에서 바르트 외. 28 Schiffmann 외. 29 Schiffmann 바와 같이이를 위해, 표적 유전자의 PPIA 평균 CT 값을 뺀 PPIA의 발현 수준에 대한 표적 유전자의 CT 값을 정규화 등의 등. 30). 그 후, ΔCT 값을 정상화하는, 사용, 소위 ΔΔCT 값을 계산미처리 된 쥐의 표적 유전자의 발현 수준 EAE 마우스에서 표적 유전자의 다시 EAE 마우스에서 ΔCT 값으로부터 미처리 된 쥐의 평균 ΔCT 값을 뺀. </li><li> 표적 유전자의 상대적인 mRNA의 발현을 얻기 위해, 다음 식을 이용하여 비율을 계산한다 : 2 - ΔΔct한다. </li></ol></li></ol></li><li> 각각의 프라이머의 특이성을 테스트합니다. 2 % 아가로 오스 겔 (31)을 사용하여 증폭 된 단편의 크기를 결정한다. 단편의 크기는 표 1에 나타낸다. </li></ol>

MJP is a consultant to Xellia and to Leo Pharmaceuticals.

여기에 설명 된 EAE 모델은 MS의 모델로 가장 주목을 받고 있으며, 통상적으로 MS (32)에 대한 치료 적 전략을 시험에 사용된다. 마우스 질병은 MS의 많은 임상 및 조직 학적 특징을 나타내고 신경 세포의 항원에 대한자가 면역의 유도에 의해 발생합니다. 미엘린 항원에 감작은 CNS 내로 혈액 뇌 장벽 부전함으로써 면역 세포의 침윤과 관련된다. 우리의 연구 결과는 면역 세포가 급성 단계에서 림프절에 일시적으로 증가 할 것으로 나타났다. 비장 T 세포와 B 세포는 질병의 전임상 단계에서 감소한다. 호중구 질환 의존적으로 증가하는 반면 혈액 순환에있어서, T 세포, B 세포, 수지상 세포 및 단핵구는 전임상 단계에서 일시적으로 증가한다. 마지막으로, 척수, 면역 세포의 증가를 검출 (도 2)이다. 이러한 데이터는 T 세포 및 B 세포의 역할 비장, 마이그레이션 것을 나타이들 세포를 들어, 활성화 및 증식 된 림프절 저장조. 이어서, 이들은 척수로의 순환을 통해 이동한다. 호중구, 단핵구 및 수지상 세포, 다른 한편으로, CNS 내로 순환을 통해 골수에서 이동한다. IL-6가 일시적 발병에서 상향 조절되는 반면, 우리의 데이타는, 척수, IFNγ, TNFα 및 IL-1β는 질환 의존적으로 조절되는 것을 알 수있다. 이러한 데이터는 EAE 병리가받은 Th1 세포와 Th17 의해 구동한다는 가설을지지한다. Th1 세포는 다시 TNFα 및 33 IL-1β를 해제 식세포를 활성화 IFNγ을 놓습니다. 또한, IL-6와 Th17받은 Th1 세포의 분화를 유도함으로써 EAE (34)의 발전을 촉진하는 것으로 알려져있다. 임상 증상의 발병과 질병의 심각도의 날 EAE 마우스의 변수입니다. 우리의 경험을 바탕으로, 여러 연구가있다이에 대한 easons. 전임상 단계에서의 스트레스에 노출 된 마우스는 질병의 심각도 감소 및 질환 발병의 지연을 나타낸다. 마우스의 하우징은 또한 EAE의 정도 또한 발병의 날에 영향을 미친다. 최근에는 마우스의 공생 미생물은 이에 마이크로 바이 그리고, EAE 병리에 영향을 미칠 수있다 EAE (35) 및 다른 하우징 상황의 발달에 영향을 미칠 것으로 나타났다. 또한, 새로 제조 백일해 독소를 사용하는 것이 매우 중요하다. 백일해 독소 손상 EAE의 개발을위한 전제 조건 인 혈액 뇌 장벽. 만료 날짜 이후 유화 MOG 35-55 펩타이드를 사용하지 마십시오. 마우스의 시대는 EAE의 병리에 영향을 미친다. 따라서, 재현성 EAE 모델을 생성하기 위해 충족되어야 할 몇 가지 규칙이있다. 가능하면, 동일한 공급 업체에서 10, 13 주에서 쥐 세 사이의 마우스를 사용합니다. 쥐가 외부 공급 업체에서 주문하는 경우, 마우스는 두 가지에 대한 순응 할 수 있도록동물의 집에서 주. 그들이 취급에 익숙해 질 수 있도록 부드럽게 EAE 유도 전에 쥐를 처리합니다. EAE 유도 후 불필요한 처리를하지 마십시오. 그들은 쉽게 즉시 임상 증상을 보여으로 도달 할 수있는 음식과 물과 마우스를 제공합니다. 마우스는 약물로 치료하여야하면 응력 교란 효과를 피하기 위해, 식품 또는 마시는 물을 혼합하는 것이 최선이다. 위관 영양 또는 주사제 약물 투여에 필수적인 경우, 차량에 대해 동일한 경로를 사용하는 것이 중요하다. 여기에 설명 된 기본 프로그레시브 EAE 모델 이외에도, 재발 완화 성 EAE 모델도 존재한다. 서로 다른 질병 코스는 다양한 마우스 균주의 다른 항원의 투여에 의해 유도된다. 따라서, MOG (35)의 응용 프로그램 - 이러한 C57BL / 6, Sv129, B10, NOD 및 Biozzi 마우스 등 마우스 균주의 55 차 진행성 질환 양식으로 연결됩니다. 흥미롭게도, 발병의 날은 다양한 마우스 균주에 다릅니다. 이므로C57BL / 6, SV129과 B10 마우스는 Biozzi 마우스는 이십일일 (36) 이후 첫 번째 임상 증상을 보여, 12 일 (11)에 대한에서 첫 번째 임상 증상을 개발한다. 이전의 연구에서, 129S4 / SvJae × C57BL / 6 하이브리드는 첫 날 (11) (28)에 대한에서 임상 증상을 나타내는 것으로 나타났다. 테오 단백질의 주입 (PLP) 131-151이의 유도에 SJL 마우스에 연결되는 재발 송금 질병 코스 37. 가장 EAE 모델 연구의 초점에 달려 사용. 재발 위상 관심되고있는 경우, 재발 완화 성 모델은 질병 발병 메인 포커스 경우 반면 사용되어야 프로그레시브 모델이 사용되어야한다. 특정 단백질의 역할은 녹 - 아웃 마우스를 사용 EAE 모델에서 조사하는 경우, 모든 균주가 상 EAE 및 녹아웃 균주의 가능성 교잡을 유도하는 데 사용할 수있는 다른 것을 명심하는 것이 중요 민감한 변형이 필요하다. 세 가지 가장 널리 사용 tMS 동물 모델의 씨네마 스테이션 (1) EAE자가 항원 - 유도된다; (2) 자연 급속도 만성 탈수 초성 질환을 유도하고, (3) 탈수 초 38 독소 유도. EAE 모델은 예컨대 수초 희소 돌기 아교 세포 단백질 또는 단백질 테오 38로서 autoantigenic 펩티드의인가에 의해 염증 및 면역 반응의 유도에 의해 특징 지어진다. 자발적인 EAE는 미엘린 희소 돌기 아교 세포 단백질 39의 펩타이드에 대해 T 세포 수용체를 과발현하는 형질 전환 마우스에서 발생한다. 바이러스로 인한 만성 염증을 유도하는, 중추 신경계의 신경 영양성 감염 Theiler`s 쥐 뇌척수염 바이러스, 예를 들어, 유도 될 수있다. 바이러스에 감염된 세포는 모두 T 세포와 체액 성 반응에 의해 공격과 만성 탈수 초화 40, 41으로하여지도한다. 독소 유도 된 탈수 초화는 구리 킬레이트 cuprizone (42), 예를 들어 유도 될 수있다. 이 모델은 demyeli하기 위해 특별히 리드국가는 cuprizone은 염증 과정은 사소한 역할을하는 반면, 별아교 세포와 미세 아교 세포의 활성화에 따라서, 희소 돌기 아교 세포 및 리드를 공격하기 때문이다. 독소의 간격 후에, 새로운 올리고 덴드로 사이트가 생성되어 새로운 수초가 형성된다. 모델은 염증, 면역 및 탈수 초성 프로세스에 대해서 다르기 때문에 이들 세 가지 모델의 사용은 상보적인 방법으로, MS의 발병의 다양한 측면에 대한 약물의 효과를 평가할 수있다. EAE 및 바이러스에 의한 모델, 염증과자가 면역 과정에서 주로 독소에 의한 모델 반면, 질병을 구동 탈수 초성과 remyelinating 프로세스가 지배적이다. MS 치료에 잠재적 약물의 임상 시험은 적어도 세 가지 모델, 독소 - 유도 모델, 재발 완화 성 EAE 및 차 시브 EAE 또는 급속도 유발 모델에 대한 약물의 효과를 검증하기 위해 사용되어야한다. EAE 모델은 그녀를 설명즉 그러한받은 Th1, Th17 및 B 세포를 43, 44 등의 질환의 주요 세포 드라이버를 식별하는 상기 MS와 같은 질병 과정의 발전기구에 상기 통찰력을 얻기 위해 사용될 수있다. MS의 개발을 촉진하여 병변을 확인 프로세스들과 관련된 염증 및 면역 과정의 더 나은 이해 확률이 더 높다는 새로운 치료 전략이 개발 될 수 있다는 것이다. 그럼에도 불구하고, 여기에 설명 된 EAE 모델은 단지 MS와 공통점이 몇 가지 특성을 가지고 있으며, 인간의 질병에서 몇 가지 분명한 차이가 있습니다. 가장 눈에 띄는 차이점은 MS 환자가 EAE 모델에서 재생되지 않는 질병 프리젠 테이션에서 다양 것입니다. 이것은 MS 환자 및 EAE 쥐 및 생쥐 균주 근친 사실 상이한 병변 패턴에 기인 할 수있다. MS 환자는 주로 이종 병변 반면 EAE 생쥐 균질 병변, 척수 가장 두드러진뇌 45, 46에서 발견. 또한, MS와 EAE는 개발 Th1 세포와 Th17 세포의 중요한 기여를 공유하지만, MS는 대조적으로, CD8 + T 세포가 EAE 병리학 (33) 내의 작은 역할을한다. 탈수 초성 프로세스 선택적 평가 덜 의무 반면 결론적 EAE 모델은자가 면역, 염증 반응과 신경 변성의 결합 효과에 주로 초점을 맞춘다. 탈수 초성의 별개의 연구는 47 프로세스에 따라서, 예 cuprizone 모델과 같은 다른 동물 모델이 사용될 수있다. EAE 모델은, 그럼에도 불구하고 MS (33)의 유용한 모델 불완전하지만.

