저자는 프로토콜 위에서 설명한 개발에서의 도움 아이오와 대학에서 미네소타 대학에서 Branden의 Moriarity, 데이비드 Largaespada, 그리고 빈센트 켕에게 감사를, 그리고 아담 Dupuy 것입니다.

1. 사육 및 트렌스 제닉 동물의 고령화 <ol><li> 실험에 적합한 유전자 변형 생쥐의 변종을 선택합니다. 원하는 암 기원의 세포 것으로 세포에 Cre Recombinase을 표현 조건부 transposase 마우스, transposons의 concatamer을 품고 마우스 및 마우스, 전형적인 실험은 세 유전자 변형 라인을 사용합니다. 모델링되는 암 환자의 큰 비율에 알려진 돌연변이가있는 경우는 시작에서이 변이를 포함하는 것이 바람직 할 수 있습니다. 이 &quot;predisposing&quot;변이의 예는 다음과 활성화 Kras, 지배적 인 부정적 Tp53 또는 floxed Pten의 allele가 포함되어 있습니다. predisposing 돌연변이에 추가하여 모델은 더 나은 (1.3 참조) 인간의 암을 의미합니다. 여러 슬리핑 뷰티 transposase와 transposon 마우스는 국립 암 연구소 마우스 저장소 (에서하실 수 있습니다 <a href="http://mouse.ncifcrf.gov/" target="_blank">http://mouse.ncifcrf.gov/</a> ). </li><li> 결국 가능한 경우 두 대립 유전자에 대한 homozygous 마우스를 얻기 위해 transposons을 품고 쥐 번식 조건 transposase 마우스. 귀하의 트리플 유전자 변형 실험 쥐 (그림 2)을 생성 할 수 Cre Recombinase을 표현 마우스로 품종 homozygous 자손합니다. 참고 : 취득 homozygous 마우스는 항상 가능하거나 이상적인 없습니다. 예를 들어, homozygous p53의 지배 부정적인 마우스는 훨씬 더 어려운 heterozygous 마우스보다 번식하려고합니다. 또한, litters이 번식 제도가 성공적으로 확인 Mendelian 유전학을 준수하는지 확인하기 위해 도움이 될 것입니다. </li><li> 취약한 배경을 사용하는 경우, predisposing allele있는 마우스에 transposase있는 첫번째 품종 마우스. 동시에 번식 마우스는 transposons을 가진 마우스에 Cre Recombinase을 표현. 각 allele 가능한 경우에 대한 homozygous 쥐를 만듭니다. 마지막으로, 쿼드 러플 유전자 변형 실험의 anim를 생성하는 과거 2 번식 제도에서 homozygous 자손을 번식ALS. </li><li> 실험 동물뿐만 아니라, 마우스 제어 동료를 생성합니다. 제어 그룹은 일반적으로 만 세 대립 유전자 (그림 2) 중 두 가지를 상속 실험 사육에서 littermates로 구성되어 있습니다. 취약한 배경의 경우, 네 개의 대립 유전자 중에 세 등의 마우스도 필요합니다. </li><li> 종양 개발 및 / 또는 moribundity에 대한 일일 실험 및 제어 쥐를 모니터링 할 수 있습니다. 귀하의 기관 동물 관리 및 동물 축산의 사용위원회 (IACUC) 요구 사항을 따르십시오. 또한, 그것은 아직 죽어가는가되지 않은 경우 동물을 희생되는에 나이를 결정하는 것이 일반적입니다. 18 개월 쥐가 euthanized 할 것인지 전형적인 연령은 16 세입니다. </li></ol> 2. 트렌스 제닉 동물의 검시 <table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> 그래 - 인감 Induc기 회의소 </td><td> 브레인 트리 과학 </td><td> EZ-177 </td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td></tr><tr><td> 10 % 포르말린 버퍼 </td><td> 시그마 알드리치 </td><td> HT501128-4L </td></tr></tbody></table> 표 1. 시약이 필요합니다. <ol><li> 마우스 죽어가는거나 결정 수명의 끝을 도달하면 IACUC 지침에 따라 CO 2 챔버를 사용하여 동물을 안락사시켜야. 일반적으로, 깨끗한 가스 챔버에 동물을 배치 가스 탱크를 열고 평방 인치 당 더 높은 5 이상 파운드를 읽어 조절기를 조정합니다. CO 2 코와 눈 자극 혐오감을 최소화하기 위해 천천히 입력하십시오. 동물의 심장이 더 이상 뛰고되지 않으며 눈에 접촉 할 때 응답하지 않는지 확인하십시오. </li><li> 70 %의 에탄올과 희생 마우스 스프레이 외관. </li><li> 장소 검시 보드에서 마우스 및 해부 핀으로 고정. 가위에게를 사용하여D 핀셋 마우스를 열고 장기를 제거합니다. 수집해야하는 장기 결정하는 것은 프로젝트에 따라 달라지게된다. 그러나, 이러한 기관은 종종 마우스가 죽어가는 이유에 중요한 통찰력을 제공으로 항상 비장과 간을 수집하는 것이 좋습니다. 또한 골수의 잠재력 분석을위한 흉골를 수집합니다. 또한, 항상 이상 나타나는 장기 나 조직을 수집 도움이됩니다. </li><li> 수집 조직 및 종양은 4 개의 섹션으로 구분해야합니다. 10 % 70 % 에탄올 다음 18 시간에 포르말린 버퍼에 하나의 섹션이 고정됩니다. 이 섹션은 H &amp; E 염색 및 / 또는 IHC 사용할 수 있습니다. 일반적으로 크기가 50-100 밀리그램있는 나머지 세 부분은, 액화 질소에 냉동 스냅 있습니다. 이러한 DNA, RNA 및 단백질 분리에 사용할 수 있습니다. </li><li> IACUC 가이드 라인에 따라 시체와 나머지 조직을 폐기합니다. </li></ol> 3. 종양의 게놈 DNA를 분리 <table border="1"><tbody><tr><td> &lt;시약의 STRONG&gt; 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> 단백질 강수량 솔루션 </td><td> Qiagen </td><td> 158910 </td></tr><tr><td> 세포 용해 버퍼 </td><td> Qiagen </td><td> 158906 </td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td></tr><tr><td> RNase </td><td> Qiagen </td><td> 158924 </td></tr><tr><td> TE 버퍼 </td><td> Promega </td><td> V6232 </td></tr></tbody></table> 표 2. 시약이 필요합니다. <ol><li> 잘게 깨끗한 면도날을 사용하여 냉동 종양 샘플을 (50-100 MG) 이기다. </li><li> 장소 1.5 ML의 microcentrifuge 튜브에 조직을 다진 5 μl Proteinase K 솔루션 (20 MG / ML)가 포함 된 셀 용해 버퍼 1 ML를 추가합니다. </li><li> 철저하게 와동. </li><li> ° C 흔드는는 바람직 하루 아침에 적어도 4 시간, 250 rpm으로 설정 한 55 품다. </li><li> 1 μl RNase 솔루션을 (10 MG / ML) 추가 및 튜브 25 배를 반전. </li><li> 30 분에 37 ° C에서 알을 품다. </li><li> 3 분에 얼음에 배치하여 실내 온도에 차가운. </li><li> 333 μl 단백질 강수량 솔루션과 강력하게 소용돌이를 추가합니다. </li><li> 14,000 rpm에서 10 분에서 원심 분리기. 단백질은 펠릿해야. 펠렛 다시 아주 작은, 소용돌이 인 경우 5 분 후 다시 원심 분리기에 얼음에 품다. </li><li> 깨끗한 15 ML의 원심 분리기 튜브로 표면에 뜨는 포함하는 DNA를 넣어. </li><li> 백퍼센트 이소프로판올의 동등한 볼륨을 추가하고 부드럽게 반전 50 회에 섞는다. </li><li> 3 분에 3,500 rpm으로 원심 분리기. </li><li> 표면에 뜨는 폐기하십시오. </li><li> 70 % 에탄올 1 ML을 추가하고 펠릿을 씻어 튜브를 여러 번 반전. </li><li> 1.5 ML의 microcentrifuge 관에 에탄올과 함께 한물 펠릿을 전송합니다. </li><li> 4 ° C.에 5 분에 14,000 rpm으로 원심 분리기 </li><li> 에탄올을 넣어, 공기 건조 (약 5-30 분)에 튜브를 반전. </li><li> Resuspend DNA Pellet는 TE의 50-500 μl에 DNA 펠렛의 크기에 따라 다릅니다. </li><li> 37 번 선택 부화는 ° C DNA를 resuspend합니다. </li><li> 장기 저장을위한 4 ° C 또는 -20 ° C에서 저장합니다. </li></ol> 4. 종양에서 링커 매개-PCR 사용하여 게놈의 DNA <table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> BfaI </td><td> 뉴 잉글랜드 Biolabs </td><td> R0568S </td></tr><tr><td> NlaIII </td><td> 뉴 잉글랜드 Biolabs </td><td> R0125S </td></tr><tr><td> 96 잘 접시를 MinElute </td><td> Qiagen </td><td> 28,051 </td></tr><tr><td> QIAvac 96 진공 매니 폴드 </td><td> Qiagen </td><td> 19,504 </td></tr><tr><td> 멀티 MicroPlate 지니, 120V </td><td> 과학 산업 주식회사 </td><td> SI-4000 </td></tr><tr><td> 5 배 결합 버퍼와 T4 DNA ligase의 </td><td> Invitrogen </td><html><td> 15224-041 </td></tr><tr><td> BamHI </td><td> 뉴 잉글랜드 Biolabs </td><td> R0136S </td></tr><tr><td> 25 MM dNTPs </td><td> Bioexpress </td><td> C-5014-200 </td></tr><tr><td> 플래티넘 DNA 형성 촉매 </td><td> Invitrogen </td><td> 10966-034 </td></tr><tr><td> FastStart DNA 형성 촉매의 DNA 중합 효소의 </td><td> 로슈 </td><td> 12032929001 </td></tr><tr><td> 아가로 오스 </td><td> Promega </td><td> V3121 </td></tr><tr><td> 태 버퍼 </td><td> Promega </td><td> V4271 </td></tr><tr><td> TE 버퍼 </td><td> Promega </td><td> V6232 </td></tr><tr><td> Ethidium 브로마이드 </td><td> Promega </td><td> H5041 </td></tr></tbody></table> 표 3. 