세포 유형과 발달 단계에 특정 프로파일에 부케 - Wollaston 실험실에서 작업은 유럽위원회 (European Commission)의 6 번째 프레임 워크 Progamme의 AGRON-OMICS 프로젝트 (부여 # LSHG-CT-2006-037704)에 의해 지원됩니다. 세포 유형 특정 프로파일에 기 포드의 연구소에서 일이 BBSRC 새로운 탐정 보조금 (BB/H019502/1)에 의해 지원됩니다. KC274와 KC464 Arabidopsis 라인 AAR 웹 (캠브리지 대학)에서 얻었다.

1. 원형질 세대 <ol><li> 면도날과 1mm 폭 스트립 (그림 1)에 수확 잎 자료와 컷. 최대 15 잎에 하나의 잎보다 더 많은을 포함하는 샘플은 쉽게 절단하기 전에 스택 할 수 있습니다. </li><li> 즉시 20 ML 솔루션을 포함 9cm 원형 페트리 접시에 잎 조각을 전송 (400 MM 마니 톨, 20 MM MES 하이드레이트, 20 MM KCl, 10 MM CaCl 2, 2 MM MgCl 2, 0.1 % BSA와 2.5 MM β-메르 캅토 에탄올, protoplasting 효소 (1.2 % 셀룰로오스 R-10, 0.6 % 셀룰로오스 RS와 0.4 % macerozyme R-10)와 RNase와 전사 억제제 (1 × ProtectRNA 10 μg / ML Actinomycin D) 등의 pH를 5.7)는, 부드럽게 잎 스트립을 분리하고 2 × 5 분에 침투 해를 진공 청소기. </li><li> 궤도 셰이커에 장소 페트리 접시 3-4 시간을위한 공간 온도와 원형질 90 RPM으로 설정합니다. <ol><li> 부화 동안 잎 스트립은 사용하여 서로 구분되어야합니다이분의 일 매시간 간격으로, 평면 핀셋으로 설정합니다. </li></ol></li><li> 50 ML 튜브에 70 μm 셀 스트레이너 (피셔 과학)를 놓고 살짝 통해 protoplasting 솔루션을 필터링합니다. 이 protoplasts이 통과 할 수 있도록하면서 체에 의해 유지 될 잎 스트립을 제거합니다. </li><li> 4 ML 솔루션 같은 체를 통해 조심스럽게 필터와 잎 스트립을 씻는다. </li><li> 둥근 바닥 튜브에 protoplasts를 전송하고 펠릿 protoplasts 5 분 300 XG에서 원형질 솔루션을 원심 분리기. </li><li> 부드럽게 protoplasts을 방해하지 않으면 서 많은 표면에 뜨는의 최대한을 대기음. </li><li> 5 분 300 XG에서 5 ML 솔루션 및 원심 분리기로 protoplasts을 씻는다. 표면에 뜨는 제거 </li><li> 파스퇴르 피펫 또는 컷 - 오프 P1000 팁을 사용하여 솔루션의 적절한 볼륨에 protoplasts을 Resuspend. </li></ol> 2. 리프 Protoplasts의 FACS </p&gt; <ol><li> 즉시 정렬하기 전에 함께 거리며 걷게 protoplasts을 피하기 위해 (비 절단) P1000 팁을 사용하여 protoplasts을 resuspend. </li><li> 50 μm filcon 필터 (BD Biosciences)를 통해 정렬 관에 protoplasts를 전송하고 셀 정렬의 노즐을 막힘 방지하기 위해 적절한 희석. protoplasts 20 PSI (집)와 21-21.5 PSI (샘플), 39.2 kHz에서의 주파수의 압력과 &lt;4000 (이러한 설정은 BD의 유입 셀 정렬에 최적의 아르의 행사 요금에 100 μm의 노즐을 사용하여 정렬됩니다 다른 셀 정렬 기계에 (BD Biosciences). 최적화 설정을 조정)을해야 할 수도 있습니다. </li><li> GFP 긍정적 인 protoplasts은 488 nm의 아르곤 레이저를 사용하고 30분의 580 대역 통과 필터 (오렌지) 대 40분의 530 대역 통과 필터 (녹색)의 출력을 플로팅 식별됩니다. GFP 긍정적 인 protoplasts이 높은 580 popu에서 530 낮은 / 낮은 580 인구 죽은 / 죽어 protoplasts와 부스러기가 아닌 GFP의 protoplasts과 함께 높은 530/low 580 인구에있을 것입니다lation (그림 2). <ol><li> RNA가 추출됩니다있는 protoplasts를 정렬 할 때 protoplasts은 환원제를 포함하는 용해 버퍼의 최소 4 볼륨 (예 : β-메르 캅토 에탄올)에 직접 정렬해야합니다. 또한, 단일 샘플의 정렬 시간이 20-30 분,하고 한 번에 처리 2-3 샘플 최대로 제한해야합니다. </li><li> 정렬 protoplasts의 시각화를 들어, protoplasts는 솔루션의 최소한 8 권과 이후 protoplasts을 집중 원심 분리에 의해 수집에 직접 정렬해야합니다. </li></ol></li></ol> 3. 대표 결과 이 프로토콜은 형광 활성화 세포 정렬 (그림 1)에 사용되는 Arabidopsis 잎에서 protoplasts을 얻기위한 방법을 설명합니다. RNase와 전사 억제제의 존재의 원형질를 생성 세포 (F)를 방지ROM이 전사 응답을 장착. 