다발성 경화증 (MS)과 대응하는 동물 모델 실험자가 면역 뇌척수염 (EAE)은 중추 신경계 (CNS)에서,자가 면역 신경 염증 변화를 나타낸다. 초기 활성 및 MS EAE 병변 침투 면역 세포의 존재를 특징으로한다. MS의 병인은 알려져 있지 않다, 그러나 널리 자기 반응성 T 세포에 의해 매개되는 수초의 파괴를 포함하는 것으로 간주된다. 이 자기 ​​반응성 T 세포는 순환에서 B 세포, 단핵구 및 호중구와 같은 다른 면역 세포를 끌어 염증성 사이토 카인 및 케모카인을 분비한다. 단핵 세포는 대 식세포로 분화. 자기 반응성 T 세포에 의해 분비 된 인터페론 감마 (IFNγ)는 염증성 식세포에 식세포 편광. 희소 돌기 아교 세포의 세포 사멸을 촉진 식세포 염증성 사이토 카인 방출 및 반응성 산소 종. 희소 돌기 아교 세포의 죽음은 탈수 초화로 연결됩니다. 또, B 세포는 P로 분화궁극적 미엘린의 열화 발생 lasma 세포 및 수초 대해 분리자가 항체. 수초의 손실은 신경 축삭 저하하여 MS (1)의 주요 특징을 나타내는 CNS의 병변 부위의 형성을 이끈다. 외주에서, T 세포와 B 세포는 림프절에서 활성화되고, 이들은 비장에서 증식 및 중추 신경계로의 순환을 통해 이동한다. 단핵구 및 호중구가 골수 증식 및 중추 신경계로의 순환을 통해 마이그레이션도. 혈액으로 또는 CNS에 혈액에서 골수, 비장과 림프절에서 백혈구의 혈관 외 유출은 케모카인과 케모카인 수용체에 의해 매개 백혈구와 내피 세포 사이의 분자 상호 작용 등 여러 가지 요인에 따라 달라집니다 다단계 과정이다. 다양한 유형의 세포에 의한 케모카인 생산은 면역 reactio 동안 유도 될 수있다이어서 2,3- 염증 부위로 면역 세포를 모집 종양 괴사 인자 α (TNFα), IFNγ 및 인터루킨 -6 (IL-6)와 같은 사이토 카인에 의해 N. 면역 세포는 염증성 사이트 세포 유형 및 이동 경로에 따라 그 표면에 케모카인 수용체의 서브 세트를 제시한다. 따라서, CXCR2, CCR1 및 CXCR1는 골수와 혈액 4 성숙 호중구에 표현, 그 리간드, CXCL2, CCL5 또는 CXCL6 결합되어, 각각 호중구를 활성화하고, 이후 세포의 이동을 내피에 자신의 접착을 촉진하고 조직 5-9로. CCL2 및 CCL20은 각각 CCR2 11 CCR6 (12)을 표현하는 단핵 세포와받은 Th1 / Th17 세포 (10)을 유치 할 수 있습니다. T 세포, 단핵구와 대 식세포 (13)를 포함하여 다른 세포 유형으로 표현 CCR1 및 CCR5, CCL3, CCL5 및 CCL7을 결합하여 MS (14) 중 상향 조절된다. CXCR3가 T 세포에 발현 및 CCL9, CCL10에 결합되고,CCL11 15. MS 처리 한 주요 전략은 면역 세포의 고갈 또는 CNS로 면역 세포 침윤을 방지한다. 따라서, 특정 케모카인 수용체의 봉쇄 EAE에서 조사되었다. 길항 또는 CCR1 16, CCR2 (17)의 유전 삭제, CCR7 18 CXCR2 19 길항 또는 CCR1 (20)의 유전 삭제 반면, CCR5 20 CXCR3 (21)가 병리학을 감소하지 않았다 EAE 병리을 줄일 수 있습니다. 따라서, 특정 백혈구 케모카인 수용체의 발현은 CNS에 후자의 침투를위한 중요하고 EAE 과정을 지시한다. 침투 면역 세포는 차례로, 염증 또는 신경 (22)의 분해를 촉진, TNFα, IL-6 및 IL-1β와 같은 사이토 카인을 방출하기 때문에 면역 세포의 고갈은 MS 환자의 효과적인 치료 전략이다. 또한, 자동반응 Th1 세포는 다시 TNFα, IL-1β 및 IL-23을 출시 할 대 식세포를 자극 IFNγ을 놓습니다. 이 원고 EAE 면역 세포 분포 EAE 마우스의 다양한 조직에서 사이토킨 수준 (mRNA의) 결정의 유도를 설명한다. 세포를 마지막 CNS 병변의 형성으로 이어질 염증 과정의 시간 의존성에 대한 개요를 제공하는 질환 과정에서 다른 시점에서 분리 하였다.