시약이 필요합니다. 링커 시퀀스 BfaI 링커 + 5 &#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGAC 3&#39; BfaI 링커-5 &#39;Phos-TAGTCCCTTAAGCGGAG 3&#39;NH2 &quot;&gt; NlaIII 링커 + 5&#39;GTAATACGACTCACTATAGGGCTCCGCTTAAGGGACCATG 3 &#39; NlaIII 링커-5 &#39;Phos-GTCCCTTAAGCGGAGCC 3&#39; 프라이머 시퀀스 앞으로 차 PCR 오른쪽 (NlaIII) : SPL IRDR R1 한 GCTTGTGGAAGGCTACTCGAAATGTTTGACCC SPL IRDR L1 한 CTGGAATTTTCCAAGCTGTTTAAAGGCACAGTCAAC : 기본 PCR 앞으로 쪽 (BfaI)를 왼쪽으로 오른쪽과 왼쪽 모두 측면에 대한 기본 PCR 역방향 : SPL Link1 한 GTAATACGACTCACTATAGGGC 차 PCR 앞으로 오른쪽 : Illumina barcoded 보조 프라이머 5 &#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaGgtgtatgtaaacttccgacttcaa의 예 (N가 12 BP 바코드를 나타내는, 대문자의 순서는 Illumina 플랫폼에 필요한, ​​그리고 낮은 경우에 시퀀스는 transposon에 바인딩됩니다.) Illumina barcoded secon의 예 : 차 PCR 앞으로 곁을 떠나지dary 입문서 5&#39;AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNNNNNNNNNaAgtgtatgtaaacttccgacttcaa (N가 12 BP 바코드를 나타내는, 대문자의 순서는 Illumina 플랫폼에 필요한, ​​그리고 낮은 경우에 시퀀스는 transposon에 바인딩됩니다.) 오른쪽과 왼쪽 모두 측면에 대한 보조 PCR 역방향 : 링커 중첩 된 역 프라이머 5 &#39;CAAGCAGAAGACGGCATACGAGCTCTTCCGATCTAGGGCTCCGCTTAAGGGAC <ol><li> +를 단련하고 - BfaI의 linkers와 NlaII linkers 모두 linkers을 링커 - (100 μM)의 50 μl와 링커의 50 μl + (100 μM)를 혼합 의해 1.5 ML의 microcentrifuge 관에 2 μl NaCl을 (5 M) 추가 할 수 있습니다. 95 5 분에 대한 ° C 열 블록의 장소. 가열 블록을 해제하고 (이 시간 이상 소요) 객실 온도에 천천히 시원한 보자. 필요한 때까지 냉각 한 후, annealed linkers는 -20 ° C의 냉동고에 저장 될 수 있습니다. </li><li> 종양 DNA의 두 aliquots, DNA 1 μg를 포함하는 각 나누어지는을 준비합니다. 하나 나누어지는이 지혜를 소화 될 것입니다transposon의 &quot;오른쪽&quot;끝으로 아슬 아슬합니다 헥타르 제한 효소. 두 번째 나누어지는이 transposon의 &quot;왼쪽&quot;마지막에 가까운 지경 제한 효소로 소화 될 것입니다. 이것은 모든 transposon 삽입 사이트를 증폭의 가능성을 최대화하기 위해 수행됩니다. </li><li> &quot;오른쪽&quot;사이드 효소 NlaII을 이용하여 하나 나누어지는의 종양 DNA를 소화하고 &quot;왼쪽&quot;쪽 효소 BfaI을 사용하여 다른 나누어지는에있는 종양 DNA 소화 : 효소 1 μl, 5 μl 10X 코 버퍼 # 4, DNA를 (결합을 1 μg) 50 μl의 총 볼륨에 ddH 2 O. 37 번 박 다이제스트 DNA ° 물 목욕이나 보육에 C. </li><li> 효소를 비활성화 가열 (BfaI = 80 ° C 20 분에, NlaIII = 65 ° C 20 분 용). </li><li> MinElute 96 잘 플레이트에 샘플을 배치하여 소화 샘플을 청소, 우물까지 약 15 분에 진공 매니 폴드 및 진공의 장소 플레이트는 건조 봐. </li><li> 모든 liqui를 제거하는 진공 매니 폴드 및 종이 타월로 96 잘 접시의 얼룩 바닥에서 판을 제거디 </li><li> 각도에 30 μl ddH 2 O를 추가하고 2 분 높은에 궤도 셰이커 세트에 흔들, 또는 20-40 배 아래로 피펫합니다. </li><li> 깨끗 96 잘 접시에 MinElute 96 잘 접시에서 우물의 전체 볼륨 (30 μl)를 전송합니다. </li><li> 단계 4.8 및 4.1 단계에서 linkers에서 소화 DNA와 링커 결합 반응을 수행합니다. 10 μl 소화 DNA, 4 μl 5 배 결합 버퍼, 5.5 μl annealed linkers (950 μg / μl), 0.5 μl T4 ligase를 (5 U / μl) 섞는다. </li><li> 16시 밤에 4 시간에 품다 ° C. </li><li> 10 분 동안 65 ° C에서 T4 DNA ligase를 비활성화의 가열. </li><li> 4.6 - MinElute 96 잘 접시와 같은 단계 4.5에 설명 된 진공 매니 폴드를 사용하여 결합을 청소하십시오. </li><li> 30 μl H 2 O에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다. </li><li> concatamer transposons 남아 파괴하기 위해 두 번째 DNA의 소화를 수행합니다. 이 문제는 플라스미드 v를 잘라 효소를 사용하여 DNA 두 번째 절단에 의해 달성된다transposon concatamer를 포함하는 유전자 변형 쥐를 만드는 데 사용 된 ector DNA. </li><li> 다이제스트 DNA는 BamHI (왼쪽과 오른쪽 모두 측면)를 사용하여 : 믹스 단계 4.13, 5 μl 10X 코 버퍼 # 3, 0.5 μl BamHI (20 U / μl), 0.5 μl BSA (에서 링커 - 출혈도 잡았 DNA의 25 μl를 10 MG / ML ), 19 μl ddH 2 O. </li><li> 37 번 다이제스트 3-6 시간 또는 밤새 ° C. </li><li> 링커에 대한 transposon과 프라이머의 특정에 대한 특정 프라이머를 사용하여 기본 PCR을 수행합니다. 이러한 사용중인 transposon와 링커에 따라 달라집니다. 프리 머의 T2/Onc과 T2/Onc2 transposons에 대한 작업 위의 프라이머 표에 나열된. </li><li> 차 PCR : 5 μl 10X 버퍼, 2.0 μl MgCl2 (50 ㎜), 4 μl dNTPs (2.5 nm 정도), 1 μl 프라이머 1 (20 μM), 1 μl 프라이머 2 (20 μM), 0.25 μl 플래티넘 DNA 형성 촉매 (5 U / ) μl, linkers있는 3 μl 소화 DNA (금액이 다를 수 있습니다), 최대 50 μl ddH 2 O. </li><li> PCR 프로그램 : 94 ° C 5 분, 94의 30주기 ° C 30에 초, 60 &amp; D예를 들어, 30 초에 C, 90 초 72 ° C. 72의 최종 확장 ° C 5 분에. </li><li> MinElute 96 잘 접시 위에 설명 된대로 진공 매니 폴드를 사용하여 PCR 제품을 청소하십시오. </li><li> 30 μl H 2 O에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다. </li><li> 148 μl ddH 2 O로 단계 4.21에서 DNA의 2 μl를 diluting하여 (1)의 1:75 희석 ° PCR을 </li><li> 또한 Illumina GAIIx 기계뿐만 아니라 (이 프리 머의 예에 대한 위의 프라이머 표를 참조) 처리 각 종양 샘플에 대한 고유 12 기본 쌍 바코드에 필요한 순서를 가지고있는 프리 머의 중첩 된 버전을 사용하여 보조 PCR을 수행합니다. </li><li> 차 PCR : MgCl2을 갖춘 10 μl 10X 버퍼, 8 μl dNTPs (2.5 ㎜), 1 μl Illumina 보조 프라이머 (20 μM), 1 μl Illumina의 둥지 1 차 프라이머 (20 μM), 0.25 μl FastStart DNA 형성 촉매를 (barcoded 5 U / μl ), 차 PCR 희석 1:75에서 2 μl DNA, 최대 100 μl ddH 2 O. </li><li> PCR 프로그램 : 94 °, 2 분을위한 C, 90 초에 45 초, 72 ° C 30 초, 53 ° C에 94 ° C의 30주기. 72의 최종 확장 ° C 5 분에. </li><li> ethidium 브로마이드 (0.5 μg / ML)를 포함하는 1 % 아가로 오스 겔에서이 PCR 반응의 45 μl를 실행합니다. 종양의 여러 가지 transposon의 삽입 (그림 3)의 amplicons을 대표하는 PCR 제품의 &quot;비방&quot;이 있어야합니다. </li><li> MinElute 96 잘 접시 위에 설명 된대로 진공 매니 폴드를 사용하여 PCR 제품의 나머지 50 μl를 청소합니다. 우물에서 50 μl ddH 2 O를 배치 한 후 다시 진공 청소기로 청소하여 한 번 씻으십시오. </li><li> 30 μl TE에 Resuspend하고 깨끗한 96 잘 판에 전송할 수 있습니다. </li><li> 각 샘플에 DNA의 농도를 결정합니다. 하나의 1.5 ML의 microfuge 관 DNA의 동등한 양의 조화를 이루고 있습니다. 이 Illumina HiSeq 2000 시스템의 단일 차선으로 순서가되어있는 라이브러리 될 것입니다. 이 Illumina 실행의 단일 차선에서 순서 수백 종양을 할 수 있습니다. </li><li> 제출시퀀싱에 대한 모든 종양에서 DNA의 동등한 양을 포함하고있는 단일 관. 이는 기관이나 상업적으로 수행 할 수 있습니다. </li></ol> 5. Transposon에 삽입 분석 <ol><li> transposon 삽입 데이터를 분석 소프트웨어는 소스 포지 (를 통해 무료로 다운로드 할 수 있습니다 <a href="http://sourceforge.net/projects/tapdancebio/" target="_blank">http://sourceforge.net/projects/tapdancebio/</a> ). TapDance라는 프로그램은, Illumina 플랫폼과 라이브러리지도 텍스트 파일에 바코드에서 시퀀스 파일이 필요합니다. </li></ol>