이 autofluorescence의 중요한 수준이 많이 죽었 죽어 protoplasts에 상승을주는의 결과가 않습니다. 이 방법으로 준비 protoplasts을 정렬 할 때이 정렬에 사용되는 580 nm의 대 530 나노 미터 형광 그래프의 여러 별개의 인구를 참조하는 것이 매우 일반적입니다. 함께이 프로토콜에서 사용되는 정렬 게이트와 함께의 예는 그림 3에 표시됩니다. Protoplasts는 솔루션의 8 권으로 정렬하여 농축을 확인하는 시각화를 위해 수집. 그림 2G는 경비 세포에 GFP를 표현 TP382 줄을 사용하여이의 예를 보여줍니다 할 수 있습니다. 이전과 증폭 후 모두이 방법을 사용하여 얻을 수 수율의 예는 표 1에 표시됩니다. 얻은 금액은 박수 피코 WTA 시스템 (500 PG-50 NG), 따라서 S를 사용하여 증폭에 충분한qPCR에 의해 ubsequent 분석 (그림 4), 차세대 시퀀싱 또는 microarray. <img alt="그림 1" src="/files/ftp_upload/4214/4214fig1.jpg" /> 그림 1. 실험 전체 워크 플로우. 1) 수확은 Arabidopsis 라인을 표현 GFP에서 관심을 출발합니다. 2) 신속하게 ~ 1mm 폭 스트립에 잘라 즉시 protoplasting 솔루션과 진공 침투에 다음을 전송할 수 있습니다. 3) 3-4 시간에 품다. 4) 70 μm의 체를 통해 조심스럽게 여과 원형질 솔루션, 원심 분리하여 아래쪽 튜브 및 펠릿의 protoplasts 반올림하기 위해 전송할 수 있습니다. 5) 바로 정렬하기 전에, 50 μm를 통해 resuspend protoplasts 및 정렬 튜브로 전송 필터입니다. 6) 정렬 GFP 긍정적 GFP 부정적인 가능한 protoplasts. 7) Protoplasts 지금은 어느 시각적 분석 또는 qPCR, 차세대 시퀀싱이나 microarray 등의 기술을 사용 할 수 있습니다. 그림 2. 본 연구에 사용 된 KC464, KC274 및 TP382 라인. adaxial 표피에 GFP 표현을 보여주는 KC464 잎 A) 가로 절을 참조하십시오. B) Protoplasts는 KC464 잎에서 파생. vasculature에 GFP 표현을 보여주는 KC274 잎 C) 가로 절을 참조하십시오. D KC274 잎에서 파생) Protoplasts. E) TP382 잎은 경비 세포에 GFP 식을 보여주고 있습니다. F) Protoplasts는 TP382 잎에서 파생. TP382 잎에서 파생 protoplasts의 높은 530/low 580 인구에서 protoplasts을 포함 GFP를 보여주는 잎 세포의 복잡한 배경에서 가드 셀을 표현 GFP의 FACS하여 얻은 농축의 G) 예. AF : 공 촛점 현미경 이미지, G : 형광 현미경 이미지입니다. 이미지 내의 스케일 바는 50 μm이다. <img alt="그림 3" src="/files/ftp_upload/4214/4214fig3.jpg" /><html> 그림 3. 30분의 580 나노 미터 (오렌지) 대 40분의 530 나노 미터 (녹색) 대역 통과 필터 (BD의 유입 셀 정렬)에서 출력의 일반 FACS 수집 도트 플롯. 표시된 정렬 문은 일반적으로 정렬하는 동안 사용되는 수 있습니다. 하나의 낮은 530/low 580 인구를 보여주는 억제제의 부재에 protoplasted 콜-4 잎 유래 protoplasts,의 A) 점 플롯. 때문에 에페드린에 의한 스트레스와 색채에 580 형광의 변화를 보여주는 억제제의 존재에 protoplasted 중량 콜-4 잎 유래 protoplasts,에서 B) 점 플롯. 높은 530/low 580 인구의 인구를 포함하는 GFP를 보여주는 억제제의 존재에 protoplasted 각각 KC74, KC464 및 TP382 라인,,,의 잎 파생 protoplasts에서 CE) 다트 플롯. GFP (높은 530/low 580) 인구의 이벤트의 비율이 주어집니다. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/4214/4214fig3large.jpg" target="_blank">큰 그림을 보려면 여기를 클릭하십시오</a> . e_content &quot;강한 : 유지 - together.within 페이지 =&quot;항상 &quot;&gt; <img alt="그림 4" src="/files/ftp_upload/4214/4214fig4.jpg" /> 그림 4. 그림 3과 같이 대표 출입을 금지 인구 분수에서 GFP를 표현. 복제 두 생물 그 다음 수행 된 GFP 특정 프리 머 (표 2)를 사용하여 박수 피코 WTA 시스템 및 qPCR을 사용하여 증폭, 각 분획 유형에 취득했다. 표시 값은 최고 (빨간색), 낮은 (녹색) 및 평균 상대 값입니다. 