<table border="0" cellpadding="0" cellspacing="0" width="913">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">ABI Prism 7500 Sequence Detection System&#160;</td>
			<td style="width:305px;">Applied Biosystems, Austin, USA</td>
			<td style="width:119px;"></td>
			<td style="width:195px;">quantitative PCR system</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Accutase</td>
			<td>Sigma Aldrich Munich, Germany</td>
			<td>A6964</td>
			<td>cell detachment solution</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD3-PE-CF594</td>
			<td>BD, Heidelberg, Germany</td>
			<td>562286</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD4-V500</td>
			<td>BD, Heidelberg, Germany</td>
			<td>560782</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD8-eFluor650</td>
			<td>eBioscience, Frankfurt, Germany</td>
			<td>95-0081-42</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD11b-eFluor605</td>
			<td>eBioscience, Frankfurt, Germany</td>
			<td>93-0112-42</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD11c-AlexaFluor700</td>
			<td>BD, Heidelberg, Germany</td>
			<td>560583</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD19-APC-H7&#160;</td>
			<td>BD, Heidelberg, Germany</td>
			<td>560143</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CD45-Vioblue&#160;</td>
			<td>Miltenyi Biotec, Bergisch Gladbach, Germany</td>
			<td>130-092-910</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">CompBeads</td>
			<td>BD, Heidelberg, Germany</td>
			<td>552843</td>
			<td>compensation beads</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Collagenase A</td>
			<td>Sigma Aldrich Munich, Germany</td>
			<td>C0130</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cytometric absolute count standard&#160;</td>
			<td>Polyscience, Eppelheim, Germany</td>
			<td>BLI-580-10</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cytometer Setup and Tracking beads&#160;</td>
			<td>BD, Heidelberg, Germany</td>
			<td>642412</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">DNase I</td>
			<td>Sigma Aldrich Munich, Germany</td>
			<td>D5025</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:295px;">EAE Kit</td>
			<td>Hooke Laboratories, Lawrence, USA</td>
			<td>EK2110</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">F4/80-PE-Cy7&#160;</td>
			<td>BioLegend, Fell, Germany</td>
			<td>123114</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">First Strand cDNA-Synthesis kit&#160;</td>
			<td>Thermo Scientific, Schwerte, Germany</td>
			<td>K1612</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Fc receptor-1 blocking buffer&#160;</td>
			<td>Miltenyi Biotec, Bergisch Gladbach, Germany</td>
			<td>130-092-575</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Flow cytometric absolute count standard</td>
			<td>Polyscience, Eppelheim, Germany</td>
			<td>580</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">FlowJo software v10&#160;</td>
			<td>Treestar, Ashland, USA</td>
			<td></td>
			<td>flow cytometry software</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">LSRII/Fortessa&#160;</td>
			<td>BD, Heidelberg, Germany</td>
			<td></td>
			<td>flow cytometer</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Ly6G-APC-Cy7&#160;</td>
			<td>BD, Heidelberg, Germany</td>
			<td>560600</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Lysing solution&#160;</td>
			<td>BD, Heidelberg, Germany</td>
			<td>349202</td>
			<td></td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;">Maxima SYBR Green&#160;</td>
			<td>Thermo Scientific, Schwerte, Germany</td>
			<td>K0221</td>
			<td>fluorescent DNA binding dye&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">RNeasy Mini Kit&#160;</td>
			<td>Qiagen, Hilden, Germany</td>
			<td>74104</td>
			<td>RNA extraction kit</td>
		</tr>
	</tbody>
</table>

induction of experimental autoimmune encephalomyelitis in mice and evaluation of the disease-dependent distribution of immune cells in various tissues

