우리는 UAS-EGFP :: MSP-300 KASH 플라스미드를 제공하는 제니스 피셔 감사합니다. mAB24B10 항체는 NICHD의 후원하에 개발 된 발달 연구 브리 도마 은행에서 얻은 아이오와 대학 생물학과에 의해 유지되었다. REPO-GAL4 재고 (BL7415)는 인디애나 대학 블루밍턴 증권 센터로부터 얻은 것입니다. 암 연구를위한 퍼듀 대학 센터 미국 암 학회 (American Cancer Society) 기관 연구비 (IRG # 58-006-53)의 지원은 기꺼이 인정합니다. Jingqun 엄마는 퍼듀 대학에서 식품 및 농업 퍼듀 조교의 농업 연구에 의해 지원됩니다.

1. EGFP의 생성 및 특성 :: KASH 초파리 <ol><li> 크로스 인 Gal4 드라이버는 MSP-300 KASH 날아 UAS-EGFP :: 운항하는 항공사. 대안 적으로, 인 Gal4 드라이버와 UAS-EGFP :: MSP-300 KASH 형질 전환 유전자를 모두 전송할 재조합 파리 표준 유전 기술을 이용하여 생성 될 수있다. 자손의 큰 숫자가 필요한 경우이 두 번째 방법은 유리하다. </li><li> 표준 현미경 기술을 사용하여 EGFP :: KASH 마커의 발현을 특징. 참고 : EGFP 발현 또는 전체 유충, 해부 고정 초파리 조직에서 표준 기술 현미경에 의해 관찰 될 수 있고, 항체의 사용을 필요로하지 않는다. <ol><li> EGFP의 발현 패턴을 결정 :: 형광 해부 현미경으로 전체 유기체의 KASH 마커 (재료의 PDF 참조). 참고 : 그림 1의 REPO-GAL4 드라이버, 전시 N 포함한 많은 인 Gal4 드라이버를예를 들면 침샘과 같은 다른 애벌레 조직에서 표현의 onspecific 패턴 (결과를 참조하십시오). </li><li> 공 초점 현미경을 사용하여 관심의 해부 조직에서 EGFP :: KASH 발현 패턴을 분석합니다. <ol><li> EGFP의 현지화 :: DNA에 KASH 태그 상대를 시각화하기 위해 0.1 μg / ML의 최종 농도에서 DAPI를 사용하여 최종 4 %의 농도 및 얼룩의 DNA에 포름 알데히드를 사용하여 그 조직을 고정합니다. </li><li> 그 조직의 크기에 따라 40 배 / 1.30 오일 침지 목적 또는 20X / 825 기름 침지 목표, 하나를 사용하여 이미지를 획득. 다음 여기 / 발광 조건은 화상 획득을 위해 이용 될 수있다 : 408 nm/425-475 NM (DAPI), 488 ㎚ / 525-550 NM (GFP). </li></ol></li></ol></li></ol> 2. 초파리 애벌레 조직에서 핵을 분리 <ol><li> 애벌레 조직의 절개 및 이후의 핵 분리를 위해 장비를 준비합니다. 그 주전체 dechorionated 배아는 또한 원하는 경우, 출발 물질로서 사용될 수있다. 그것은 관심의 세포 유형은 같은 가상적인 디스크와 같은 특정 조직에있는 경우가 아니라 전체 유충보다 부분적으로 해부 유충의 조직을 사용하는 것이 좋습니다. 이 비특이적 감소하고, 또한 비 표적 세포의 일부 인 Gal4 드라이버의 발현에 의해 발생 될 수있는 문제를 제거합니다. <ol><li> (자료 PDF 참조) 날카로운 집게의 두 쌍의 준비, 하나의 실리콘 처리 9 잘 유리판 (재료 PDF를 참조), PBT (1X PBS, pH를 7.4, 0.1 % 트윈 20). </li><li> 자석 구슬에 GFP 항체를 Prebind. 이 단계는 해부를 시작하기 전에 시작해야합니다. 세척 버퍼 400 μL에 (자료 PDF를 참조 로슈) 자석 구슬의 10 μL (인비 트 로젠은, 재료 PDF 참조) GFP 항체의 2 μg을 추가 (1X PBS, pH를 7.4, 2.5 mM의 MgCl2를) 1.5 ML 튜브에 . 필요한 경우 사용되는 비즈와 항체의 양은 샘에서 타겟의 양에 기초하여 최적화 될 수있다PLE 및 비드에 항체의 결합 친화도. </li><li> 상온에서 적어도 30 분 동안 회전 구슬과 항체를 품어. </li><li> 자기 랙에 구슬과 항체를 포함하는 1.5 ML 튜브를 (자료 PDF 참조) 놓고 구슬이 약 1 ~ 2 분 동안 자기에 바인딩 할 수 있습니다. 언 바운드 항체를 포함하는 상층 액을 제거하고 1 ㎖ 피펫을 사용하여 버퍼를 씻어. 비드를 자석에 인접한 측면에 1.5 ㎖의 튜브의 벽에 결합되어 유지된다. </li><li> 2.1.4 섹션에 설명 된대로마다 버퍼 세척 1 ㎖로 두 번 구슬을 씻어. 자기 랙에서 1.5 ML 튜브를 제거하고 구슬을 혼합하고 각 세척 단계에서 버퍼를 씻어 짧게 반전. </li><li> 단계 2.7 계속할 준비가 될 때까지 세척 버퍼 항체 결합 구슬을 저장합니다. 구슬은 프로토콜의 모든 단계에서 건조하도록 허용 할 수 없습니다. </li></ol></li><li> PBT의 유충의 조직을 해부하고 해부 조직을 전송9 잘 요리 잘 하나. 일반적으로, 100 번째 령 유충의 눈 엽과 눈, 상상 디스크의 해부는 핵 격리 다음 하류 유전자 발현 분석을위한 충분한 자료를 제공합니다. </li><li> 핵 추출 버퍼에 고립 된 조직을 씻어 (10 mM의 HEPES-KOH, pH를 7.5, 2.5 mM의 MgCl2를 2, 10 밀리미터의 KCl) 1.5 ML 튜브에. 신선한 핵 추출 버퍼의 1 ㎖가 들어 얼음에 (자료 PDF 참조) 1 ㎖ 다운스 균질에 고립 된 유충의 조직을 전송합니다. 5 분 동안 얼음에 품어. 이 RNA는 핵 다음 분리 추출 할 경우 프로테아제 억제제를 추가 할 필요가 없다. </li><li> 느슨한 유봉 20 스트로크에 의해 조직을 방해하고 세포가 팽창 할 수 있도록 10 분 동안 얼음에 샘플을 품어. 꽉 유봉과 함께 15 선을 사용하여 세포에서 핵을 추출합니다. 느슨한 꽉 방앗 공이와 스트로크의 수는 다른 조직과 세포 유형에 최적화 될 필요가; 초과 균질화가 발생할 수 있습니다부족 균질화가 조직에서 모든 핵을 추출하는 것은 아니지만 핵 전단. </li><li> 핵 균질화 버퍼 prerinsed 된 40 μm의 기공 크기의 여과기 (재료 PDF 참조)을 통해, 핵 및 세포 파편을 포함하는 균질를 필터링합니다. 신선한 튜브에 여과 균질를 수집합니다. </li><li> 핵 수율, 핵의 무결성을 확인하고, 격리 핵 이전에 표적 유전자의 전사 수준을 결정하기 위해 후속 분석을 위해 사전에 격리 샘플을 수집합니다. <ol><li> 피펫을 사용하여 새로운 1.5 ML 튜브로 전송 필터링 된 균질의 50 μL. 이것은 사전에 격리 샘플입니다. 트리 졸 시약 500 μl를 추가 이후의 RNA 분리 (3.1 단계) -20 ° C에서, 혼합하는 반전 및 저장 (재료 PDF,주의 참조). </li><li> 새로운 1.5 ML 튜브로 전송 필터링 균질 20 ㎕. <ol><li> 0.1 μg / ML의 최종 농도에 DAPI를 추가하고, INC10 분 동안 얼음에 ubate 샘플. </li><li> 폴리 라이신 코팅 커버 슬립에 DAPI 염색 핵을 전송하고, 현미경 슬라이드에 배치합니다. 명확한 매니큐어를 사용하여 커버 슬립을 봉인. </li><li> 핵 무결성 및 형광 현미경을 사용하여 그 GFP - 태그 핵의 존재를 확인합니다. 참고 : 핵 문제를 해결하기 위해, 또는이 슬라이드는 (24 시간 이내) 준비 다음 합리적으로 신속하게 분석하는 경우 GFP에 얼룩 할 필요가 없습니다. </li></ol></li><li> 새로운 1.5 ML 튜브로 전송 필터링 된 균질의 10 μL 및 세척 버퍼 90 μL (1X PBS, pH를 7.4, 2.5 mM의 MgCl2를)를 추가합니다. 0.1 μg / ML의 최종 농도에 DAPI를 추가하고 10 분 동안 얼음에 품어. 10X 공기 목적에 따라 표면 형광을 사용하여 DAPI 양성 핵을 계산하는 혈구를 사용하여 사전에 격리 샘플의 핵 수익률을 결정합니다. </li></ol></li><li> 자기 랙에 (2.1.6 절에서 제조) 항체 바인딩 비드를 포함하는 1.5 ML 튜브를 놓고,및 2.1.4 장에 설명 된대로 자기 구슬이 적어도 2 분 동안 자석에 바인딩 할 수 있습니다. 1 ㎖ 피펫을 사용하여 항체 결합 구슬에서 세척 버퍼를 제거하고, 1 ㎖ 피펫을 사용하여 1.5 ML 튜브에 2.5 단계에서 필터링 된 균질를 추가합니다. </li><li> 부드럽게 섞어 튜브를 여러 번 반전, 최종 통해 엔드 교반과 함께 30 분 동안 4 ° C에서 알을 품다. 가능하면 이러한 핵의 응집을 초래할 수 있기 때문에 튜브에 거품을 피하십시오. </li><li> 자기 랙에 항체 결합 구슬과 균질를 포함하는 1.5 ML 튜브를 배치하고 2.1.4 섹션에 설명 된대로 자기 구슬이 적어도 2 분 동안 자석에 바인딩 할 수 있습니다. 1 ㎖ 피펫을 사용하여 언 바운드 핵 분획을 포함하는 균질를 제거합니다. </li><li> 세척의 배 1 ㎖를 할 때마다 버퍼 샘플을 씻으십시오. 설명 된대로 구슬, 바인딩 핵을 포함하는 1.5 ML 튜브를 제거하고 랙에서 버퍼를 씻어 여러 번 섞어 반전 후 자기 랙에 튜브를 배치단계 2.9 및 1 ㎖ 피펫을 사용하여 상층 액을 제거합니다. </li><li> 대상 핵에 결합해야한다 구슬로 세척 버퍼 150 μl를 추가합니다. 이 후 격리 샘플입니다. 현미경 분석과 이후의 RNA 추출을 위해 샘플을 준비합니다. <ol><li> 새로운 1.5 ML 튜브와 DAPI와 얼룩으로 환승 후 격리 샘플 20 ㎕ 및 2.6.2 절에 설명 된대로 분석 할 수 있습니다. GFP + / DAPI +와 GFP-/DAPI + 후 격리 샘플의 농축 GFP + 핵의 순도를 결정하는 자석 구슬에 의하여 촬영 된 핵을 계산합니다. </li><li> , 후 격리 샘플의 나머지 부분에 트리 졸 시약 1 ㎖를 추가 혼합하는 반전 및 저장 이후의 RNA 분리 (3.1 단계) -20 ° C에서. 참고 : 트리 졸의 샘플은 필요한 경우 -20 ℃에서 몇 주 동안 저장 될 수있다 그것은, 트리 졸 시약을 사용하여 이전의 RNA 추출에 자석 구슬에서 핵을 용출 할 필요가 없습니다 becaus전자 구슬은 이후의 RNA 분리에 방해가되지 않습니다. </li></ol></li></ol> 3. 애벌레 조직에서 고립 된 핵의 성적 수준을 결정 <ol><li> 다음과 같은 수정과 (재료 PDF 참조) 트리 졸 기반의 RNA 추출을위한 기술 표준 프로토콜을 사용하여 섹션 2.6.1과 2.11.2에서 제조 된 사전 차단 및 사후 격리 샘플에서 RNA를 분리 : <ol><li> RNA 펠렛의 침전 후, 펠릿에 RNase가없는 물 19.2 μL 및 RNASecure 시약의 0.8 μL (재료 PDF 참조) 추가 RNAses을 비활성화하는 20 분 동안 60 ° C에서 알을 품다. </li></ol></li><li> 제조 업체의 프로토콜을 다음 QubitR 2.0 형광을 사용하여 이러한 큐 비트 RNA 분석 키트와 같은 형광 RNA 결합 염료 (재료 PDF 참조) RNA의 농도를 결정합니다. </li><li> 그러한 EpiScr로 증폭 역전사 효소를 이용하여 cDNA를 합성IPT는 제조업체의 지침에 따라 효소 키트 및 oligodT 프라이머 역. 참고 : 일반적으로 RNA의 50 ~ 100 NG가 여러 유전자 발현 분석을 수행 할 수있는 cDNA를 생성합니다. 사전 분리 및 포스트 분리 RNA의 당량은 cDNA를 생성하는데 사용되어야한다. </li><li> 이 10 배 전에 실시간으로 정량 PCR (qPCR에) 분석을 희석하기 위해 20 μL의 cDNA를 샘플로의 nuclease없는 물 180 μl를 추가합니다. 희석 된 cDNA 샘플 qPCR에 억제 할 수 있기 때문에 희석는 중요한 단계이다. </li><li> 중합 효소와의 dNTPs, 4 pmole의 앞으로의 각각의 qPCR 마스터 믹스를 준비하고 역방향 프라이머, 20 μL의 최종 반응 부피에 멸균 물과 함께했다. <ol><li> 관심의 세포 유형에서 발현 될 것으로 예상되는 유전자들을 대상으로 한 조직이 수집되는 발달 단계에서의 qPCR하도록 프라이머를 설계한다. 인트론에 걸쳐하는 디자인 프라이머 가능하면되도록 게놈과cDNA를 PCR 제품은 구별 될 수있다. 주 : 표적 세포 분류 유전자 발현 프로파일이 알려지지 않은 경우, 태그 핵 인구에서 구체적으로 표현되어야 EGFP 대하여 프라이머는 특정 세포 유형과 조직 (표 1)에 대한 프로토콜을 최적화 할 수있다. </li></ol></li><li> 전체 조직에서 준비하는 cDNA의 희석 시리즈에 비교하여 사전 차단 및 사후 격리 샘플에 대한 관심의 각 유전자의 상대적 성적 수준을 결정합니다. 표적 유전자의 전사 수준은 Rpl32 (또는 바람직하게는 몇 개의 표준 발현 유전자)와 같은 참고 유전자로 정규화한다. </li></ol>