<ol>
	<li>Fearon, E. R., Vogelstein, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genetic+model+for+colorectal+tumorigenesis.">A genetic model for colorectal tumorigenesis.</a> Cell. 61, 759-767 (1990).</li><li>Wood, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Genomic+Landscapes+of+Human+Breast+and+Colorectal+Cancers.">The Genomic Landscapes of Human Breast and Colorectal Cancers.</a> Science. 318, 1108-1113 (2007).</li><li>Ivics, Z., Hackett, P. B., Plasterk, R. H., Izsv&#225;k, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+Reconstruction+of+Sleeping+Beauty,+a+Tc1-like+Transposon+from+Fish,+and+Its+Transposition+in+Human+Cells.">Molecular Reconstruction of Sleeping Beauty, a Tc1-like Transposon from Fish, and Its Transposition in Human Cells.</a> Cell. 91, 501-510 (1997).</li><li>Starr, T. K., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+using+the+Sleeping+Beauty+transposon.">Cancer gene discovery using the Sleeping Beauty transposon.</a> Cell Cycle. 4, 1744-1748 (2005).</li><li>Mueller, P. R., Wold, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+Vivo+Footprinting+of+a+Muscle+Specific+Enhancer+by+Ligation+Mediated+PCR.">In Vivo Footprinting of a Muscle Specific Enhancer by Ligation Mediated PCR.</a> Science. 246, 780-786 (1989).</li><li>Bergemann, T. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+methods+for+finding+common+insertion+sites+and+co-occurring+common+insertion+sites+in+transposon-+and+virus-based+genetic+screens.">New methods for finding common insertion sites and co-occurring common insertion sites in transposon- and virus-based genetic screens.</a> Nucleic acids research. 40, 3822-3833 (2012).</li><li>Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Harnessing+transposons+for+cancer+gene+discovery.">Harnessing transposons for cancer gene discovery.</a> Nature Reviews Cancer. 10, 696-706 (2010).</li><li>Collier, L. S., Carlson, C. M., Ravimohan, S., Dupuy, A. J., Largaespada, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cancer+gene+discovery+in+solid+tumours+using+transposon-based+somatic+mutagenesis+in+the+mouse.">Cancer gene discovery in solid tumours using transposon-based somatic mutagenesis in the mouse.</a> Nature. 436, 272-276 (2005).</li><li>Starr, T. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transposon-based+genetic+screen+in+mice+identifies+genes+altered+in+colorectal+cancer.">A transposon-based genetic screen in mice identifies genes altered in colorectal cancer.</a> Science. 323, 1747-1750 (2009).</li><li>Keng, V. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+conditional+transposon-based+insertional+mutagenesis+screen+for+genes+associated+with+mouse+hepatocellular+carcinoma.">A conditional transposon-based insertional mutagenesis screen for genes associated with mouse hepatocellular carcinoma.</a> Nature. 27, 264-274 (2009).</li><li>Dupuy, A. J., Akagi, K., Largaespada, D. A., Copeland, N. G., Jenkins, N. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+mutagenesis+using+a+highly+mobile+somatic+Sleeping+Beauty+transposon+system.">Mammalian mutagenesis using a highly mobile somatic Sleeping Beauty transposon system.</a> Nature. 436, 221-226 (2005).</li></ol>