높은 580 인구가 두 분할이 경우에 있었고, 낮은 530/low 580과 하나의 생물 복제 만이 하나의 값이 표시 될 수 있도록 사용 된 높은 530/low 580. ACT2 (At3g18780)는 모든 샘플에 대한 표준으로 사용되었다. 잎 : 전체 잎. 정렬되지 않은 : 정렬되지 않은 protoplasts. GFP1 : 높은 530/low 580과 Rest1 : 낮은 530/low 580, GFP2 : 높은 530/high 580과 Rest2 : 그림 3과 삽입에 설명 된 낮은 530/high 580. 결과는 확인 O 아르정렬 분수 (예 : 그림 2G)에 GFP 셀 내용의 F 광학 평가는. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/4214/4214fig4large.jpg" target="_blank">큰 그림을 보려면 여기를 클릭하십시오</a> . <table border="1"><tbody><tr><td> 견본 </td><td> 잎의 번호 </td><td> 셀의 번호 </td><td> 수율 RNA (NG) </td><td> 수율 RNA (증폭, NG) </td></tr><tr><td> 전체 잎 전체 잎 B </td><td> 1 1 </td><td> - - </td><td> 8001 10,525 </td><td> 4623 *** 4572 *** </td></tr><tr><td> 정렬되지 않은 protoplasts 정렬되지 않은 protoplasts의 B </td><td> 5 5 </td><td> - - </td><td> 2433 2625 </td><td> 1152 *** 3321 *** </td></tr><tr><td> GFP1 Rest1 </td><td> 15 </td><td> 6039 (0.39 % *) 55,389 (6.40% *) </td><td> - ** - ** </td><td> 861 489 </td></tr><tr><td> GFP1 B Rest1 B </td><td> 15 </td><td> 10,783 (0.63 % *) 57,040 (7.49 % *) </td><td> - ** - ** </td><td> 537 420 </td></tr><tr><td> GFP2 Rest2 </td><td> 15 </td><td> 18,337 (1.49 % *) 62,405 (73.49 % *) </td><td> - ** - ** </td><td> 360 411 </td></tr></tbody></table> 표 1. 샘플 FACS를 사용하여 수집 및 라이브 GFP-표현 protoplasts를 포함하는 분획 결정하는 qPCR으로 분석했다. 또한 박수 피코 WTA 시스템 (NuGen)와 증폭 전후 NG의 총 RNA 수율은이 표에 포함되어 있습니다. GFP1, GFP2, Rest1 및 Rest2 분수가 그림 4의 삽입에 표시됩니다. 전체 셀 정렬 실행의 세포의 *의 비율은 분수에있는 셀의 수를 옆에 괄호에 있습니다. 이 비율은에 상관하지 않습니다FACS 정렬은 &#39;휴식&#39;분수에 대한 실행 각 샘플에 대한 각 다른 하나는 이전 수집 화장실 세포의 훨씬 더 많기 때문에 GFP의 분수에 비해 중지되었습니다. 제조업체의 프로토콜에 따라 증폭 반응에 대한 입력으로 사용 ** 50 NG. <table border="1"><tbody><tr><td> 뇌관 </td><td> 순서 </td></tr><tr><td> mGFP5 - ER.fw </td><td> GCCTGAGGGATACGTGCAGGAGA </td></tr><tr><td> mGFP5 - ER.rv </td><td> TGGCGGGTCTTGAAGTTGGCT </td></tr><tr><td> ACT2.fw </td><td> GCCATCCAAGCTGTTCTCTC </td></tr><tr><td> ACT2.rv </td><td> GCCATCCAAGCTGTTCTCTC </td></tr></tbody></table> 표 2. qPCR의 프리 머.

<ol>
	<li>Efroni, I., Eshed, Y., Lifschitz, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphogenesis+of+Simple+and+Compound+Leaves:+A+Critical+Review.">Morphogenesis of Simple and Compound Leaves: A Critical Review.</a> Plant Cell. 22, 1019-1032 (2010).</li><li>Kleber, R., Kehr, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Preparation+and+Quality+Assessment+of+RNA+From+Cell-Specific+Samples+Obtained+by+Laser+Microdissection.">Preparation and Quality Assessment of RNA From Cell-Specific Samples Obtained by Laser Microdissection.