<ol>
	<li>Weake, V. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcription+initiation+function+of+the+ubiquitous+SAGA+complex+in+tissue-specific+gene+activation.">Post-transcription initiation function of the ubiquitous SAGA complex in tissue-specific gene activation.</a> Genes Dev. 25, 1499-1509 (2011).</li><li>Bonn, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+chromatin+immunoprecipitation+from+multicellular+complex+samples+using+BiTS-ChIP.">Cell type-specific chromatin immunoprecipitation from multicellular complex samples using BiTS-ChIP.</a> Nat. Protoc. 7, 978-994 (2012).</li><li>Haenni, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+C.+elegans+intestinal+gene+expression+and+polyadenylation+by+fluorescence-activated+nuclei+sorting+and+3'-end-seq.">Analysis of C. elegans intestinal gene expression and polyadenylation by fluorescence-activated nuclei sorting and 3'-end-seq.</a> Nucleic Acids Res. 40, 6304-6318 (2012).</li><li>Barthelson, R. A., Lambert, G. M., Vanier, C., Lynch, R. M., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+the+contributions+of+the+nuclear+and+cytoplasmic+compartments+to+global+gene+expression+in+human+cells.">Comparison of the contributions of the nuclear and cytoplasmic compartments to global gene expression in human cells.</a> BMC Genom. 8, 340 (2007).</li><li>Zhang, C., Barthelson, R. A., Lambert, G. M., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+characterization+of+cell-specific+gene+expression+through+fluorescence-activated+sorting+of+nuclei.">Global characterization of cell-specific gene expression through fluorescence-activated sorting of nuclei.</a> Plant Physiol. 147, 30-40 (2008).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+INTACT+method+for+cell+type-specific+gene+expression+and+chromatin+profiling+in+Arabidopsis+thaliana.">The INTACT method for cell type-specific gene expression and chromatin profiling in Arabidopsis thaliana.</a> Nat. Protoc. 6, 56-68 (2011).</li><li>Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+method+for+gene+expression+and+chromatin+profiling+of+individual+cell+types+within+a+tissue.">A simple method for gene expression and chromatin profiling of individual cell types within a tissue.</a> Dev Cell. 18, 1030-1040 (2010).</li><li>Steiner, F. A., Talbert, P. B., Kasinathan, S., Deal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-type-specific+nuclei+purification+from+whole+animals+for+genome-wide+expression+and+chromatin+profiling.">Cell-type-specific nuclei purification from whole animals for genome-wide expression and chromatin profiling.</a> Genom. Res. 22, 766-777 (2012).</li><li>Brand, A. H., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+gene+expression+as+a+means+of+altering+cell+fates+and+generating+dominant+phenotypes.">Targeted gene expression as a means of altering cell fates and generating dominant phenotypes.</a> Development. 118, 401-415 (1993).</li><li>Henry, G. L., Davis, F. P., Picard, S., Eddy, S. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+type-specific+genomics+of+Drosophila+neurons.">Cell type-specific genomics of Drosophila neurons.</a> Nucleic Acids res. 40, 9691-9704 (2012).</li><li>Starr, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KASH+and+SUN+proteins.">KASH and SUN proteins.</a> Curr Biol. 21, 414-415 (2011).</li><li>Fischer, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+klarsicht+has+distinct+subcellular+localization+domains+for+nuclear+envelope+and+microtubule+localization+in+the+eye.">Drosophila klarsicht has distinct subcellular localization domains for nuclear envelope and microtubule localization in the eye.</a> Genetics. 168, 1385-1393 (2004).</li><li>Patterson, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+functions+of+Klarsicht+and+nuclear+lamin+in+developmentally+regulated+nuclear+migrations+of+photoreceptor+cells+in+the+Drosophila+eye.">The functions of Klarsicht and nuclear lamin in developmentally regulated nuclear migrations of photoreceptor cells in the Drosophila eye.</a> Mol. Biol. Cell. 15, 600-610 (2004).</li><li>Yu, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+KASH+domain+protein+MSP-300+plays+an+essential+role+in+nuclear+anchoring+during+Drosophila+oogenesis.">The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis.</a> Dev. Biol. 289, 336-345 (2006).</li><li>Bischof, J., Maeda, R. K., Hediger, M., Karch, F., Basler, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+optimized+transgenesis+system+for+Drosophila+using+germ-line-specific+phiC31+integrases.">An optimized transgenesis system for Drosophila using germ-line-specific phiC31 integrases.</a> Proc. Natl. Acad. Sci. U.S.A. 104, 3312-3317 (2007).</li><li>Kracklauer, M. P., Banks, S. M., Xie, X., Wu, Y., Fischer, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+klaroid+encodes+a+SUN+domain+protein+required+for+Klarsicht+localization+to+the+nuclear+envelope+and+nuclear+migration+in+the+eye.">Drosophila klaroid encodes a SUN domain protein required for Klarsicht localization to the nuclear envelope and nuclear migration in the eye.</a> Fly. 1, 75-85 (2007).</li><li>Markstein, M., Pitsouli, C., Villalta, C., Celniker, S. E., Perrimon, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploiting+position+effects+and+the+gypsy+retrovirus+insulator+to+engineer+precisely+expressed+transgenes.">Exploiting position effects and the gypsy retrovirus insulator to engineer precisely expressed transgenes.</a> Nat. Genet. 40, 476-483 (2008).</li><li>Sepp, K. J., Schulte, J., Auld, V. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Peripheral+glia+direct+axon+guidance+across+the+CNS/PNS+transition+zone.">Peripheral glia direct axon guidance across the CNS/PNS transition zone.</a> Dev. Biol. 238, 47-63 (2001).</li><li>Fujita, S. C., Zipursky, S. L., Benzer, S., Ferrus, A., Shotwell, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+against+the+Drosophila+nervous+system.">Monoclonal antibodies against the Drosophila nervous system.</a> Proc. Natl. Acad. Sci. U.S.A. 79, 7929-7933 (1982).</li></ol>