저자는 공개 할 수 없어요.

잠자는 숲속의 미녀 transposon 시스템을 사용하여 앞으로 유전자 화면은 원인 암 변이를 식별하는 방법을 제공합니다. 모든 predisposing 변이에 추가 Cre Recombinase를 제어 할 수있는 적절한 프로모터를 선택하면, SB 화면이 알려져 파악하고 새로운 후보 암 유전자 것입니다. SB 화면의 성공은 화면을 만들 때 선택한 마우스에 달려 있습니다. transposon를 들어, 우리는 서로 다른 염색체 7 일 종양 발생 transposons의 concatamer을 가진 두 개의 서로 다른 마우스 변종을 사용하는 것이 좋습니다. SB의 transposase을 활성화합니다 조직 별 Cre의 Recombinase을 선택할 때 조심스럽게 생각 사용해야합니다. Cre 효소가 모델로되는 암의 기원 세포되고 의심​​되는 세포 유형에서 활성화되어 있다는 증거가 있어야합니다. 성공적인 예는 Villin-Cre (GI 기관 암), 알부민-Cre을 (간세포 carcinom 포함) 및 보조 - Cre (림프종). 8-10 성공적으로 화면에 필요한 마우스의 수는 종양 penetrance에 따라 달라집니다. 일반적으로 더 많은 종양 등 마우스는보다 강력한 화면에 발생합니다. 암 대기 시간의 2 배의 차이를 감지 할 수 최소 60 동물 제어 및 실험 그룹이 모두 거기에 있어야합니다. 11 이 화면의 다양한 자연은 하나, 질병의 특성을 지정 진행을 따라, 그리고 유전 성분을 분석 할 수 있다는 점에서 다른 기술에 관련하여 강력하다. 이 기술은 새로운 잠재 암 운전 유전자를 식별 CIS 목록을 굴복 한 화면의 숫자에 성공했다. 이 정보 지향성 연구는 이러한 소설 변이의 기능을 이해하기 위해 수행 할 수 있습니다. 전반적으로,이 기술의 사용은 이러한 특정 유전자 무타의 결과를 제거하기위한 새로운 약물 요법의 최종 디자인으로 이어질 수 있습니다tions.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td><td> 코멘트 (선택 사항) </td></tr><tr><td> 그래 - 인감 유도 상공 회의소 </td><td> 브레인 트리 과학 </td><td> EZ-177 </td><td></td></tr><tr><td> Cryovial </td><td> Bioexpress </td><td> C-3355-2 </td><td></td></tr><tr><td> 10 % 포르말린 버퍼 </td><td> 시그마 알드리치 </td><td> HT501128-4L </td><td></td></tr><tr><td> 단백질 강수량 솔루션 </td><td> Qiagen </td><td> 158910 </td><td></td></tr><tr><td> 세포 용해 버퍼 </td><td> Qiagen </td><td> 158906 </td><td></td></tr><tr><td> Proteinase K </td><td> Qiagen </td><td> 158920 </td><td></td></tr><tr><td> RNase </td><td> Qiagen </td><td> 158924 </td><td></td></tr><tr><td> TE 버퍼 </td> &lt;TD&gt; Promega </td><td> V6232 </td><td></td></tr><tr><td> BfaI </td><td> 뉴 잉글랜드 Biolabs </td><td> R0568S </td><td></td></tr><tr><td> NlaIII </td><td> 뉴 잉글랜드 Biolabs </td><td> R0125S </td><td></td></tr><tr><td> 96 잘 접시를 MinElute </td><td> Qiagen </td><td> 28,051 </td><td></td></tr><tr><td> QIAvac 96 진공 매니 폴드 </td><td> Qiagen </td><td> 19,504 </td><td></td></tr><tr><td> 멀티 MicroPlate 지니, 120V </td><td> 과학 산업 주식회사 </td><td> SI-4000 </td><td></td></tr><tr><td> 5 배 결합 버퍼와 T4 DNA ligase의 </td><td> Invitrogen </td><td> 15224-041 </td><td></td></tr><tr><td> BamHI </td><td> 뉴 잉글랜드 Biolabs </td><td> R0136S </td><td></td></tr><tr><td> 25mM dNTPs </td><td> Bioexpress </td><td> C-5014-200 </td><td></td></tr><tr><td> 플래티넘 DNA 형성 촉매 </td><td> Invitrogen </td><td&gt; 10966-034 </td><td></td></tr><tr><td> FastStart DNA 형성 촉매의 DNA 중합 효소의 </td><td> 로슈 </td><td> 12032929001 </td><td></td></tr><tr><td> 아가로 오스 </td><td> Promega </td><td> V3121 </td><td></td></tr><tr><td> 태 버퍼 </td><td> Promega </td><td> V4271 </td><td></td></tr><tr><td> TE 버퍼 </td><td> Promega </td><td> V6232 </td><td></td></tr><tr><td> Ethidium 브로마이드 </td><td> Promega </td><td> H5041 </td><td></td></tr></tbody></table>

identification of sleeping beauty transposon insertions in solid tumors using linker-mediated pcr