다발성 경화증은인지 모터 손상에 기인하는 중추 신경계 (CNS)에서 병변 형성을 특징으로하는 염증성자가 면역 질환 인 것으로 추정된다. 이 또한 CNS 병변의 형성, 모터의 손상을 특징으로하며,자가 면역 및 염증 반응에 의해 구동되기 때문에 실험적자가 면역 뇌척수염 (EAE)은 MS의 유용한 동물 모델이다. EAE 모델 중 하나는 미엘린 희소 돌기 아교 세포 단백질 생쥐 (MOG) 35-55 유래의 펩타이드로 유도된다. EAE 마우스는 진행성 질환 코스를 개발한다. 이 과정은 세 단계로 구분됩니다 전임상 단계 (하루 0-9), 질병 발병 (일 10-11) 및 급성기 (일 12-14). MS와 EAE는 CNS 침투 자기 반응성 T 세포에 의해 유발된다. 이러한 T 세포는 또한 면역 세포의 채용으로 이어질 케모카인 및 사이토 카인을 분비한다. 척수 (D)에 따라서, 면역 세포 분포세 가지 질병의 단계를 uring하는 조사 하였다. T 세포, B 세포 및 단핵 세포의 활성화 / 확산 / 축적이 시작되는 질병의 시점을 강조하기 위해, 림프절, 비장 및 혈액에서 면역 세포 분포는 또한 평가 하였다. 또한, 세 가지 질병 단계에서 여러 가지 사이토 카인 (IL-1β, IL-6, IL-23, TNFα, IFNγ)의 수준은 질환의 염증 과정에 대한 통찰력을 얻기 위해, 측정 하였다. 결론적으로, 데이터는 EAE 병리 동안 면역 세포의 기능 프로파일의 개요를 제공한다.