저자가 공개하는 게 없다.

이 프로토콜은 Drosophila의 배아 또는 애벌레 조직에서 혼합 된 세포 집단에서 특히 태그 핵을 분리 또는 매우 풍부하게하는 데 사용할 수 있습니다. 이 프로토콜을 사용하여, 핵은 약 1 시간에 해부 조직으로부터 단리 할 수​​있다. 고립 된 핵의 순도와 수율은 실험적으로 각 세포 유형에 대해 결정해야합니다. 이 때문에 시료 내에 존재 구슬 혈구를 사용하여 프로토콜의 후 분리 단계에서 비드 바인딩 핵을 정량화하기 어렵다. 핵의 정확한 숫자는 다운 스트림 응용 프로그램에 필요한 경우 따라서, 이러한 DNA 함량 등의 다른 방법에 따라 핵 수익률을 추정 할 필요가있을 것입니다. RNA가 성공적으로 분리되고 정량화 될 수 있다면 핵 수율의 정확한 계산은 유전자 발현 분석을 위해 필요하지 않다. 우리가 발견 한 것처럼 그것은, RNA 수율을 정량화 형광 기반의 방법을 사용하는 것을 권장합니다 RNA 농도의 분광 결정이러한 낮은 농도의 샘플에서 매우 변수입니다. 자석 구슬과 항체의 선택 : 성공에 영향을 미칠 것이다 프로토콜의 두 가지 중요한 측면이 있습니다. GFP 또는 단백질 G에 연결되어 자석 구슬은 여러 가지 서로 다른 소스에서 상업적으로 이용 가능하다. 그러나, 강하게 두 가지 이유로이 프로토콜에 설명 된 절차에 인비 트 로젠에서 사용할 수있는 단백질 G 자석 구슬을 사용하는 것이 좋습니다. 첫째, 2.8 μM의 인비 구슬의 크기는 약 5 μM (도 2D) 우리가 조사한 세포 유형의 핵의 평균 크기보다 약간 작다. 작은 자석 구슬 (예를 들면 50 나노, μMACS α-GFP,있는 Miltenyi 생명 공학) 일괄 세척 스타일의 자석에 신속하게 결합하지 않고,이 구슬에 제공되는 열이 애벌레 조직 추출물 방해 할 수 있습니다. 큰 자석 구슬 (예를 들면 10 ㎛, PureProteome 단백질 G 자성 BEADS, 밀리 포어는) 우리의 예비 시험에서 핵에 잘 결합하지 않았고,이 또한 어려운 표준 현미경 기술에 의해 비드 바인딩 샘플에서 핵을 식별하고, DAPI 및 GFP 모두 같은 채널에서 강한 형광도를 나타낸다. 자성 비드의 선택 이외에, 그것은 면역 잘 작동하지만 높은 비특이적 백그라운드가없는 GFP 항체를 사용하는 것이 중요하다. 이 프로토콜의 재현성을 돕기 위해, 우리는 GFP에 대해 단일 ​​클론 마우스 항체를 사용했습니다. GFP에 대한 클론 토끼 항체는 성공적으로 우리의 예비 연구에서 상용화에 박차를 가하고 있었다, 그러나 이들은 더 높은 특이 현상이 배경이있었습니다. 다른 단일 클론 항체는 성공의 다양한 수준 (예 : 발달 연구 브리 도마 은행) 테스트되었습니다. 따라서, 항체 선택은 표지 된 핵의 성공적인 분리에 중요한 요소이다. 이 프로토콜에서 우리는 DET하는 방법을 설명하지만고립 핵에서 순백 유전자 전 사체 수준, 그것은 단계 2.1-2.11에 기재된 방법은 또한 후속 염색질 면역 침전 분석에 사용할 수있는 핵을 단리에 적합 할 것으로 예상된다. 조직이 이전의 균질화 (2.3 단계)에 1 %의 포름 알데히드에 고정되어있는 경우, 다음 해부 조직은 여러 가지 일 크로 마틴 면역 분석을 수행 할 충분한 절연 물질을 통해 수집 할 수 있습니다. 전술 한 바와 같이 만 거친 추정치를 제공하는 혈구를 사용하여 얻을 수,을 바탕으로, 우리는 일반적으로 X 10 4 1.3을 얻어 눈, 상상 디스크 100 유충 (표 2)의 광학 로브에서 2.7 × 10 4 아교 세포의 핵. 따라서, 우리의 방법을 사용하여, 상기 타겟 셀 분류 풍부에 따라 염색질 면역 침전 분석을 수행하기에 충분한 재료를 구하는 것이 실현 가능하고, 또한 에피토프한다. 이 TECHNI의 한 유용 유전자 응용 프로그램생각도는 적극적으로 열성 치사 돌연변이 대립 유전자 동형이다 배아 또는 유충의 특정 세포 유형의 핵에 라벨을 사용할 수 있다는 것입니다. 이 작업을 수행하기 위해 두 개의 플라이 주식은 관심의 돌연변이 대립 유전자가 특정 인 Gal4 드라이버와 재결합하는, 또는 세 번째 염색체에 UAS-EGFP :: MSP-300 KASH의 유전자로 생성해야합니다. 돌연변이 대립 유전자 인 Gal4 드라이버를 들고 파리가 돌연변이 대립 유전자의 두 사본이 돌연변이 대립 유전자와 UAS-EGFP :: MSP-300 KASH의 유전자 만 자손을 들고 파리로 교차하는 경우 조직에서 GFP로 표지 할 수있는 인 Gal4 드라이버가 표시됩니다. 따라서, 열성 치명적인 대립 유전자의 세포 고유의 효과는 이전에 치사의 단계로, 배아 또는 유충 단계에서 검사 할 수 있습니다. 이 유전자 기술 이전에 적극적으로, SAGA 서브 유닛에 sgf11 1 돌연변이 동형 접합했다 배아 근육 세포를 레이블로 사용 된 &lt;/ SUP&gt;.