인간 종양의 게놈, proteomic transcriptomic, 그리고 epigenomic 분석은 일치하는 정상 조직에 비해 각 암 게놈 내에서 이상 수천이 있다는 것을 나타냅니다. 이러한 분석을 바탕으로 암은 하나의 많은 알려지지 않은 유전자 드라이버가 있다는 것을 분명하다. 불행하게도 이러한 드라이버는 직접 종양 형성에 기여하지 않는 게놈의 여객 이상의 훨씬 더 큰 숫자 안에 숨겨져 있습니다. 암 게놈의 또 다른 측면은 비슷 종양 유형에서 상당한 유전 이질성이 있다는 것입니다. 각 종양은 종양 형성 2 선택적 이점을 제공합니다 다른 변이를 가지고 있고, 할 수 있습니다. 여객 변이의 배경을 줄이면서 쥐 편견 앞으로 유전 화면을 수행하면, 종양을 생성하고 자신의 유전자 구성을 분석 할 수있는 도구를 제공합니다. 슬리핑 뷰티 (SB) transposon 시스템은 하나의 방법 3. SB 시스템은 모바일 v를 활용transposase 효소에 의해 게놈 전체에 삽입 할 수 ectors (transposons). 변이는 Cre Recombinase에 의해 활성화되는 조건 transposase의 allele의 사용을 통해 특정 세포 유형으로 제한됩니다. 대부분의 마우스 라인은 특정 조직에서 해당 표현 Cre의 Recombinase을 존재합니다. 조건부 transposase의 allele (예 : 훈제 연어 스톱 - 훈제 연어 - SB11)에 다음 줄 중 하나를 횡단함으로써, SB 시스템은 명시 적 Cre Recombinase 세포에서 활성화됩니다. Cre Recombinase은 소비세 정지 카세트를 의지 해당하므로 지정된 셀 유형에서 transposon의 mutagenesis를 활성화 transposase allele의 블록 식. 실험 쥐가 조건부 transposase의 allele, transposons의 concatamer 및 조직 별 Cre의 Recombinase의 allele을 가지고 있도록 SB 화면이 유전자 변형 생쥐의 세 변종을 사육에 의해 시작됩니다. 이 마우스는 종양 양식까지 연령에 허용들이 죽어가는이 될 수 있습니다. 마우스 했군요necropsied 및 게놈 DNA는 종양으로부터 격리되어 있습니다. 다음으로, 게놈 DNA는 링커로 인한-PCR을 받게 (LM-PCR)는 SB transposon을 포함하는 게놈 loci의 증폭의 결과.입니다 LM-PCR은 단일 종양의 4 transposon의 삽입을 포함하는 게놈 loci의 수백을 대표하는 고유 amplicons 수백하게됩니다 단일 종양을 수행했습니다. 모든 종양의 transposon의 삽입 분석하고 일반적인 삽입 사이트 (CISs)는 적절한 통계 방법 5를 사용하여 식별됩니다. CIS 내에서 유전자 oncogenes 또는 종양 억제 유전자가 될 가능성이 매우 높다고 있으며, 후보 암 유전자로 간주됩니다. 후보 암 유전자를 식별 할 수 SB 시스템을 사용의 장점은 다음과 같습니다의 순서는, 2 알려져 있기 때문에 1) transposon은 쉽게 전위는 거의 모든 세포 유형으로 이동하고 3) transposon이 가능하다 할 수 있습니다) 게놈에 위치 될 수있다 소개 모두 이득과 손실 기능 돌연변이 6. followiNG 프로토콜은 후보 암 유전자 (그림 1)을 식별하기 위해 SB transposon 시스템을 사용하여 앞으로 유전자 화면을 고안하고 실행하는 방법에 대해 설명합니다.

번식 체계가 설립 된 후, 브마다 19~21일 쓰레기를 생산해야합니다. 쓰레기 크기는 브 및 유전 배경의 연령에 따라, 5 사이 12 새끼를 달라집니다. 또한, 쓰레기의 유전자형이 번식 체계가 정확하고 성공적인 모두 있는지 확인하는 방법으로 Mendelian 유전학을 준수하는지 확인하십시오. 실험이 성공하기 위해서는 실험 동물의 종양 발병률은 제어 동물에서 종양 발생률보다 훨씬 커야한다. 더 &quot;predisposing&quot;돌연변이가 실험에 포함되지 않은 경우 제어 동물의 종양에 몇 가지가 있어야합니다. &quot;predisposing&quot;변이가 실험에 포함 된 경우,이 동물의 종양 발병률은 돌연변이와 SB 활동과 동물의 발생보다 훨씬 낮을 수 있습니다. LM-PCR은 단일 종양에 transposon의 삽입 수백 증폭해야합니다. 헥타르를 실행 한 후1 % 젤의 보조 PCR 제품의면이 증폭를 대표하는 DNA의 &quot;비방&quot;(그림 3)가 있어야합니다. 하나 또는 두 개의 밴드가있는 경우, SB 하나는 종양에 적극적으로되지 않았거나 오류가 (그림 4) 프로토콜에 만들어졌습니다. Illumina GAIIx 플랫폼의 단일 차선 1-200 종양 시퀀싱이 100 BP 각 (그림 5) 3 천만 시퀀스를 통해 생산해야합니다. 표 1. 시약 섹션 2 필요합니다. 표 2. 시약 섹션 3 필요합니다. 표 3. 시약 섹션 4 필요합니다. <img src="/files/ftp_upload/50156/50156fig1.jpg" alt="그림 1" fo:content-width="6in" fo:src="/files/ftp_upload/50156/50156fig1highres.jpg"/> 1 그림. 단계를 보여주는 플로우 차트잠자는 숲속의 미녀 시스템을 사용하여 앞으로 유전 화면을 수행 할 수 있습니다. 먼저, 마우스 모델이 생성됩니다. 죽어가는 그리고 종양이 수집 분리 할 때 마우스 그런 다음 necropsied 있습니다. 종양 DNA는 정화되고 링커 매개-PCR이 수행됩니다. 마지막으로, transposon의 삽입과 증폭 종양 DNA는 순서가 및 일반 삽입 사이트는 식별됩니다. <img src="/files/ftp_upload/50156/50156fig2.jpg" alt="그림 2"/> 그림 2. 실험 일대를 생성하는 방식을 사육. transposase (Rosa26-LsL-SB11)를 포함하는 마우스는 transposons (T2-ONC)의 concatamer을 품고 마우스에 발을 담그 있습니다. 자손 그런 다음 Cre Recombinase (Cre)를 구동 지정된 조직 특정 발기인을 들고 마우스로 결합되어 있습니다. <img src="/files/ftp_upload/50156/50156fig3.jpg" alt="그림 3"/> 그림 3. 대표하는차 PCR의 결과입니다. 예상 제품 외관은 100에서 600 기본 쌍에 이르기까지 같은 얼룩이 있습니다. <img src="/files/ftp_upload/50156/50156fig4.jpg" alt="그림 4"/> LM-PCR에 실패 할 경우 그림 4., DNA의 &#39;비방&#39;의 부재가있을 것입니다. 대신에, 당신은 DNA의 결정적인 밴드를 볼 수 있습니다. <img src="/files/ftp_upload/50156/50156fig5.jpg" alt="그림 5" fo:src="/files/ftp_upload/50156/50156fig5highres.jpg" fo:content-width="4.6in"/> Illumina GAIIx 플랫폼의 단일 차선을 보여 시퀀싱 실행에서 그림 5. 예를 들어 데이터 100 기본 쌍을 각각 3 천만 시퀀스를 통해 생산해야합니다.