그림 1은이 문서에서 설명하는 다른 방법의 개략적 인 개요를 제공합니다. 1) 마우스는 MOG 35-55 항원의 주사를 수신 및 10.7 ± 0.3 일 (28) 후 초기 임상 증상을 개발한다. EAE 마우스의 대표적인 질병 코스. 그림 1과 2) 다양한 조직 (비장, 림프절, 요추 척수)에 표시되고 혈액은 전임상 단계 (2 일, 4 일 동안 서로 다른 시간 지점에서 제어 및 EAE 생쥐에서 추출 하루 6) 질환의 발병 동안 (10 일) 및 질병 (12 일, 14 일째). 3) EAE 발달을 조절하는 사이토 카인의 mRNA 발현 프로파일의 급성기, 각종의 판단 조직은 정량적 PCR을 사용하여 질병 과정에서 다른 시점에서 추출 하였다. 4) 단셀 추출 다양한 조직으로부터 분리되고질병 과정과 면역 세포 분포 중 상이한 시점에서 유세포 분석기를 사용하여 측정. 비장 및 림프절에서 T 세포와 B 세포는 가장 저명한 세포 유형으로 관찰된다. 림프절 달리, 비장, 또한 단핵구 및 호중구의 수가 많으면 존재한다. 모든 면역 세포 급성기 림프절의 일시적인 증가를 보여 비장 만 대 식세포, B 세포, T 세포 및 호중구가 증가하는 반면. 혈액, 모든 면역 세포는 전임상 단계에서 일시적으로 증가한다. 요추 척수, 모든 면역 세포의 질병에 의존 증가가 떨어져 아마도 척수에 자신의 입구 (그림 2) 후 대 식세포로 분화 단핵 세포에서 관찰된다. CD4 + 및 CD8 + T 세포는 다른 질환 과정시 비장, 림프절, 혈액에서는 유사한 변화를 나타낸다. 오전척수 옹 침윤 세포, CD4 + T 세포의 증가는 대부분 (도 3)을 발음한다. 도 4에서, 다른 세포 집단의 결정을위한 게이팅-전략이 도시되어있다. 단핵구 (CD45hi, CD3-, Ly6G-, CD19-, CD11c-, CD11b를 +), 대 식세포 (CD45hi, CD3-, Ly6G-, CD11c-을, CD11b를 +, F4 / 다음과 같이 구체적으로,이 논문에 기술 된 세포 집단이 확인되었다 80hi), 호중구 (CD45hi, CD3-, CD11b를 +, Ly6G +), 수지상 세포 (CD45hi, CD3-, Ly6G-, CD19-, CD11c 양성의 +), B 세포 (CD45hi, CD3-, CD19 +) T 세포 (CD45hi, CD3 +) , CD4 + T 세포 (CD45hi, CD3 +, CD4 +) 및 CD8 + T 세포 (CD45hi, CD3 +, CD8 +). 세포의 수는, 따라서 절대 세포 수를 반영하는 조직의 양 (비장의 무게, 림프절, 요추 척수) 또는 혈액량과 관련된다. 이 총 세포의 백분율이 측정 된 세포 유형을 표현하는 것도 가능하다. lym에서IL-6 mRNA의 발현이 질병 의존적으로 증가되는 반면, pH가 노드는, IL-23의 mRNA의 발현은 일시적으로, 전임상 단계에서 증가된다. 질환의 발병에서 IL-1β mRNA 발현이 발생하는 동안, 비장에서 IL-6 및 IL-23 mRNA 발현은 전임상 단계에서 일시적으로 증가한다. 혈액에서 TNFα의 mRNA 발현은 질병에 비례하여 증가한다. 요추 척수에서 TNFα, IL-1β 및 급성 단계에서 IFNγ 증가, IL-6는 시작 단계 (그림 5) 중 상향 조절되는 반면. <img alt="그림 1" src="/files/ftp_upload/53933/53933fig1.jpg" /> 그림 1 : 유도 및 EAE의 면역 학적 평가를위한 작업 흐름의 계획. 1) EAE 임상 증상의 발전을 선도 마우스에서 유도된다. 임상 증상은 구 분입니다0) 흔적, 꼬리 0.5) 말단 마비, 1) 꼬리의 완전한 마비, 1.5) 맥 빠진 꼬리와 뒷다리의 약한 약점, 2) 다리를 저는 꼬리와 뒷다리의 심각한 약점을 다음 없기 때문에, 임상 점수에 의해 에드 2.5) 맥 빠진 꼬리와 하나의 뒷다리, 3) 다리를 저는 꼬리와 두 뒷다리 마비의 마비. 도시 된 도면에 사용 된 마우스의 수는 마우스가 질환 과정, 비장, 서혜부 림프절, 혈액 및 요추 척수 중에 다른 시점에서 희생) 제 그림 바르트 외. (28)로부터 변형되었다.이 있었다 이 조직에서 분리 추출 및 단일 세포. 3) 다양한 조직에서 면역 세포의 분포, 유동 세포 계측법에 의해 결정. 4) 정량적 PCR에 의해 결정되는 다른 조직에서 다양한 사이토 카인에 대한 mRNA의 발현. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53933/53933fig1large.jpg" target="_blank">더 큰 버전을 보려면 여기를 클릭하십시오 이 f를</a>igure. <img alt="그림 2" src="/files/ftp_upload/53933/53933fig2.jpg" /> 그림 2 :. 면역 세포 배포, FACS (형광 활성 세포 정렬) 비장의 분석, 림프절, 다른 질병 단계에서 EAE 쥐에서 혈액과 척수 샘플에 의해 결정 실험에 도시 된 바와 같이, 그룹 당 마우스의 수는 2였다 - 10 호중구의 분포는 / 피와 호중구의 단핵구는 / 척수에서 대 식세포는 적응 바르트 등 (28)에서 수정됩니다.. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53933/53933fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" src="/files/ftp_upload/53933/53933fig3.jpg" /> 그림 3 : CD4 + T 세포와 CD8 <suFACS 분석에 의해 결정 다른 질병 단계에서 EAE 마우스에서 샘플에있는 P&gt; + T 세포의 분포. A) 림프절, B) 비장, C) 피와 D) 척수. . ± 표준 오차 (SEM) 수단 (10) 결과 제시 - 도시 한 실험에서, 그룹 당 마우스의 수는 2였다 <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53933/53933fig3large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하세요.</a> <img alt="그림 4" src="/files/ftp_upload/53933/53933fig4.jpg" /> 그림 4 : T 세포, 일 12 A) 모든 셀에서 SSC / CD45의 음모에 EAE 쥐의 척수에서 B 세포, 호중구, 단핵구, 수지상 세포와 대 식세포의 유세포 분석을위한 게이팅 전략. 문 :. CD45 + 세포에서 CD45 + 세포 B) FSC-H /의 음모 FSC-W에스. 문 : 하나의 세포 C) 단일 세포에서 SSC-A의 플롯 / FSC-A.. 문 : 가능한 세포. D) 가능한 세포에서 FSC-H / CD3의 줄거리. 문 : CD3 + 및 CD3 - 세포 E) CD3 + 세포의 CD4 / CD8의 줄거리.. 문 : CD4 + CD8 - (CD4 + T 세포) 및 CD4 - CD8 + (CD8 + T 세포) F) CD3에서 CD19 및 Ly6G / CD11b를의 음모 - 세포.. 문 : CD19 + CD11b를 - 세포 (B 세포), Ly6G + CD11b를 + 세포 (호중구) 및 CD19 - Ly6G - 셀 G) CD19에서의 CD11c / CD11b를 세포의 음모 - Ly6G - 세포 :. 게이트의 CD11c + 세포 (수지상 세포 )과의 CD11c - 세포 H) SSC / F4 / 80 FR의 줄거리.옴의 CD11c - 세포. 문 : F4 / 80 - 세포 (단핵구)와 F4 / 80 + 세포 (대 식세포). 9 중 하나를 대표 플롯이 표시됩니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53933/53933fig4large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 5" src="/files/ftp_upload/53933/53933fig5.jpg" /> 그림 5 :. 사이토 카인 프로필 (IL-1β, IL-6, IL-23, TNFα, IFNγ) 다른 질병 단계에서 EAE 마우스에서 샘플에 A) 림프절, B) 비장, C) 피와 D) 척수. mRNA의 발현 수준은 프로필 머라 A (PPIA)를 펩 정규화하고, 동일 연령의 미처리 마우스의 mRNA 발현을 사용하여 계산 하였다. 측정은 세중의에서 수행되었다. 3. 결과 역 ± 수단으로서 제시 - 그룹 당 마우스의 수는 2였다ndard 오류 (SEM). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/53933/53933fig5large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> 유전자 </td><td colspan="3"> 앞으로 </td><td colspan="3"> 역 </td><td> 의 fragment 크기 (BP) </td></tr><tr><td> IL-1β </td><td colspan="3"> CTGGTGTGTGACGTTCCCATTA </td><td colspan="3"> CCGACAGCACGAGGCTTT </td><td> (76) </td></tr><tr><td> IL-6 </td><td colspan="3"> TAGTCCTTCCTACCCCAATTTCC </td><td colspan="3"> TTGGTCCTTAGCCACTCCTTC </td><td> (76) </td></tr><tr><td> IL-23 </td><td colspan="3"> GAGCAGCAACTCTGACTGAGCC </td><td colspan="3"> GAACAGCACAAGTCCTAATGGGTTA </td><td> (127) </td></tr><tr><td> IFNγ </td><td colspan="3"> CACGGCACAGTCATTGAAAGC </td><td colspan="3"> CACCATCCTTTTGCCAGTTCC </td><td> (118) </td></tr><tr><td> TNFα </td><td colspan="3"> TGACAAGCCTGTAGCCCACG </td><td colspan="3"> GCCTTGTCCCTTGAAGAGAACC </td><td> 178 </td></tr><tr><td> PPIA </td><td colspan="3"> GCTGGACCAAACACAAACGG </td><td colspan="3"> GCCATTCCTGGACCCAAAAC </td><td> (144) </td></tr></tbody></table> 표 1 : 프라이머 쌍.