이러한 중추 신경계로서 초파리 조직 세포 유형의 복합 혼합물을 포함한다. 따라서, 초파리 조직으로부터 세포 특정 유전자 발현 프로파일을 분석하는데, 이는 다운 스트림 애플리케이션을 활성화하기에 충분한 양으로 특정한 세포 균질 집단을 분리하는 제 필요하다. 손상 조직에서 세포를 분리하는 방법은 레이저 미세 절제하고, 전체 세포 (FACS)를 정렬 형광 활성화 된 셀 (가) 있습니다. FACS는 1-3 프로파일 유전자 발현과 크로 마틴에 초파리의 배아에서와 예쁜 꼬마 선충의 세포와 핵을 분리하는 데 사용되었지만, FACS 및 레이저 미세 절제는 매우 혼합 세포 유형 또는 해당 포함 세포를 포함하는 조직에서 성공적으로 수행하기가 어려울 수 있습니다 뉴런과 같은 불규칙한 형태. 이러한 어려움을 극복하기 위해, 오히려 세포보다 핵은 특정 세포 유형에서 분리 및 후속 세대를 위해 사용될 수있다전자 발현 프로파일 링. 중요한 것은, 핵 RNA 샘플을 사용하여 마이크로 어레이 기반의 mRNA 발현 분석은 그 전체 RNA 4, 5를 이용하여 수행 일반적으로 대등 한 결과를 나타낸다. 더욱이, 핵 RNA를 이용한 유전자 발현 분석은 성공적 C. 등 여러 유기체에서 유전자 발현을 연구하기 위해 사용되었다 엘레, 애기 장대, 초파리, 인간 4, 5, 2, 3. 여러 가지 방법이 최근 유전자 발현 분석 및 / 또는 염색질 면역 침전에 적합한 초파리 조직으로부터 레이블 핵의 특정 집단의 분리를 위해 설명되었다. 면역 (비트 칩) 방법에 대한 조직 특정 염색질의 배치 격리 핵 지역화 GFP 2의 세포 유형 특정 표현에 기초하여 고정 핵을 분리하기 위해 FACS를 사용합니다. 이 접근법은 SU왔다ccessfully 초파리 배아 2 중배엽으로부터 고립 핵 염색질 면역 침전을 사용하여 히스톤 변형 및 전사 인자의 분포를 분석하기 위해 사용했다. 그러나, FACS 기반의 접근 방식으로 인해 다운 스트림 애플리케이션에 적합한 번호를 얻기 위해 필요한 증가 정렬 시간에 혼합 인구의 작은 비율을 구성하는 표시 핵을 분리 덜 적합 할 수있다. 이러한 한계를 극복하기 위해 여러 그룹은 특정 세포 유형의 특정 항원에 표시되어 핵을 정화하는 선호도 기반 격리 기술을 활용했다. 애기 장대 (6, 7)에 사용하기 위해 개발 된 특정 세포 유형 (를 본래) 방법에 태그 핵의 분리는 최근 초파리 8에 사용하기 위해 적응하고있다. 이 방법에서는, 생체에 대한 바이오 티 닐화 기질 인 핵 엔벨로프 융합 단백질이다 coexpres특정 세포 유형에서 대장균 비오틴 리가 피라와 SED. 비오틴 - 표지 된 핵이어서 스트렙 타비 딘 - 기반 선호도 분리를 이용하여 혼합 집단으로부터 정제 될 수있다. 이 방법을 사용하여, 핵이 성공적 핵막 융합 단백질 중배엽 특정 인핸서 8의 제어하에 발현되는 초파리 배아 중배엽으로부터 표지와 분리 하였다. 저자는 또한 인 Gal4 조절 서열, UAS (9)의 제어하에 임의의 세포 유형에서 발현 될 수 핵막 융합 단백질을 생성. 이 방법은 빠른 속도로 혼합 인구에서 레이블 핵의 하위 집합을 분리 할 수​​ 있지만, 별도의 세 가지 유전자 구조를 필요로하며, 따라서 특정 유전자 응용 프로그램에 적합하지 않은 경우가 있습니다. 최근 접근법은 SUN (S AD1 및 UN C-84) 핵막의 내막에 집중 도메인 - 함유 단백질이 태그로 된 설명되었다형광 단백질과 Gal4/UAS 시스템 (10)의 제어하에 표현. 핵은 핵막의 외막을 제거하는 비이 온성 세제의 존재 하에서 단리하고, 항-GFP 항체에 결합 된 자성 비드를 이용하여 친 화성 정제 하였다. 이 접근법은 성공적 초파리 (10)의 성인의 뇌 신경 세포 내의 특정 아형에서 표지 된 핵의 작은 집단을 분리하기 위해 사용되었다. 여기에, 초파리 유충의 조직에서 세포의 혼합 인구에서 레이블 핵의 분리를위한 프로토콜을 설명한다. 이 방법은 독립적으로 개발하지만, 헨리 등. 10 첫째로 기술 된 방법과 유사하고, 핵은 혼합 인구에서 태그 핵의 후속 분리를 용이하게하기 위해 만 초파리 melanogaster의 특정 세포 유형에 표현되는 형광 물질로 표지 된 선호도 기반의 접근 방식을 사용하여. 핵 레이블을하려면,KASH (K의 larsicht / NC-1 / S의 yne H는 omology) 도메인을 활용 하였다. KASH 도메인은 핵 주변 공간 (11) 내에서 SUN 도메인 함유 단백질과의 상호 작용을 통해 부분에있는 핵 봉투의 외부 막에 지역화 횡단 도메인입니다. 자신의 N-말단 도메인과 같은 세포질 12-14에서 액틴 세포 골격 또는 미세 소관과 같은 단백질과 상호 작용하는 동안 같은 초파리 MSP-300 및 Klarsicht 같은 단백질의 C-말단 도메인은 KASH, 아우터 핵막으로 이들 단백질을 고정. 구문이있는 초파리 MSP-300의 KASH 도메인이 pUAST-attB 벡터 15, 16 인 Gal4 조절 서열, UAS의 제어하에, EGFP의 C-말단에 융합 된 생성 된. phiC31 사이트 별 통합을 사용하여 형질 전환 초파리는 생성 된 UAS-EGFP :: MSP-300 KASH의 유전자가 염색체에 attP2 궤적에 삽입 된에3L 17. UAS-EGFP :: MSP-300 KASH는 파리 관심의 세포 유형의 외부 핵 막에 EGFP의 대상 표현의 결과로, 특정 세포 유형의 인 Gal4 드라이버를 표현 파리 교차 할 수있다. 표지 된 핵은 자성 비드에 결합 GFP에 대한 항체를 사용하여 혼합 된 세포 집단으로부터 정제 될 수있다. 이 방법에서는, 비이 온성 세제의 사용은 EGFP 태그가 외측 핵막의 세포질 측에 지역화 때문에 필요하며, 따라서 항체가 액세스되지 않는다. 후술 프로토콜은 순도와 절연 핵의 수율 정량화, 초파리 애벌레 조직의 특정 세포 유형에서 EGFP-표지 핵 농축 / 분리, 및 (정량적 역전사 중합 효소 연쇄 반응에 적합한 핵 RNA를 추출하기 위해 사용될 수있다 QRT -PCR) 유전자 발현 분석. 핵의 분리 및 친 화성 정제 (Tissu은 제외E 해부)는 한 시간 이내에 수행 될 수있다. 결과는 신경교 핵 성공적 유생 광섬유 엽과 눈 가상적인 디스크로부터 단리하고, 이후의 유전자 발현 분석을 위해 사용될 수 있음을 나타내는 표시된다. 이것은이 방법은 대상 세포가 전체 인구의 5 % 미만을 구성하는 배아와 유충 조직으로부터 레이블 핵의 분리 / 농축하는 데 유용 할 것으로 예상된다. 이 연구에서 생성 된 모든 초파리 주식과 플라스미드는 요청시 저자에서 사용할 수 있습니다.