Watch this Scientific Journal Video about Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR at JoVE.com

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

편견 접근법을 사용하여 발암의 알 수없는 드라이버를 식별하는 방법이 설명되어 있습니다. 방법은 사용<em&gt; 잠자는 숲속의 미녀</em특정 조직으로 이동하는 임의의 mutagen으로&gt; transposon. 종양 형성을 유도 transposon의 삽입의 게놈지도는 소설 oncogenes와 종양 억제 유전자를 식별

의 식별<em&gt; 잠자는 숲속의 미녀</em링커로 인한 PCR을 사용하여 고체 종양의&gt; Transposon의 삽입

Genomic, proteomic, transcriptomic, and epigenomic analyses of human tumors indicate that there are thousands of anomalies within each cancer genome ...

identification-sleeping-beauty-transposon-insertions-solid-tumors

Nanyang Technological University

Research

JoVE Journal

Medicine

Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

14.0K 조회수.  University of Minnesota, Minneapolis. 편견 접근법을 사용하여 발암의 알 수없는 드라이버를 식별하는 방법이 설명되어 있습니다. 방법은 사용 잠자는 숲속의 미녀 transposon. 종양 형성을 유도 transposon의 삽입의 게놈지도는 소설 oncogenes와 종양 억제 유전자를 식별

비디오: Identification of Sleeping Beauty Transposon Insertions in Solid Tumors using Linker-mediated PCR

Establishment and Propagation of Human Retinoblastoma Tumors in Immune Deficient Mice

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited time. These cultured tumorspheres may exhibit markedly different cellular phenotypes when compared to the original tumors. Demonstration that cultured cells have the capability of forming new tumors is important to ensure that cultured cells model the biology of the original tumor. 
Here we present a protocol for propagating human retinoblastoma tumors in vivo using Rag2-/- immune deficient mice. Cultured human retinoblastoma tumorspheres of low passage or cells obtained from freshly harvested human retinoblastoma tumors injected directly into the vitreous cavity of murine eyes form tumors within 2-4 weeks. These tumors can be harvested and either further passaged into murine eyes in vivo or grown as tumorspheres in vitro. Propagation has been successfully carried out for at least three passages thus establishing a continuing source of human retinoblastoma tissue for further experimentation. 
Wesley S. Bond and Lalita Wadhwa are co-first authors.

A method is described to propagate human retinoblastoma tumors in mice. Tumor cells are directly injected into the eyes of immune deficient mice. Secondary tumors have been successfully established using both cells directly harvested from human tumors and cultured tumorspheres.

면역 결함 마우스의 확립과 인간 Retinoblastoma 종양의 전파

Culturing retinoblastoma tumor cells in defined stem cell media gives rise to primary tumorspheres that can be grown and maintained for only a limited ...

연구

의학

Evaluation of Nanoparticle Uptake in Tumors in Real Time Using Intravital Imaging

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle uptake in tumors at the microscopic level1,2,3, highlighting the utility of a suitable xenograft model in which to perform detailed uptake analyses. Here, we use high-resolution intravital imaging to evaluate nanoparticle uptake in human tumor xenografts in a modified, shell-less chicken embryo model. The chicken embryo model is particularly well-suited for these in vivo analyses because it supports the growth of human tumors, is relatively inexpensive and does not require anesthetization or surgery 4,5. Tumor cells form fully vascularized xenografts within 7 days when implanted into the chorioallantoic membrane (CAM) 6. The resulting tumors are visualized by non-invasive real-time, high-resolution imaging that can be maintained for up to 72 hours with little impact on either the host or tumor systems. Nanoparticles with a wide range of sizes and formulations administered distal to the tumor can be visualized and quantified as they flow through the bloodstream, extravasate from leaky tumor vasculature, and accumulate at the tumor site. We describe here the analysis of nanoparticles derived from Cowpea mosaic virus (CPMV) decorated with near-infrared fluorescent dyes and/or polyethylene glycol polymers (PEG) 7, 8, 9,10,11. Upon intravenous administration, these viral nanoparticles are rapidly internalized by endothelial cells, resulting in global labeling of the vasculature both outside and within the tumor7,12. PEGylation of the viral nanoparticles increases their plasma half-life, extends their time in the circulation, and ultimately enhances their accumulation in tumors via the enhanced permeability and retention (EPR) effect 7, 10,11. The rate and extent of accumulation of nanoparticles in a tumor is measured over time using image analysis software. This technique provides a method to both visualize and quantify nanoparticle dynamics in human tumors.

We present a novel approach to quantify nanoparticle localization in the vasculature of human xenografted tumors using dynamic, real-time intravital imaging in an avian embryo model.

Intravital 이미징을 사용하여 실시간으로 종양의 Nanoparticle의 이해 평가

Current technologies for tumor imaging, such as ultrasound, MRI, PET and CT, are unable to yield high-resolution images for the assessment of nanoparticle ...

Heterogeneity Mapping of Protein Expression in Tumors using Quantitative Immunofluorescence

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of areas of distinct differentiation into recognized histological subtypes, or different pathological grade, often there are more subtle differences in phenotype which defy accurate classification (Figure 1). Ultimately, since morphology is dictated by the underlying molecular phenotype, areas with visible differences are likely to be accompanied by differences in the expression of proteins which orchestrate cellular function and behavior, and therefore, appearance. The significance of visible and invisible (molecular) heterogeneity for prognosis is unknown, but recent evidence suggests that, at least at the genetic level, heterogeneity exists in the primary tumor1,2, and some of these sub-clones give rise to metastatic (and therefore lethal) disease. 
Moreover, some proteins are measured as biomarkers because they are the targets of therapy (for instance ER and HER2 for tamoxifen and trastuzumab (Herceptin), respectively). If these proteins show variable expression within a tumor then therapeutic responses may also be variable. The widely used histopathologic scoring schemes for immunohistochemistry either ignore, or numerically homogenize the quantification of protein expression. Similarly, in destructive techniques, where the tumor samples are homogenized (such as gene expression profiling), quantitative information can be elucidated, but spatial information is lost. Genetic heterogeneity mapping approaches in pancreatic cancer have relied either on generation of a single cell suspension3, or on macrodissection4. A recent study has used quantum dots in order to map morphologic and molecular heterogeneity in prostate cancer tissue5, providing proof of principle that morphology and molecular mapping is feasible, but falling short of quantifying the heterogeneity. Since immunohistochemistry is, at best, only semi-quantitative and subject to intra- and inter-observer bias, more sensitive and quantitative methodologies are required in order to accurately map and quantify tissue heterogeneity in situ.
We have developed and applied an experimental and statistical methodology in order to systematically quantify the heterogeneity of protein expression in whole tissue sections of tumors, based on the Automated QUantitative Analysis (AQUA) system6. Tissue sections are labeled with specific antibodies directed against cytokeratins and targets of interest, coupled to fluorophore-labeled secondary antibodies. Slides are imaged using a whole-slide fluorescence scanner. Images are subdivided into hundreds to thousands of tiles, and each tile is then assigned an AQUA score which is a measure of protein concentration within the epithelial (tumor) component of the tissue. Heatmaps are generated to represent tissue expression of the proteins and a heterogeneity score assigned, using a statistical measure of heterogeneity originally used in ecology, based on the Simpson's biodiversity index7.
To date there have been no attempts to systematically map and quantify this variability in tandem with protein expression, in histological preparations. Here, we illustrate the first use of the method applied to ER and HER2 biomarker expression in ovarian cancer. Using this method paves the way for analyzing heterogeneity as an independent variable in studies of biomarker expression in translational studies, in order to establish the significance of heterogeneity in prognosis and prediction of responses to therapy.