Watch this Scientific Journal Video about Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues at JoVE

Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

다양한 조직에서 면역 세포의 질병에 의존하는 유통의 마우스 및 평가에 실험자가 면역 뇌척수염의 유도

Multiple sclerosis is presumed to be an inflammatory autoimmune disease, which is characterized by lesion formation in the central nervous system (CNS) ...

induction-experimental-autoimmune-encephalomyelitis-mice-evaluation

Nanyang Technological University

Research

JoVE Journal

Immunology and Infection

23.4K 조회수.  Goethe University Hospital Frankfurt. This manuscript describes the methods for induction and scoring of the experimental autoimmune encephalomyelitis (EAE) model, together with the assessment of immune cell distribution and mRNA cytokine levels in lymph nodes, spleen, blood and spinal cord using flow cytometry and quantitative PCR, respectively, at various disease phases.

비디오: Induction of Experimental Autoimmune Encephalomyelitis in Mice and Evaluation of the Disease-dependent Distribution of Immune Cells in Various Tissues

Preparation of Mouse Pituitary Immunogen for the Induction of Experimental Autoimmune Hypophysitis

Autoimmune hypophysitis is a chronic inflammation of the pituitary gland caused or accompanied by autoimmunity1. It has traditionally been considered a rare disease but reporting has increased markedly in recent years. Hypophysitis, in fact, develops not uncommonly as a "side effect" in cancer patients treated with antibodies that block inhibitory receptors expressed on T lymphocytes, such as CTLA-42 and PD-1 receptors. Autoimmune hypophysitis can be induced experimentally by injecting mice with pituitary proteins mixed with an adjuvant3. In this video article we demonstrate how to extract proteins from mouse pituitary glands and how to prepare them in a form suitable for inducing autoimmune hypophysitis in SJL mice.

Autoimmune hypophysitis can be reproduced in mice by injecting an extract of mouse pituitary proteins.

실험 면역 Hypophysitis의 유도를위한 마우스 뇌하수체 Immunogen의 준비

Autoimmune hypophysitis is a chronic inflammation of the pituitary gland caused or accompanied by autoimmunity1.  It has traditionally been considered a ...

연구

면역학 및 감염병학

Induction of Experimental Autoimmune Hypophysitis in SJL Mice

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse models allow us to study how diseases unfold, often providing a good replica of the same processes occurring in humans. For some autoimmune diseases, like type 1A diabetes, there are models (the NOD mouse) that spontaneously develop a disease similar to the human counterpart. For many other autoimmune diseases, however, the model needs to be induced experimentally. A common approach in this regard is to inject the mouse with a dominant antigen derived from the organ being studied. For example, investigators interested in autoimmune thyroiditis inject mice with thyroglobulin2, and those interested in myasthenia gravis inject them with the acetylcholine receptor3. If the autoantigen for a particular autoimmune disease is not known, investigators inject a crude protein extract from the organ targeted by the autoimmune reaction. For autoimmune hypophysitis, the pathogenic autoantigen(s) remain to be identified4, and thus a crude pituitary protein preparation is used. In this video article we demonstrate how to induce experimental autoimmune hypophysitis in SJL mice.

This video shows how to induce autoimmune hypophysitis in SJL mice and how to assess its severity by histopathology.

SJL 마우스의 실험적 면역 Hypophysitis의 유도

Autoimmune hypophysitis can be reproduced experimentally by the injection of pituitary proteins mixed with an adjuvant into susceptible mice1. Mouse ...

Seven Steps to Stellate Cells

Hepatic stellate cells are liver-resident cells of star-like morphology and are located in the space of Disse between liver sinusoidal endothelial cells and hepatocytes1,2. Stellate cells are derived from bone marrow precursors and store up to 80% of the total body vitamin A1, 2. Upon activation, stellate cells differentiate into myofibroblasts to produce extracellular matrix, thus contributing to liver fibrosis3. Based on their ability to contract, myofibroblastic stellate cells can regulate the vascular tone associated with portal hypertension4. Recently, we demonstrated that hepatic stellate cells are potent antigen presenting cells and can activate NKT cells as well as conventional T lymphocytes5. 

 Here we present a method for the efficient preparation of hepatic stellate cells from mouse liver. Due to their perisinusoidal localization, the isolation of hepatic stellate cells is a multi-step process. In order to render stellate cells accessible to isolation from the space of Disse, mouse livers are perfused in situ with the digestive enzymes Pronase E and Collagenase P. Following perfusion, the liver tissue is subjected to additional enzymatic treatment with Pronase E and Collagenase P in vitro. Subsequently, the method takes advantage of the massive amount of vitamin A-storing lipid droplets in hepatic stellate cells. This feature allows the separation of stellate cells from other hepatic cell types by centrifugation on an 8% Nycodenz gradient. The protocol described here yields a highly pure and homogenous population of stellate cells. Purity of preparations can be assessed by staining for the marker molecule glial fibrillary acidic protein (GFAP), prior to analysis by fluorescence microscopy or flow cytometry. Further, light microscopy reveals the unique appearance of star-shaped hepatic stellate cells that harbor high amounts of lipid droplets. 


 Taken together, we present a detailed protocol for the efficient isolation of hepatic stellate cells, including representative images of their morphological appearance and GFAP expression that help to define the stellate cell entity.

Here we describe a method for the isolation of hepatic stellate cells from mouse liver. For stellate cell purification, mouse livers are digested in situ and in vitro by pronase-collagenase treatment prior to density gradient centrifugation. This technique yields highly pure hepatic stellate cells.

셀을 별 모양으로 일곱 단계

Hepatic stellate cells are liver-resident  cells of star-like morphology and are located in the space of Disse between  liver sinusoidal endothelial cells ...