<table border="0" cellpadding="0" cellspacing="0" width="1884">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">Anti-chaoptin antibody (mouse, monoclonal)</td>
			<td style="width:263px;">Developmental Studies Hybridoma Bank</td>
			<td style="width:195px;">mAB24B10</td>
			<td style="width:828px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-GFP antibody (mouse, monoclonal)</td>
			<td>Roche</td>
			<td>11814460001</td>
			<td>This specific antibody is recommended for this protocol. However, alternative antibodies could also be used.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">2X Bullseye EvaGreen qPCR Mastermix with ROX</td>
			<td>MidSci</td>
			<td>BEQPCR-R</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">DAPI (4&#39;,6-diamidino-2-phenylindole, dihydrochloride salt)</td>
			<td>Biotium</td>
			<td>40011</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dounce Homogenizer (1 ml)</td>
			<td>VWR</td>
			<td>62400-595</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dumont #5 Tweezers, 11 cm</td>
			<td>World Precision Instruments</td>
			<td>14095</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dynabeads Protein G for Immunoprecipitation</td>
			<td>Invitrogen</td>
			<td>10003D</td>
			<td>This specific brand of magnetic beads is recommended for this protocol.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">EpiScript Reverse Transcriptase</td>
			<td>Epicentre</td>
			<td>ERT12910K</td>
			<td><a href="http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf">http://www.epibio.com/docs/default-source/protocols/episcript-reverse-transcriptase.pdf</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Falcon cell strainers, 40 &#956;m pore size</td>
			<td>VWR</td>
			<td>21008-949</td>
			<td>Alternative pore sizes could be used, depending on the size of the target cell nuclei.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Magnetic stand (8 x 1.5 ml tubes)</td>
			<td>Millipore</td>
			<td>LSKMAGS08&#160;</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">Mini tube rotator</td>
			<td style="width:263px;">Genemate</td>
			<td style="width:195px;">H-6700</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:599px;">Qubit starter kit</td>
			<td style="width:263px;">Life Technologies</td>
			<td style="width:195px;">Q32871</td>
			<td style="width:828px;">Similar fluorescence-based methods for quantifying RNA yield could be used. <a href="http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdf">http://tools.invitrogen.com/content/sfs/manuals/mp32852.pdfZ</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">RNAsecure (Ambion)</td>
			<td style="width:263px;">Life Technologies</td>
			<td style="width:195px;">AM7010</td>
			<td style="width:828px;">The use of this reagent to inactivate RNAses is optional.</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">RT-PCR machine Thermal Cycler</td>
			<td style="width:263px;">BioRad</td>
			<td style="width:195px;">CFX Connect Thermal Cycler</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Siliconized 9 well glass plate</td>
			<td>Hampton Research</td>
			<td>HR3-134</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">Stereomicroscope Fluorescence Adapter (Royal Blue (440 - 460nm) excitation + yellow barrier</td>
			<td style="width:263px;">Nightsea</td>
			<td style="width:195px;"></td>
			<td>This adaptor enables GFP fluorescence to be examined using a typical dissecting microscope (eg Nikon)</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">StereoZoom Microscope 83604 Set with 10X Wide Field Eyepieces and Universal Boom Stand</td>
			<td style="width:263px;">Nikon</td>
			<td style="width:195px;">SMZ 745</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:599px;">Thermal Cycler</td>
			<td style="width:263px;">BioRad</td>
			<td style="width:195px;">T100</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Trizol reagent</td>
			<td style="width:263px;">Life Technologies</td>
			<td>15596018</td>
			<td>CAUTION; Alternative RNA extraction methods can be used. <a href="http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf" >http://tools.invitrogen.com/content/sfs/manuals/trizol_reagent.pdf</a></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tween 20</td>
			<td>Amresco</td>
			<td>0777-1L</td>
			<td></td>
		</tr>
	</tbody>
</table>

affinity-based isolation of tagged nuclei from drosophila tissues for gene expression analysis

초파리의 melanogaster 배아와 유충 조직은 종종 이들 조직에서의 유전자 발현 분석을 복잡하게 세포 유형의 고도로 이종 혼합물을 함유한다. 따라서, 초파리 조직으로부터 세포 특정 유전자 발현 프로파일을 분석하는, 높은 순도와 같은 전사 프로파일 링 및 염색질 면역 하류 어플리케이션에 충분한 수율에서 특정 세포 유형을 분리 할 필요가있다. 그러나 이러한 조직의 특정 세포 유형의 희귀 인구와 결합 등의 중추 신경계와 같은 조직의 불규칙한 세포의 형태는, 정렬, 레이저 미세 절제와 형광 활성화 된 세포로 세포 분리의 전통적인 방법에 대해 (FACS)에 도전을 제기 할 수 있습니다 . 여기서, 태그 핵의 궁합 기반 격리보다는 전체 세포를 사용하여 셀 고유의 유전자 발현 프로파일을 특징 화하는 대안 적 접근법이 설명된다. 특정 C의 핵관심 엘 유형은 유전 Gal4/UAS 진 발현 시스템을 이용하여 핵 봉투 지역화 EGFP 태그로 표시되어 있습니다. 이 EGFP-태그 된 핵은 자성 비드에 결합된다 GFP에 대한 항체를 사용하여 단리 할 수​​있다. 이 프로토콜에서 설명하는 방법은 이러한 세포 유형에서 전체 세포 집단의 2 % 미만을 포함하는 경우에도, 고순도 초파리 유충의 중추 신경계와 발현 분석을위한 충분한 수준에서 특정 세포 유형의 핵의 일관된 분리를 가능하게 조직. 이 접근법은 초파리 배아 특정 인 Gal4 드라이버를 사용 유생 세포 유형의 다양한 핵을 분리하기 위해 사용될 수 있으며, FACS 또는 레이저 미세 절제를 위해 적당하지 않은 종류의 세포에서 핵을 분리하는 데 유용 할 수있다.