Here we describe a method to quantify molecular heterogeneity in histological sections of tumor material using quantitative immunofluorescence, image analysis, and a statistical measure of heterogeneity. The method is intended for use in clinical biomarker development and analysis.

양적 Immunofluorescence를 사용하여 종양의 단백질 표현의 이질 매핑

Morphologic heterogeneity within an individual tumor is well-recognized by histopathologists in surgical practice. While this often takes the form of ...

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR (qPCR)

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process including development1, apoptosis2, and cell cycle regulation3. MiRNAs are estimated to regulate the expression of 30% to 90% of human genes4 by binding to their target messenger RNAs (mRNAs)5. Widespread dysregulation of miRNAs has been reported in various diseases and cancer subtypes6. Due to their prevalence and unique structure, these small molecules are likely to be the next generation of biomarkers, therapeutic agents and/or targets.
Methods used to investigate miRNA expression include SYBR green I dye- based as well as Taqman-probe based qPCR. If miRNAs are to be effectively used in the clinical setting, it is imperative that their detection in fresh and/or archived clinical samples be accurate, reproducible, and specific. qPCR has been widely used for validating expression of miRNAs in whole genome analyses such as microarray studies7. The samples used in this protocol were from patients who underwent radical prostatectomy for clinically localized prostate cancer; however other tissues and cell lines can be substituted in. Prostate specimens were snap-frozen in liquid nitrogen after resection. Clinical variables and follow-up information for each patient were collected for subsequent analysis8.
Quantification of miRNA levels in prostate tumor samples. The main steps in qPCR analysis of tumors are: Total RNA extraction, cDNA synthesis, and detection of qPCR products using miRNA-specific primers. Total RNA, which includes mRNA, miRNA, and other small RNAs were extracted from specimens using TRIzol reagent. Qiagen's miScript System was used to synthesize cDNA and perform qPCR (Figure 1). Endogenous miRNAs are not polyadenylated, therefore during the reverse transcription process, a poly(A) polymerase polyadenylates the miRNA. The miRNA is used as a template to synthesize cDNA using oligo-dT and Reverse Transcriptase. A universal tag sequence on the 5' end of oligo-dT primers facilitates the amplification of cDNA in the PCR step. PCR product amplification is detected by the level of fluorescence emitted by SYBR Green, a dye which intercalates into double stranded DNA. Specific miRNA primers, along with a Universal Primer that binds to the universal tag sequence will amplify specific miRNA sequences. 
The miScript Primer Assays are available for over a thousand human-specific miRNAs, and hundreds of murine-specific miRNAs. Relative quantification method was used here to quantify the expression of miRNAs. To correct for variability amongst different samples, expression levels of a target miRNA is normalized to the expression levels of a reference gene. The choice of a gene on which to normalize the expression of targets is critical in relative quantification method of analysis. Examples of reference genes typically used in this capacity are the small RNAs RNU6B, RNU44, and RNU48 as they are considered to be stably expressed across most samples. In this protocol, RNU6B is used as the reference gene.

MicroRNA Detection in Prostate Tumors by Quantitative Real-time PCR qPCR

Quantitative Real Time polymerase chain reaction (qPCR) is a rapid and sensitive method to investigate the expression levels of various microRNA (miRNA) molecules in tumor samples. Using this method expression of hundreds of different miRNA molecules can be amplified, quantified, and analyzed from the same cDNA template.

정량 실시간 PCR (qPCR)에 의한 전립선 종양에 MicroRNA 감지

MicroRNAs (miRNAs) are single-stranded, 18&#x2013;24 nucleotide long, non-coding RNA molecules. They are involved in virtually every cellular process ...

In vitro Organoid Culture of Primary Mouse Colon Tumors

Several human and murine colon cancer cell lines have been established, physiologic integrity of colon tumors such as multiple cell layers, basal-apical polarity, ability to differentiate, and anoikis are not maintained in colon cancer derived cell lines. The present study demonstrates a method for culturing primary mouse colon tumor organoids adapted from Sato T et al. 1, which retains important physiologic features of colon tumors. This method consists of mouse colon tumor tissue collection, adjacent normal colon epithelium dissociation, colon tumor cells digestion into single cells, embedding colon tumor cells into matrigel, and selective culture based on the principle that tumor cells maintain growth on limiting nutrient conditions compared to normal epithelial cells.
The primary tumor organoids if isolated from genetically modified mice provide a very useful system to assess tumor autonomous function of specific genes. Moreover, the tumor organoids are amenable to genetic manipulation by virus meditated gene delivery; therefore signaling pathways involved in the colon tumorigenesis could also be extensively investigated by overexpression or knockdown. Primary tumor organoids culture provides a physiologic relevant and feasible means to study the mechanisms and therapeutic modalities for colon tumorigenesis.

In vitro Organoid Culture of Primary Mouse Colon Tumors

A simple method to establish primary murine colon tumor organoid is described. This method utilizes the feature that colon tumor cells survive and grow into organoids in media containing limited growth factors, whereas normal colon epithelial do not.

기본 마우스 대장 종양의 체외 Organoid의 문화

Several  human and murine colon cancer cell lines have been established, physiologic  integrity of colon tumors such as multiple cell layers, basal-apical ...

Cerebrospinal Fluid MicroRNA Profiling Using Quantitative Real Time PCR

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their translational repression. Changes in miRNA expression have been shown to be involved in the development of all major complex diseases. Furthermore, recent findings showed that miRNAs can be secreted to the extracellular environment and enter the bloodstream and other body fluids where they can circulate with high stability. The function of such circulating miRNAs remains largely elusive, but systematic high throughput approaches, such as miRNA profiling arrays, have lead to the identification of miRNA signatures in several pathological conditions, including neurodegenerative disorders and several types of cancers. In this context, the identification of miRNA expression profile in the cerebrospinal fluid, as reported in our recent study, makes miRNAs attractive candidates for biomarker analysis.
There are several tools available for profiling microRNAs, such as microarrays, quantitative real-time PCR (qPCR), and deep sequencing. Here, we describe a sensitive method to profile microRNAs in cerebrospinal fluids by quantitative real-time PCR. We used the Exiqon microRNA ready-to-use PCR human panels I and II V2.R, which allows detection of 742 unique human microRNAs. We performed the arrays in triplicate runs and we processed and analyzed data using the GenEx Professional 5 software.
Using this protocol, we have successfully profiled microRNAs in various types of cell lines and primary cells, CSF, plasma, and formalin-fixed paraffin-embedded tissues.