Overcoming Unresponsiveness in Experimental Autoimmune Encephalomyelitis (EAE) Resistant Mouse Strains by Adoptive Transfer and Antigenic Challenge

Experimental autoimmune encephalomyelitis (EAE) is an inflammatory disease of the central nervous system (CNS) and has been used as an animal model for study of the human demyelinating disease, multiple sclerosis (MS). EAE is characterized by pathologic infiltration of mononuclear cells into the CNS and by clinical manifestation of paralytic disease. Similar to MS, EAE is also under genetic control in that certain mouse strains are susceptible to disease induction while others are resistant. Typically, C57BL/6 (H-2b) mice immunized with myelin basic protein (MBP) fail to develop paralytic signs. This unresponsiveness is certainly not due to defects in antigen processing or antigen presentation of MBP, as an experimental protocol described here had been used to induce severe EAE in C57BL/6 mice as well as other reputed resistant mouse strains. In addition, encephalitogenic T cell clones from C57BL/6 and Balb/c mice reactive to MBP had been successfully isolated and propagated.
The experimental protocol involves using a cellular adoptive transfer system in which MBP-primed (200 &mu;g/mouse) C57BL/6 donor lymph node cells are isolated and cultured for five days with the antigen to expand the pool of MBP-specific T cells. At the end of the culture period, 50 million viable cells are transferred into naive syngeneic recipients through the tail vein. Recipient mice so treated normally do not develop EAE, thus reaffirming their resistant status, and they can remain normal indefinitely. Ten days post cell transfer, recipient mice are challenged with complete Freund adjuvant (CFA)-emulsified MBP in four sites in the flanks. Severe EAE starts to develop in these mice ten to fourteen days after challenge. Results showed that the induction of disease was antigenic specific as challenge with irrelevant antigens did not induce clinical signs of disease. Significantly, a titration of the antigen dose used to challenge the recipient mice showed that it could be as low as 5 &mu;g/mouse. In addition, a kinetic study of the timing of antigenic challenge showed that challenge to induce disease was effective as early as 5 days post antigenic challenge and as long as over 445 days post antigenic challenge. These data strongly point toward the involvement of a "long-lived" T cell population in maintaining unresponsiveness. The involvement of regulatory T cells (Tregs) in this system is not defined.

Overcoming Unresponsiveness in Experimental Autoimmune Encephalomyelitis EAE Resistant Mouse Strains by Adoptive Transfer and Antigenic Challenge

Certain mouse strains are able to resist induction of experimental autoimmune encephalomyelitis (EAE) with myelin basic protein. Described here is a simple immunization protocol that reverses the unresponsiveness and induces paralytic disease in several typical EAE resistant mouse stains.

입양 이전 및 Antigenic 챌린지에 의해 실험적 면역 Encephalomyelitis (EAE) 모성 마우스 변종에 응답하지 않는 문제를 극복

Experimental autoimmune encephalomyelitis (EAE) is an inflammatory disease of the central nervous system (CNS) and has been used as an animal model for ...

Myelin Oligodendrocyte Glycoprotein (MOG35-55) Induced Experimental Autoimmune Encephalomyelitis (EAE) in C57BL/6 Mice

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While the exact etiology of the disease is yet unclear, autoreactive T lymphocytes are thought to play a central role in its pathophysiology. MS therapy is only partially effective so far and research efforts continue to expand our knowledge on the pathophysiology of the disease and to develop novel treatment strategies. Experimental autoimmune encephalomyelitis (EAE) is the most common animal model for MS sharing many clinical and pathophysiological features. There is a broad diversity of EAE models which reflect different clinical, immunological and histological aspects of human MS. Actively-induced EAE in mice is the easiest inducible model with robust and replicable results. It is especially suited for investigating the effects of drugs or of particular genes by using transgenic mice challenged by autoimmune neuroinflammation. Therefore, mice are immunized with CNS homogenates or peptides of myelin proteins. Due to the low immunogenic potential of these peptides, strong adjuvants are used. EAE susceptibility and phenotype depends on the chosen antigen and rodent strain. C57BL/6 mice are the commonly used strain for transgenic mouse construction and respond among others to myelin oligodendrocyte glycoprotein (MOG). The immunogenic epitope MOG35-55 is suspended in complete Freund's adjuvant (CFA) prior to immunization and pertussis toxin is applied on the day of immunization and two days later. Mice develop a "classic" self-limited monophasic EAE with ascending flaccid paralysis within 9-14 days after immunization. Mice are evaluated daily using a clinical scoring system for 25-50 days. Special considerations for care taking of animals with EAE as well as potential applications and limitations of this model are discussed.

Myelin Oligodendrocyte Glycoprotein MOG35-55 Induced Experimental Autoimmune Encephalomyelitis EAE in C57BL/6 Mice

Experimental autoimmune encephalomyelitis (EAE) is an established animal model of multiple sclerosis. C57BL/6 mice are immunized with myelin oligodendrocyte glycoprotein (MOG) peptide 35-55 (MOG35-55), resulting in an ascending flaccid paralysis caused by autoreactive immune cells in the central nervous system. Protocols for disease induction and monitoring will be discussed.

수초 희소 돌기 아교 세포 당 단백질 (MOG<sub&gt; 35-55</sub&gt;) C57BL / 6 쥐에 실험자가 면역 뇌척수염 (EAE) 유도

Multiple sclerosis is a chronic neuroinflammatory demyelinating disorder of the central nervous system with a strong neurodegenerative component. While ...

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages and disadvantages. We describe here an experimental colitis model that is initiated by adoptive transfer of syngeneic splenic CD4+CD45RBhigh T cells into T and B cell deficient recipient mice. The CD4+CD45RBhigh T cell population that largely consists of na&#239;ve effector cells is capable of inducing chronic intestinal inflammation, closely resembling key aspects of human IBD. This method can be manipulated to study aspects of disease onset and progression. Additionally it can be used to study the function of innate, adaptive, and regulatory immune cell populations, and the role of environmental exposures, i.e., the microbiota, in intestinal inflammation. In this article we illustrate the methodology for inducing colitis with a step-by-step protocol. This includes a video demonstration of key technical aspects required to successfully develop this murine model of experimental colitis for research purposes.