REPO-GAL4 드라이버 (블루밍턴 재고 번호 7415)가 특별히 개발 (18)의 여러 단계에서 초파리 신경계에있는 신경 교세포로 표현된다. 파리 안정적으로 표준 유전자 기술을 사용하여 REPO-GAL4 드라이버의 제어하에 UAS-EGFP :: MSP-300 KASH 표현이 생성되었다. EGFP의 발현 패턴 :: KASH의 형질 전환이 파리에서의 특성을, 제 령 유충의 해부 눈 엽과 눈, 상상 디스크에서 GFP 발현의 패턴은 공 초점 현미경을 사용하여 조사 하였다. 해부 조직은 광 수용체의 축색 돌기 (mAb24B10 레이블을 DNA와 α-chaoptin (19)를 표시하는 DAPI와 대조했다 ) 자료 PDF를 참조하십시오. 그림 1A는 REPO-GAL4 기반 EGFP가 :: KASH의 유전자가 예상되는 표현 패턴의 광 엽 (叶)과 눈, 상상 디스크에 아교로 표현을 보여줍니다. 높은 배율에서,EGFP 발현 EGFP의 핵 봉투 지방화와 일치 DAPI 양성 DNA, :: KASH 태그 (그림 1B)를 둘러싸는 원형 패턴으로 관찰된다. EGFP 발현은 GFP에 대한 항체를 사용하여 신호 증폭을위한 필요없이 고정 및 비 고정 조직에서 모두 검출 할 수있다; GFP에 대한 항체는도 1 및도 2에 도시 된 이미지에서 EGFP :: KASH 식을 시각화하는데 사용되지 않았다. EGFP :: KASH의 유전자가 초파리 유충의 다른 조직에 비특이적으로 표현되어 있는지 확인하려면, GFP의 발현은 해부 현미경 형광을 사용하여 전체 제 령 유충에서 조사 하였다. 특히, EGFP의 특이 발현 :: KASH의 유전자는 제 령 유충의 침샘에 높은 수준에서 관찰되었다. 이 REPO-GAL4 드라이버 개발의 애벌레 단계에서 아교가 아닌 다른 세포 유형의 활동이 있음을 나타냅니다. 따라서, 구체적 GLI를 격리알 핵은 제 령 유충의 눈 엽과 눈, 상상 디스크 전에 균질화 및 친 화성 분리에 절개를 이용하여 분리 하였다. 이 프로토콜은 초파리의 조직에서 핵의 추출에 적합한 지 확인하고, 눈 엽 눈에서 얻은 균질에서 주어진 조직, 사전 분리 샘플 (섹션 2.6.2)에 존재하는 태그 핵의 비율을 추정하기 REPO-GAL4의 가상적인 디스크, UAS-EGFP :: MSP-300 KASH 제 령 유충을 조사 하였다. 그림 2A는 공 초점 현미경을 사용하여 얻은 사전 차단 샘플의 대표 이미지를 보여줍니다. 이 이미지에서 핵의 존재는 DAPI - 긍정적 인 이벤트로 표시됩니다. 띄엄 띄엄 흩어져 GFP 양성, DAPI 양성 신경교 핵의 소수도 관찰된다. 우리는 GFP 양성 핵이 총 핵 인구의 2 %를 차지하고 것으로 예상샘플 (그림 2A). 섹션 2.6.3 (표 2)에 설명 된대로 눈 엽 100 애벌레를 해부 한 눈, 상상 디스크의 전체 핵 수익률은 사전에 분리 샘플에 대해 측정 하였다. 약 2 %가 GFP 양성 된 0.8 및 1.2 × 10 7 핵 사이에 포함 된 100 해부 눈 엽과 눈, 상상 디스크에서 일반적인 사전 차단 샘플. 그림 2B는 정의 된 영역에서 DAPI 양성 핵의 대표 이미지를 보여줍니다 혈구의. 핵이 손상을주지하고 (도 2A 및 2B) 프로토콜에서 사용되는 추출 조건 하에서 일관된 원형을 유지한다. 이 프로토콜은 분리 및 / 또는 고도의 혼합 세포 인구를 포함하는 조직에서 레이블 핵의 특정 인구를 풍부하게 사용할 수 있는지 확인하려면, α-GFP 항체 코팅 자기 구슬을 사용했다눈 엽 100 REPO-GAL4, UAS-EGFP :: MSP-300 KASH 제 령 애벌레의 눈, 상상 디스크에서 얻은 균질에서 태그 핵을 분리하는 D. 도 2C 및 2D에서는 EGFP :: KASH는 α-GFP 코팅 자석 구슬에 아교 핵 바인딩 태그 및 자기 분리 다음 포스트 분리 샘플 (섹션 2.11.1)에서 관찰되는 것을 알 수있다. 자석 구슬은 GFP 채널의 일부 형광도를 전시하지만, 이들은 쉽게 자신의 작은 크기 (핵 약 5 μm의 대 자석 구슬 2.8 μm의)와 DAPI 염색의 부족으로 구슬 바인딩 핵 차별화 할 수 있습니다. GFP + / DAPI + 핵은 후 격리 샘플 DAPI 긍정적 인 사건의 95 % 이상을 차지하고있다. 따라서, 목표는 핵 인구 태그는 고도의 사전 차단에 포스트 분리 샘플 상대에 충실샘플. 후 격리 샘플 쇼 강력한 핵 봉투 지역화 GFP의 형광과의 핵의 대부분은 일반적으로 구슬에 둘러싸여 있습니다. 그러나, 태그없는 핵의 소수의이 샘플에 존재할 수있는 가능성이있다. 따라서,도 2C 및도 3에서 유전자 발현 분석의 결과 (아래 참조)는 대상, 신경교 핵 인구가 매우 충실 태그 된 것을 나타내더라도 다른 비특이적 세포 유형에서 몇몇 핵 또한 시료에 존재하는 가능성 배제 할 수 없습니다. 그것은 사용자가 특정 세포 유형과 그 조직 대상 핵 인구의 농축을 극대화하고, 비특이적 핵을 제거하기 위해이 프로토콜을 최적화하는 것이 좋습니다. 특히, 항체 및 비즈 재료 상대적인 시작의 비율은 대상 핵의 최적 농축 중요 할 가능성이있다. 이 때문에, 전체의 범위트립 전형적인 사전 분리 샘플에 존재 핵 번호는 표 2에 나타낸다. 사전 분리 샘플에 존재하는 총 핵 숫자 및 광섬유 엽과 눈 가상적인 디스크의 혼합 집단에서 신경교 세포의 추정 된 비율에 기초하여, 포스트 - 분리 샘플의 최대 핵 수율 1.6 사이에있을 것으로 예상했다 × 105 및 2.4 × 10 5 핵. 그러나, 단계 2.6.3에서 설명 핵 수율을 결정하는 혈구를 사용하여, 포스트 - 분리 샘플에서 얻어진 실제 핵 수율은 4 x 4 10 10 X 1.3 내지 2.7 핵이었다. 후 격리 샘플에 존재하는 비즈 혈구의 정확한 로딩에 영향을 미칠 것으로 보인다 때문에 이러한 핵 수익률은 매우 거친 추정치를 나타냅니다. 일부 GFP 양성 핵을 나타내는 언 바운드 균질에서 관찰되는의의 모든 GFP 양성 핵효율적으로이 프로토콜에 사용되는 조건에서 구슬에 충분한 바인드. 순차적 분리 단계를 바인딩하거나 수행하는 시간을 늘리면이 수율을 증가시킬 수 있지만, 이것은 순도와 RNA 무결성 모두의 비용으로 올 수 있습니다. 이 프로토콜에 설명 된 조건을 사용하여, RNA의 충분한 양이 QRT-PCR (표 2)에 의해 하류의 유전자 발현 분석을위한 사후 분리 샘플에서 얻어 질 수있다. 따라서,이 프로토콜은 신속하고 엄격 세포의 혼합 집단을 포함 조직으로부터 표적 핵을 단리 할 수​​있다. 또한, 구체적으로 관련 인구 세포의 단지 작은 비율이 5 % 미만을 구성하는 타겟 핵을 분리 할 수​​있다. 더 후 분리 샘플이 높은 목표 신경교 핵 인구에 충실한 것을 확인하려면, 사전에 격리 4 가지 유전자에 대한 성적 수준 </strong&gt; 및 사후 격리 샘플은 RT-qPCR에 의해 비교 ​​하였다. elav, nrv2와 EGFP의 전 사체 수준은 두 개의 샘플에서 결정되고 (도 3) 신경교 세포에서 상당 수준과 주변 중추 신경계에서 발현되는 기준 유전자 Rpl32, 정규화 하였다. 후 격리 샘플의 배 차이는 1로 설정되어있는 사전 격리 샘플을 기준으로 표시됩니다. 그림 3에서, 후 격리 샘플은 미리 분리 샘플의 연결 특정 유전자 elav 상대적으로 상당히 낮은 성적 수준을 보여줍니다. 이 신경 세포의 핵에서 표현 된 후 격리 샘플에 있음을 나타냅니다. 대조적으로, 신경교 - 농후 nrv2 유전자 (10) 및 EGFP 모두 높은 전사 수준은 사후 졸라에 존재사전 분리 샘플 기 샘플 상대. 이 결과는 이후 분리 샘플이 높은 대상 신경교 핵 인구 농축되어 있음을 나타냅니다. 이것은이 프로토콜에서 측정 전 사체 수준이 핵 성적을 나타낸다는 것을주의하는 것이 중요하고, 따라서 활성 전사의 수준보다는 정상 상태의 mRNA를 나타낼 가능성이있다. REPO의 재현 식은 REPO-GAL4 드라이버로 표현 인 Gal4 단백질은 내생 REPO 유전자의 활성 전사 후 지속될 수 있습니다 중단 한 것을 제안, 우리의 사전 차단 및 사후 격리 샘플도 검출되지 않았다. 이 트 위 프로모터를 사용하여 표시 핵 아마 인해 단백질의 안정성 8 대 전사의 개발시기의 차이로, 트 위 성적의 농축 수준을 표시하지 않는 한 다른 연구 결과와 일치한다. 탁EN 함께,이 결과는 설명 프로토콜이 성공적으로 높은 세포의 혼합 집단을 포함 조직으로부터 표적 핵을 풍부하게하고, 격리 된 핵은 유전자 발현 분석 용으로 적합하다는 것을 사용할 수 있음을 보여준다. <img alt="그림 1" fo:content-width="5in" fo:src="/files/ftp_upload/51418/51418fig1highres.jpg" src="/files/ftp_upload/51418/51418fig1.jpg" /> 그림 1. REPO-GAL4의 발현 패턴, UAS-EGFP :: MSP-300 KASH 라인을 비행. (A) 제 령 애벌레에서 REPO-GAL4는 눈에 glial 세포에서 UAS-EGFP :: MSP-300 KASH의 유전자의 발현을 구동 로브, 광학 스토킹 (OS)와 눈, 상상 디스크 (ED). glial 세포의 핵 봉투 EGFP :: KASH (녹색)으로 표시됩니다. R1 - R8 시각 세포의 축삭은 비교를 위해 α-chaoptin (mAB24B10, 빨간색)으로 표시하고, DNA는 역입니다있다DAPI (보라색)으로 조사 하였다. GFP - 라벨 아교 세포 핵은 (화살표로 표시) 눈 엽 내의 얇은 판 (라)에 따라 볼 수 있습니다. 스케일 바, 50 μm의. (B) EGFP :: KASH를 포함하는 광 엽의 얇은 신경절의 높은 배율 이미지는 아교 세포의 핵을 표시. 스케일 바, 50 μm의. 공 촛점 이미지는 하나를 사용하여 획득 하였다 &#160; 40 배 / 1.30 오일이나 &#160; 20X / 825 기름 침지 목표, 408 nm/425-475 뉴 멕시코 (DAPI)의 여기 / 방출 파장을 사용하여, 488 nm/525-550 뉴 멕시코 (GFP) 561 nm/595-620 뉴 멕시코 (알렉사 5,6,8 ). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51418/51418fig1highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 2" fo:content-width="5in" fo:src="/files/ftp_upload/51418/51418fig2highres.jpg" src="/files/ftp_upload/51418/51418fig2.jpg" /> 그림 2. 핵의 특성&quot;사전 분리&quot;와 &quot;포스트 분리&quot;샘플. (A) 대표 이미지에서 REPO-GAL4, UAS-EGFP :: MSP-300 KASH 사전 분리 샘플은 20 / 825 기름 침지 목표 및 표준 X를 사용하여 분석 공 초점 현미경. DNA는 DAPI (파란색)로 염색하고, EGFP :: KASH는 신경교 핵이 (화살표로 표시) 녹색으로 표시되는 태그됩니다. 스케일 바, 50 μm의. (B) X 10 공기 객관적이고 표준 표면 형광 현미경을 사용하여 혈구에 미리 격리 샘플에서 DAPI 염색 핵의 대표 이미지. 혈구 그리드는 밝은 회색으로 표시됩니다. GFP의 형광 표면 형광 현미경이 목적에 따라 표시되지 않은으로 만 DAPI 양성 핵,이 이미지에 표시됩니다. (C)의 repo-GAL4, UAS-EGFP :: MSP-300 KASH 후 격리 샘플 대표 이미지패널에 대하여 기술 된 바와 같이 분석했다. 격리 된 EGFP :: KASH는 DAPI에 대해 긍정적으로 얼룩 (화살표로 표시) 신경교 핵을 태그하고, 구슬에 의해 둘러싸여있다 GFP 채널에서 낮은 수준에있는 autofluoresce. 스케일 바, 50 μm의. 전형적인 고립 된 EGFP :: KASH의 (D) 높은 배율의 이미지는 구슬로 둘러싸인 (화살표로 표시) 신경교 핵 태그. 스케일 바, 5 μm의는. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51418/51418fig2highres.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> <img alt="그림 3" fo:content-width="5in" fo:src="/files/ftp_upload/51418/51418fig3highres.jpg" src="/files/ftp_upload/51418/51418fig3.jpg" /> 그림 3. &quot;사전 분리&quot;와 &quot;포스트 분리&quot;샘플 대표 QRT-PCR 데이터. 표적 유전자의 전사 수준은 사전 ISOL의 QRT-PCR에 의해 결정되었다REPO-GAL4, UAS-EGFP :: MSP-300 KASH 눈 엽 (叶)과 눈, 상상 디스크에서 얻은 ATION 및 사후 격리 샘플. 모든 전 사체 수준은 Rpl32 사체 수준으로 정규화하고, 각각의 유전자 표적을위한 사전 분리 시료는 1로 설정된다. 한 생물학적 실험에서 대표 결과는 다음과 유전자 표시됩니다 : elav, nrv2 및 EGFP. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 유전자 </td><td> 프라이머 서열 (5 &#39;-3&#39;) </td><td> 크기 PCR 제품 (BP) </td></tr><tr><td> EGFP </td><td> GAGGGATACGTGCAGGAGAG </td><td> (102) </td></tr><tr><td></td><td> GATCCTGTTGACGAGGGTGT </td><td></td></tr><tr><td> nrv2 </td><td> GGCTGGTTGTAGTCGCAGTT </td><td> 125 </td></tr><tr><td></td><td> GGCACCCAACACGAGAACTA </td><td></td></tr><tr><td> elav </td><td> GCACCATTCGGAGCAATAAT </td><td> 153 </td></tr><tr><td></td><td> TGTGCAGCTGGATGGTGTAG </td><td></td></tr><tr><td> Rpl32 </td><td> GCTAAGCTGTCGCACAAATG </td><td> (160) </td></tr><tr><td></td><td> CGTTGTGCACCAGGAACTT </td><td></td></tr></tbody></table> 표 1. QRT-PCR 분석을 위해 사용 된 프라이머. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> 사전 분리 샘플에서 핵의 수 : </td><td> 후 격리 샘플에서 핵의 예상 총 수 </td><td> 후 격리 샘플에서 RNA 수익률 (겨) </td></tr><tr><td> 0.8-1.2 × 10 7 </td><td> 1.3-2.7 × 104 </td><td> 160-220 NG </td></tr></tbody></table> 표 2. 얻은 대표적인 핵 및 RNA 수율.glial 세포가 함께 표시되는 100 해부 눈 엽 및 REPO-GAL4, UAS-EGFP :: MSP-300 KASH 유전자형에서 눈, 상상 디스크에서 사전 차단 및 사후 격리 샘플에서 얻은 핵 및 RNA 수율의 전형적인 범위 EGFP :: KASH. 2.6.3에 설명 된 핵을 정량화하고, 3.1.2에 설명 된 RNA를 정량 하였다.