We describe a protocol of real time PCR to profile microRNAs in the cerebrospinal fluid (CSF). With the exception of RNA extraction protocols, the procedure can be extended to RNA extracted from other body fluids, cultured cells, or tissue specimens.

정량 실시간 PCR을 사용하여 뇌척수액의 마이크로 RNA 프로파일

MicroRNAs (miRNAs) constitute a potent layer of gene regulation by guiding RISC to target sites located on mRNAs and, consequently, by modulating their ...

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent marker. Mouse models (brain tumor and arthritis) were used to evaluate the usefulness of this method. Saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles tagged with CellVue Maroon (CVM) fluorophore were administered intravenously. Animals were then placed in the rotational holder (MARS) of the in vivo imaging system. Images were acquired in 10&#176; steps over 380&#176;. A rectangular&#160;region of interest (ROI) was placed across the full image width at the model disease site. Within the ROI, and for every image, mean fluorescence intensity was computed after background subtraction. In the mouse models studied, the labeled nanovesicles were taken up in both the orthotopic and transgenic brain tumors, and in the arthritic sites (toes and ankles). Curve analysis of the multi angle image ROIs determined the angle with the highest signal. Thus, the optimal angle for imaging each disease site was characterized. The MAROI method applied to imaging of fluorescent compounds is a noninvasive, economical, and precise tool for in vivo quantitative analysis of the disease states in the described mouse models.

In Vivo Optical Imaging of Brain Tumors and Arthritis Using Fluorescent SapC-DOPS Nanovesicles

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo quantitation of a fluorescent marker delivered by saposin C (SapC)-dioleoylphosphatidylserine (DOPS) nanovesicles. Employing mouse models of cancer and arthritis, we demonstrate how the MAROI signal curve analysis can be used for the precise mapping and biological characterization of disease processes.

형광 SAPC-DOPS Nanovesicles을 사용하여 뇌 종양 및 관절염의 생체 광학 이미징

We describe a multi-angle rotational optical imaging (MAROI) system for in vivo monitoring of physiopathological processes labeled with a fluorescent ...

Quantitative Mass Spectrometric Profiling of Cancer-cell Proteomes Derived From Liquid and Solid Tumors

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic biomarkers. However, methods for quantitative proteomic characterization of patient-derived tumors and in particular their cellular subpopulations are largely lacking. Here we describe an experimental set-up that allows quantitative analysis of proteomes of cancer cell subpopulations derived from either liquid or solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry followed by bioinformatic data analysis. To enrich specific cellular subsets, liquid tumors are first immunophenotyped by flow cytometry followed by FACS-sorting; for solid tumors, laser-capture microdissection is used to purify specific cellular subpopulations. In a second step, proteins are extracted from the purified cells and subsequently combined with a tumor-specific, SILAC-labeled spike-in standard that enables protein quantification. The resulting protein mixture is subjected to either gel electrophoresis or Filter Aided Sample Preparation (FASP) followed by tryptic digestion. Finally, tryptic peptides are analyzed using a hybrid quadrupole-orbitrap mass spectrometer, and the data obtained are processed with bioinformatic software suites including MaxQuant. By means of the workflow presented here, up to 8,000 proteins can be identified and quantified in patient-derived samples, and the resulting protein expression profiles can be compared among patients to identify diagnostic proteomic signatures or potential drug targets.

In-depth analyses of cancer cell proteomes facilitate identification of novel drug targets and diagnostic biomarkers. We describe an experimental workflow for quantitative analysis of (phospho-)proteomes in cancer cell subpopulations derived from liquid and solid tumors. This is achieved by combining cellular enrichment strategies with quantitative Super-SILAC-based mass spectrometry.

액체 및 고체 종양 유래의 암세포 프로테옴 정량적 질량 분석 프로파일

In-depth analyses of cancer cell proteomes are needed to elucidate oncogenic pathomechanisms, as well as to identify potential drug targets and diagnostic ...

Spatial Measurements of Perfusion, Interstitial Fluid Pressure and Liposomes Accumulation in Solid Tumors

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and elevated IFP are linked to the heterogeneous intra-tumoral distribution of nanotechnology-based drug delivery systems such as liposomes. In the present study, the relationship between tumor microcirculation, elevated IFP, and accumulation of nanoparticles was investigated through in vivo experimentation. This was accomplished by evaluation of the tumor microcirculation using dynamic contrast enhanced computed tomography (DCE-CT) and measurement of tumor IFP using a novel image-guided robotic needle placement system connected to the micro-CT scanner. The intra-tumoral accumulation of liposomes was determined by CT image-based assessment of a nanoparticle liposomal formulation that stably encapsulate the contrast agent iohexol (CT-liposomes). CT imaging allowed for co-localization of the spatial distribution of tumor hemodynamics, IFP and CT-liposome accumulation in an individual subcutaneous xenograft mouse model of breast cancer. Measurements led to the discovery that perfusion and plasma volume fraction are strong mediators of the intra-tumoral distribution of liposomes. Furthermore, the results suggest that IFP plays an indirect role in mediating liposome distribution through modulating blood flow.

The heterogeneous intra-tumoral accumulation of liposomes has been linked to an abnormal tumor microenvironment. Herein methods are presented to measure tumor microcirculation by perfusion imaging and elevated interstitial fluid pressure (IFP) using an image-guided robotic system. Measurements are compared to the intra-tumoral accumulation of liposomes, determined using volumetric micro-CT imaging.

관류의 공간 측정, 고체 종양에 삽입 유체 압력과 리포좀 축적

The heterogeneous intra-tumoral accumulation of liposomes is a critical determinant of their efficacy. Both the chaotic tumor microcirculation and ...

Multicolor 3D Printing of Complex Intracranial Tumors in Neurosurgery

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. The model can be used for planning and simulating critical steps of a surgical approach. Therefore, it is important that anatomical structures such as blood vessels inside a tumor can be printed to be colored not only on their surface, but throughout their whole volume. During simulation this allows for the removal of certain parts (e.g., with a high-speed drill) and revealing internally located structures of a different color. Thus, diagnostic information from various imaging modalities (e.g., CT, MRI) can be combined in a single compact and tangible object.
However, preparation and printing of such a fully colored anatomical model remains a difficult task. Therefore, a step-by-step guide is provided, demonstrating the fusion of different cross-sectional imaging data sets, segmentation of anatomical structures, and creation of a virtual model. In a second step the virtual model is printed with volumetrically colored anatomical structures using a plaster-based color 3D binder jetting technique. This method allows highly accurate reproduction of patient-specific anatomy as shown in a series of 3D-printed petrous apex chondrosarcomas. Furthermore, the models created can be cut and drilled, revealing internal structures that allow for simulation of surgical procedures.

The protocol describes the fabrication of fully colored three-dimensional prints of patient-specific, anatomical skull models to be used for surgical simulation. The crucial steps of combining different imaging modalities, image segmentation, three-dimensional model extraction, and production of the prints are explained.

신경 외과에서 복잡한 두개내 종양의 다색 3D 프린팅

Three-dimensional (3D) printing technologies offer the possibility of visualizing patient-specific pathologies in a physical model of correct dimensions. ...

의 식별

요약

더 많은 비디오 탐색

이 비디오의 챕터