</a> Methods Mol. Biol. 323, 367-377 (2006).</li><li>Birnbaum, K., Shasha, D. E., Wang, J. Y., Jung, J. W., Lamberts, G. M., Galbraith, D. W., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Gene+Expression+Map+of+the+Arabidopsis+root.">A Gene Expression Map of the Arabidopsis root.</a> Science. 302, 1956-1960 (2003).</li><li>Warnasooriya, S. N., Montgomery, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Investigating+Tissue-+and+Organ-specific+Phytochrome+Responses+using+FACS-assisted+Cell-type+Specific+Expression+Profiling+in+Arabidopsis+thaliana.">Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana.</a> J. Vis. Exp. (39), e1925 (2010).</li><li>Beal, R. B., Henikoff, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Simple+Method+For+Gene+Expression+and+Chromatin+Profiling+of+Individual+Cell+Types+Within+a+Tissue.">A Simple Method For Gene Expression and Chromatin Profiling of Individual Cell Types Within a Tissue.</a> Dev. Cell. 18, 1030-1040 (2010).</li><li>Mustroph, A., Zanetti, M. E., Jang, C. J. H., Holtan, H. E., Repetti, P. P., Galbraith, D. W., Girke, T., Bailey-Serres, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Profiling+translatomes+of+discrete+cell+populations+resolves+altered+cellular+priorities+during+hypoxia+in+Arabidopsis.">Profiling translatomes of discrete cell populations resolves altered cellular priorities during hypoxia in Arabidopsis.</a> PNAS. 106, 18843-18848 (2009).</li><li>Brady, S. M., Orlando, D. A., Lee, J. Y., Wang, J. Y., Koch, J., Dinneny, J. R., Mace, D., Ohler, U., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dominant+Root+Expression+Patterns+Revealed+in+a+High-Resolution+Spatiotemporal+Expression+Map.">Dominant Root Expression Patterns Revealed in a High-Resolution Spatiotemporal Expression Map.</a> Science. 318, 801-806 (2007).</li><li>Gifford, M. L., Dean, A., Gutierrez, R. A., Coruzzi, G. M., Birnbaum, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-specific+nitrogen+responses+mediate+developmental+plasticity.">Cell-specific nitrogen responses mediate developmental plasticity.</a> PNAS. 105, 803-808 (2008).</li><li>Dinneny, J. R., Long, T. A., Wang, J. Y., Jung, J. W., Mace, D., Pointer, S., Barron, C., Brady, S. M., Schiefelbein, J., Benfey, P. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+identity+mediates+the+response+of+Arabidopsis+roots+to+abiotic+stress.">Cell identity mediates the response of Arabidopsis roots to abiotic stress.</a> Science. 320, 942-945 (2008).</li><li>Peterson, S. V., Johansson, A. I., Kowalczyk, M., Makoveychuk, A., Wang, J. Y., Moritz, T., Grebe, M., Benfey, P. N., Sandberg, G., Ljung, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Auxin+Gradient+and+Maximum+in+the+Arabidopsis+Root+Apex+Shown+by+High-Resolution+Cell-Specific+Analysis+of+IAA+Distribution+and+Synthesis.">An Auxin Gradient and Maximum in the Arabidopsis Root Apex Shown by High-Resolution Cell-Specific Analysis of IAA Distribution and Synthesis.</a> Plant Cell. 21, 1659-1668 (2009).</li><li>Yadav, R. K., Girke, T., Pasala, S., Xie, M., Reddy, G. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+map+of+the+Arabidopsis+shoot+apical+meristem+stem+cell+niche.">Gene expression map of the Arabidopsis shoot apical meristem stem cell niche.</a> PNAS. 106, 4941-4946 (2009).</li><li>Harkins, K. R., Jefferson, R. A., Kavanagh, T. A., Bevan, M. W., Galbraith, D. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+photosynthesis-related+gene+fusions+is+restricted+by+cell+type+in+transgenic+plants+and+in+transfected+protoplasts.">Expression of photosynthesis-related gene fusions is restricted by cell type in transgenic plants and in transfected protoplasts.</a> PNAS. 87, 816-820 (1990).</li><li>Yang, Y., Costa, A., Leonhardt, N., Siegel, R. S., Schroeder, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+strong+Arabidopsis+guard+cell+promoter+and+it's+potential+as+a+research+tool.">Isolation of a strong Arabidopsis guard cell promoter and it's potential as a research tool.</a> Plant Methods. 4, 6 (2008).</li><li>Gardner, M. J., Baker, A. J., Assie, J. -. M., Poethig, R. S., Haseloff, J. P., Webb, A. A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=GAL4+GFP+enhancer+trap+lines+for+analysis+of+stomatal+guard+cell+development+and+gene+expression.">GAL4 GFP enhancer trap lines for analysis of stomatal guard cell development and gene expression.</a> J. Exp. Bot. 60, 213-226 (2009).</li></ol>

관심 없음 충돌이 선언 없습니다.