Watch this Scientific Journal Video about Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis at JoVE.com

Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

초파리의 조직은 종종 세포 유형의 이종 혼합물을 포함한다. 특정 조직으로부터 특정 세포 유형에서의 유전자 발현을 조사하기 위해, 핵 유전자 태그이어서 궁합 기반 접근 방식을 사용하여 단리 할 수​​있다. 격리 핵은 유전자 발현 분석 및 면역 침전과 같은 염색질 하류 애플리케이션에 사용될 수있다.

에서 태그가 핵의 선호도 기반 격리<em&gt; 초파리</em유전자 발현 분석을위한&gt; 조직

Drosophila melanogaster embryonic and larval tissues often contain a highly heterogeneous mixture of cell types, which can complicate the analysis of gene ...

affinity-based-isolation-tagged-nuclei-from-drosophila-tissues-for

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

Genetics

Gene Expression

SCIENTISTS IN ACTION

14.7K 조회수.  Purdue University.  초파리의 조직은 종종 세포 유형의 이종 혼합물을 포함한다. 특정 조직으로부터 특정 세포 유형에서의 유전자 발현을 조사하기 위해, 핵 유전자 태그이어서 궁합 기반 접근 방식을 사용하여 단리 할 수​​있다. 격리 핵은 유전자 발현 분석 및 면역 침전과 같은 염색질 하류 애플리케이션에 사용될 수있다. 

비디오: Affinity-based Isolation of Tagged Nuclei from Drosophila Tissues for Gene Expression Analysis

Bacterial Gene Expression Analysis Using Microarrays

Microarrays을 사용하여 세균의 유전자 발현 분석

연구

생물학

Neuronal Nuclei Isolation from Human Postmortem Brain Tissue

Neurons in the human brain become postmitotic largely during prenatal development, and thus maintain their nuclei throughout the full lifespan. However, little is known about changes in neuronal chromatin and nuclear organization during the course of development and aging, or in chronic neuropsychiatric disease. However, to date most chromatin and DNA based assays (other than FISH) lack single cell resolution. To this end, the considerable cellular heterogeneity of brain tissue poses a significant limitation, because typically various subpopulations of neurons are intermingled with different types of glia and other non-neuronal cells. One possible solution would be to grow cell-type specific cultures, but most CNS cells, including neurons, are ex vivo sustainable, at best, for only a few weeks and thus would provide an incomplete model for epigenetic mechanisms potentially operating across the full lifespan.  Here, we provide a protocol to extract and purify nuclei from frozen (never fixed) human postmortem brain. The method involves extraction of nuclei in hypotonic lysis buffer, followed by ultracentrifugation and immunotagging with anti-NeuN antibody. Labeled neuronal nuclei are then collected separately using fluorescence-activated sorting. This method should be applicable to any brain region in a wide range of species and suitable for chromatin immunoprecipitation studies with site- and modification-specific anti-histone antibodies, and for DNA methylation and other assays. 

The cellular heterogeneity of brain tissue poses a significant limitation for the study of epigenetic markings in chromatin because most assays lack single cell resolution. Neurons typically are intermingled with glia and other non-neuronal cells. We provide a protocol to extract and collect neuronal nuclei from human brain.

인간의 사후 뇌 조직에서 핵의 연결을 격리

Neurons in the human brain become postmitotic largely during prenatal development, and thus maintain their nuclei throughout the full lifespan. However, ...

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

Electroporation에 대한 Murine 골수에서 조혈 세포 차 문화의 준비

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Vaccinia Virus Infection &amp; Temporal Analysis of Virus Gene Expression: Part 1

The family Poxviridae consists of large double-stranded DNA containing viruses that replicate exclusively in the cytoplasm of infected cells. Members of the orthopox genus include variola, the causative agent of human small pox, monkeypox, and vaccinia (VAC), the prototypic member of the virus family. Within the relatively large (~ 200 kb) vaccinia genome, three classes of genes are encoded: early, intermediate, and late. While all three classes are transcribed by virally-encoded RNA polymerases, each class serves a different function in the life cycle of the virus. Poxviruses utilize multiple strategies for modulation of the host cellular environment during infection. In order to understand regulation of both host and virus gene expression, we have utilized genome-wide approaches to analyze transcript abundance from both virus and host cells. Here, we demonstrate time course infections of HeLa cells with Vaccinia virus and sampling RNA at several time points post-infection. Both host and viral total RNA is isolated and amplified for hybridization to microarrays for analysis of gene expression.