Induction of Murine Intestinal Inflammation by Adoptive Transfer of Effector CD4+CD45RBhigh T Cells into Immunodeficient Mice

Here, we present a protocol to induce colonic inflammation in mice by adoptive transfer of syngeneic CD4+CD45RBhigh T cells into T and B cell deficient recipients. Clinical and histopathological features mimic human inflammatory bowel diseases. This method allows the study of the initiation of colonic inflammation and progression of disease.

이펙터 CD4의 입양 전송하여 쥐과 장내 염증의 유도<sup&gt; +</sup&gt; CD45RB<sup&gt; 높은</sup&gt; 면역 결핍 마우스에게 T 세포

There are many different animal models available for studying the pathogenesis of human inflammatory bowel diseases (IBD), each with its own advantages ...

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

병원성 메커니즘 연구를위한 BALB / c 마우스에서 약물 유도,자가 면역 간염의 유도

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Visualizing Impairment of the Endothelial and Glial Barriers of the Neurovascular Unit during Experimental Autoimmune Encephalomyelitis In Vivo

The neurovascular unit (NVU) is composed of microvascular endothelial cells forming the blood-brain barrier (BBB), an endothelial basement membrane with embedded pericytes, and the glia limitans composed by the parenchymal basement membrane and astrocytic end-feed embracing the abluminal aspect of central nervous system (CNS) microvessels. In addition to maintaining CNS homeostasis the NVU controls immune cell trafficking into the CNS. During immunosurveillance of the CNS low numbers of activated lymphocytes can cross the endothelial barrier without causing BBB dysfunction or clinical disease. In contrast, during neuroinflammation such as in multiple sclerosis or its animal model experimental autoimmune encephalomyelitis (EAE) a large number of immune cells can cross the BBB and subsequently the glia limitans eventually reaching the CNS parenchyma leading to clinical disease. 
Immune cell migration into the CNS parenchyma is thus a two-step process that involves a sequential migration across the endothelial and glial barrier of the NVU employing distinct molecular mechanisms. If following their passage across the endothelial barrier, T cells encounter their cognate antigen on perivascular antigen-presenting cells their local reactivation will initiate subsequent mechanisms leading to the focal activation of gelatinases, which will enable the T cells to cross the glial barrier and enter the CNS parenchyma. Thus, assessing both, BBB permeability and MMP activity in spatial correlation to immune cell accumulation in the CNS during EAE allows to specify loss of integrity of the endothelial and glial barriers of the NVU. 
We here show how to induce EAE in C57BL/6 mice by active immunization and how to subsequently analyze BBB permeability in vivo using a combination of exogenous fluorescent tracers. We further show, how to visualize and localize gelatinase activity in EAE brains by in situ zymogaphy coupled to immunofluorescent stainings of BBB basement membranes and CD45+ invading immune cells.

Here, we present protocols to investigate impairment of the neurovascular unit during experimental autoimmune encephalomyelitis in vivo. We specifically address how to determine blood-brain barrier permeability and gelatinase activity involved in leukocyte migration across the glia limitans.&#160;

Vivo에서 실험적인 자기 면역 뇌 중 Neurovascular 단위의 내 피와 폐해 장벽의 장애 시각화

The neurovascular unit (NVU) is composed of microvascular endothelial cells forming the blood-brain barrier (BBB), an endothelial basement membrane with ...

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase (G6PI)-Induced RA Mice

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T (iNKT) cells. Patients with active RA present fewer iNKT cells, defective cell function, and excessive polarization of Th1. In this study, an RA animal model was established using a mixture of hGPI325-339 and hGPI469-483 peptides. The iNKT cells were obtained by in vivo induction and in vitro purification, followed by infusion into RA mice for adoptive immunotherapy. The in vivo imaging system (IVIS) tracking revealed that iNKT cells were mainly distributed in the spleen and liver. On day 12 after cell therapy, the disease progression slowed down significantly, the clinical symptoms were alleviated, the abundance of iNKT cells in the thymus increased, the proportion of iNKT1 in the thymus decreased, and the levels of TNF-&#945;, IFN-&#947;, and IL-6 in the serum decreased. Adoptive immunotherapy of iNKT cells restored the balance of immune cells and corrected the excessive inflammation of the body.

Adoptive Immunotherapy of iNKT Cells in Glucose-6-Phosphate Isomerase G6PI-Induced RA Mice

This protocol uses G6PI mixed peptides to construct rheumatoid arthritis models that are closer to that of human rheumatoid arthritis in CD4+ T cells and cytokines. High purity invariant natural killer T cells (mainly iNKT2) with specific phenotypes and functions were obtained by in vivo induction and in vitro purification for adoptive immunotherapy.

포도당-6-인산염 이사머라제(G6PI)-유도 RA 마우스에서 iNKT 세포의 입양 면역 요법

Rheumatoid arthritis (RA) is a complex chronic inflammatory autoimmune disease. The pathogenesis of the disease is related to invariant natural killer T ...

Flow Cytometric Analysis of Lymphocyte Infiltration in Central Nervous System during Experimental Autoimmune Encephalomyelitis

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS) caused by the combination of environmental factors and susceptible genetic background. Experimental autoimmune encephalomyelitis (EAE) is a typical disease model of MS widely used for investigating the pathogenesis in which T lymphocytes specific for myelin antigens initiate an inflammatory reaction in CNS. It is very important to assess how lymphocytes in the CNS regulate the development of disease. However, the approach for measuring the quantity and quality of infiltrated lymphocytes in the CNS is very limited due to the difficulties in isolating and detecting infiltrated lymphocytes from the brain. This manuscript presents a protocol for that is useful for the isolation, identification, and characterization of infiltrated lymphocytes from the CNS and will be helpful for our understanding of how lymphocytes are involved in the development of the CNS autoimmune disease.

This manuscript presents a protocol to induce active experimental autoimmune encephalomyelitis (EAE) in mice. A method for the isolation and characterization of the infiltrated lymphocytes in the central nervous system (CNS) is also presented to show how lymphocytes are involved in the development of CNS autoimmune disease.

실험적인 자가면역 뇌척수염 중 중추신경계에서 림프구 침투의 흐름 세포 분석

Multiple sclerosis (MS) is an autoimmune disease of the central nervous system (CNS) caused by the combination of environmental factors and susceptible ...