Vaccinia Virus Infection & Temporal Analysis of Virus Gene Expression: Part 1

Protocol for Vaccinia infection of HeLa cells and analysis of host and viral gene expression. Part 1 of 3.

우두 바이러스 감염 및 바이러스 유전자 발현의 시간적 분석 : 1 부

The family Poxviridae consists of large double-stranded DNA containing viruses that replicate exclusively in the cytoplasm of infected cells.  Members of ...

RNA Isolation from Embryonic Zebrafish and cDNA Synthesis for Gene Expression Analysis

Many important and complex laboratory procedures require an input of high quality, intact RNA.  A degraded sample or the presence of impurities can lead to disastrous results in downstream experimental applications.  It is therefore, of utmost importance to use solid techniques with numerous safeguards and quality control checks to ensure a superior sample.  Herein, we detail a protocol to isolate total RNA from whole zebrafish embryos using a commercially available chemical denaturant and subsequent cleanup to remove traces of DNA and impurities using a commercial RNA isolation kit. As RNA is relatively unstable and easily prone to cleavage by RNAses, most protocols assay gene expression using a cDNA product that is directly synthesized from an RNA template. We detail a procedure to convert RNA into the more stable cDNA product using a commercially available kit. Throughout these procedures there are numerous quality control checks to ensure that the sample is not degraded or contaminated.  The end product of these protocols is cDNA that is suitable for microarray analysis, RT-PCR or long-term storage.    

The isolation of high quality, intact RNA is an essential step in many laboratory protocols. Here, we demonstrate RNA extraction from whole zebrafish embryos and cDNA synthesis for subsequent application in various experimental procedures including gene expression microarray analysis.

유전자 발현 분석을위한 배아 Zebrafish 및 cDNA 합성에서 RNA 격리

Many important and complex laboratory procedures require an input of high quality, intact RNA.  A degraded sample or the presence of impurities can lead ...

Using the Gene Pulser MXcell Electroporation System to Transfect Primary Cells with High Efficiency

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell electroporation system and Gene Pulser electroporation buffer (Bio-Rad) were specifically developed to easily transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells. We will demonstrate how to perform a simple experiment to quickly identify the best electroporation conditions. We will demonstrate how to run several samples through a range of electroporation conditions so that an experiment can be conducted at the same time as optimization is performed. We will also show how optimal conditions identified using 96-well electroporation plates can be used with standard electroporation cuvettes, facilitating the switch from electroporation plates to electroporation cuvettes while maintaining the same electroporation efficiency. In the video, we will also discuss some of the key factors that can lead to the success or failure of electroporation experiments.

This procedure shows how to use the Gene Pulser MXcell electroporation system to rapidly and easily identify the best electroporation conditions for mouse embryonic fibroblasts (MEFs) or other primary cells. Considerations for troubleshooting are also discussed in the associated video.

고효율 기본 셀을 Transfect하는 진 Pulser Electroporation MXcell의 시스템을 사용하여

Robotics and Dynamic Image Analysis for Studies of Gene Expression in Plant Tissues

Gene expression in plant tissues is typically studied by destructive extraction of compounds from plant tissues for in vitro analyses. The methods presented here utilize the green fluorescent protein (gfp) gene for continual monitoring of gene expression in the same pieces of tissues, over time. The gfp gene was placed under regulatory control of different promoters and introduced into lima bean cotyledonary tissues via particle bombardment. Cotyledons were then placed on a robotic image collection system, which consisted of a fluorescence dissecting microscope with a digital camera and a 2-dimensional robotics platform custom-designed to allow secure attachment of culture dishes. Images were collected from cotyledonary tissues every hour for 100 hours to generate expression profiles for each promoter. Each collected series of 100 images was first subjected to manual image alignment using ImageReady to make certain that GFP-expressing foci were consistently retained within selected fields of analysis. Specific regions of the series measuring 300 x 400 pixels, were then selected for further analysis to provide GFP Intensity measurements using ImageJ software. Batch images were separated into the red, green and blue channels and GFP-expressing areas were identified using the threshold feature of ImageJ. After subtracting the background fluorescence (subtraction of gray values of non-expressing pixels from every pixel) in the respective red and green channels, GFP intensity was calculated by multiplying the mean grayscale value per pixel by the total number of GFP-expressing pixels in each channel, and then adding those values for both the red and green channels. GFP Intensity values were collected for all 100 time points to yield expression profiles. Variations in GFP expression profiles resulted from differences in factors such as promoter strength, presence of a silencing suppressor, or nature of the promoter. In addition to quantification of GFP intensity, the image series were also used to generate time-lapse animations using ImageReady. Time-lapse animations revealed that the clear majority of cells displayed a relatively rapid increase in GFP expression, followed by a slow decline. Some cells occasionally displayed a sudden loss of fluorescence, which may be associated with rapid cell death. Apparent transport of GFP across the membrane and cell wall to adjacent cells was also observed. Time lapse animations provided additional information that could not otherwise be obtained using GFP Intensity profiles or single time point image collections.

We report a method for introduction, tracking and quantitative analysis of GFP expression in plant cells. This method utilizes a custom-designed robotics system for semi-continuous image collection from large numbers of samples, over time. We also demonstrate the use of ImageJ and ImageReady for analysis of image series.

로보틱스 및 식물 조직에서 유전자 발현의 연구 동적 이미지 분석

Gene expression in plant tissues is typically studied by destructive extraction of compounds from plant tissues for in vitro analyses. The methods ...

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

유전자 발현 연구를 단순화하는 자동 셀 카운터를 사용하여 : Namalwa 셀에서 IL - 4 종속 유전자 발현의 siRNA의 최저

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

Paraffin-Embedded and Frozen Sections of Drosophila Adult Muscles

The molecular characterization of muscular dystrophies and myopathies in humans has revealed the complexity of muscle disease and genetic analysis of muscle specification, formation and function in model systems has provided valuable insight into muscle physiology. Therefore, identifying and characterizing molecular mechanisms that underlie muscle damage is critical. The structure of adult Drosophila multi-fiber muscles resemble vertebrate striated muscles 1 and the genetic tractability of Drosophila has made it a great system to analyze dystrophic muscle morphology and characterize the processes affecting muscular function in ageing adult flies 2. Here we present the histological technique for preparing paraffin-embedded and frozen sections of Drosophila thoracic muscles. These preparations allow for the tissue to be stained with classical histological stains and labeled with protein detecting dyes, and specifically cryosections are ideal for immunohistochemical detection of proteins in intact muscles. This allows for analysis of muscle tissue structure, identification of morphological defects, and detection of the expression pattern for muscle/neuron-specific proteins in Drosophila adult muscles. These techniques can also be slightly modified for sectioning of other body parts.

Paraffin-Embedded and Frozen Sections of Drosophila Adult Muscles

Identification of mechanisms underlying muscle damage is crucial. Here we present the histological technique for preparing paraffin-embedded and frozen sections of Drosophila thoracic muscles. This allows analysis of muscle morphology and localization of protein and other muscle cell components.

의 파라핀 - 임베디드 및 냉동 섹션 Drosophila 성인 근육

The molecular characterization of muscular dystrophies and myopathies in humans has revealed the complexity of muscle disease and genetic analysis of ...

Analysis of Global RNA Synthesis at the Single Cell Level following Hypoxia

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a particular transcriptional program in order to mount an appropriate and coordinated cellular response. The cell possesses several oxygen sensor enzymes that require molecular oxygen as cofactor for their activity. These range from prolyl-hydroxylases to histone demethylases. The majority of studies analyzing cellular responses to hypoxia are based on cellular populations and average studies, and as such single cell analysis of hypoxic cells are seldom performed. Here we describe a method of analysis of global RNA synthesis at the single cell level in hypoxia by using Click-iT RNA imaging kits in an oxygen controlled workstation, followed by microscopy analysis and quantification.&nbsp; Using cancer cells exposed to hypoxia for different lengths of time, RNA is labeled and measured in each cell. This analysis allows the visualization of temporal and cell-to-cell changes in global RNA synthesis following hypoxic stress.

We describe a technique for analysis of global RNA synthesis in hypoxia using imaging. Click-chemistry labeling of RNA has not previously been performed under hypoxia and allows visualization of global RNA changes at the single cell level. This approach complements the existing averaged RNA techniques, allowing direct visualization of cell-to-cell changes in global RNA synthesis.

저산소증에 따라 단일 세포 수준에서 글로벌 RNA의 합성 분석

Hypoxia or lowering of the oxygen availability is involved in many physiological and pathological processes. At the molecular level, cells initiate a ...