우리는 원형질 생성 및 FACS를 사용하여 후속 셀 정렬의 잎에 GFP를 표현 Arabidopsis 식물의 사용을 허용하는 방법을 설명합니다. 이 방법은 qPCR 또는 microarray에 의해 증폭, 따라서 이후의 분석에 사용되는 RNA의 충분한 양을 산출. 정렬 분수가 높은 등의 qPCR (그림 2)에 의해 증명 GFP 함유 세포에 풍부합니다. 잎 스트립 억제제가 함유 원형질 솔루션으로 침투 진공 될 때까지 라이브 protoplasts의 높은 수율을 달성하려면이 프로 시저의 초기 단계에서 신속하게 작동하는 것이 중요합니다. 또한, 1mm의 잎 스트립을 생성 할 때이 과도한 손상되므로 낮은 원형질 수율로 연결로, 잎보다는 &#39;고기&#39;또는 매시업을 갈라하거나 잘라서하는 것이 매우 중요합니다. 방법 사이의 중요한 차이는 여기와 다른 publishe 설명D 방법은 RNase 억제제와 전사 억제제를 사용하는 것입니다. 대부분의 방법은 protoplasts이 더 쉽게 생성 할 수있는 Arabidopsis 뿌리, 개발하고 있습니다. 그러나, mesophyll을 제외한, 잎과 함께 작업 할 때,이 원형질 생성 시간을 증가 할 필요가 있습니다. 따라서 원형질 생성 처리 자체 (데이터가 표시되지 않음)의 결과로 유전자 발현의 변화로부터 보호하기 위해 이러한 억제제를 포함하는 것이 중요합니다. 그러나 억제제의 존재이의 스트레스에 대응하기 위해되는 소성의 손실로 연결로 protoplasts 더 취약해질 가능성이 오프에 유전자 이상을, 전환하여하거나, 전사 반응을 마운트 할 수 없다는로 연결 절차를 protoplasting. 우리는 GFP-표현 Arabidopsis 라인의 번호를 성공적으로 여기에서 설명한 방법을 사용했습니다. 중요한 것은, 우리는 GFP 라인에서 또는 강력 GFP를 표현과 함께이 방법을 사용했습니다핵, 또는 더 약하게 non-localized/diffuse cytosolic 방식으로는 여기를 사용 KC464와 KC274 선 경우가 있습니다. 라인의 두 종류가 방법과 호환하고 GFP-표현 protoplasts의 매우 풍부한 분수 (그림 2, 3)을 얻을 수 있습니다. 형광이 죽은 / 죽어 세포의 autofluorescence 라이브 셀을 선택 할 수있는 능력을 유지하기 위해 크게 다를 수 있습니다 형광 선택해야합니다 있지만 방법은 쉽게 다른 fluorophores에 적용 할 수 있습니다.

<table border="1"><tbody><tr><td> 시약의 이름 </td><td> 회사 </td><td> 카탈로그 번호 </td></tr><tr><td> Cellulase R-10 </td><td> Melford </td><td> C8001 </td></tr><tr><td> Cellulase RS </td><td> Melford </td><td> C8003 </td></tr><tr><td> Macerozyme R-10 </td><td> Melford </td><td> M8002 </td></tr><tr><td> BSA </td><td> 시그마 - 알드리치 </td><td> A3912 </td></tr><tr><td> ProtectRNA </td><td> 시그마 - 알드리치 </td><td> R7397 </td></tr><tr><td> Actinomycin D </td><td> 시그마 - 알드리치 </td><td> A1410 </td></tr><tr><td> 70 μm 셀 스트레이너 </td><td> 어부 </td><td> FB35181 </td></tr><tr><td> 50 μm filcon 컵 타입의 필터 </td><td> BD Biosciences </td><td> 340630 </td></tr></tbody></table>

cell specific analysis of arabidopsis leaves using fluorescence activated cell sorting

잎 primordium의 개시 후, 바이오 매스 축적은 주로 세포 증식과 잎 1 확장에 의해 제어됩니다. 그러나, Arabidopsis 잎은 다양한 세포 유형과 여러 구조로 구성 복잡한 기관이다. 동시에 성장하는 잎은 확장을 중단하고 노화 1 받아야 할 첫 번째되는 잎자루에서 먼 세포로, 개발의 여러 단계에서 세포를 포함하고 있습니다. 잎 내의 다른 세포는 따라서 나누어 elongating 또는 구별되며, 적극적인 스트레스 나 죽어, 및 / 또는 한 번에 자신의 세포 유형의 하위 세트의 자극에 반응. 이것은 잎 도전의 게놈 연구를합니다 : 예를 들어 서로 다른 세포 반응 영역 또는 셀 유형에서 작동 유전자 네트워크에서 전체 잎, 신호의 표현 데이터를 분석 할 때 실마리를 못 찾고됩니다 생성 된 부정확 한 프로필에서 결과. 이 문제를 해결하려면, Several 방법은 세포 특정 유전자 발현 연구를 활성화하는 설명되어 있습니다. 이러한 레이저 캡처 microdissection (LCM) 2 또는 원형질 생성 및 후속 형광 활성화 셀 정렬 (FACS) 3,4, 핵 강수량 5 polysomes 6 immunoprecipitation의 최근 설명 그대로 시스템에 사용되는 GFP 표현 식물이 포함되어 있습니다. FACS이 성공적으로 루트 팁에서 셀 정체성과 거리가 유전자 3,7 다수의 표현의 프로필에 큰 효과가 있다는 표시 등의 연구 숫자에 사용되었습니다. GFP 라인의 FACS는 루트 질소 반응 및 측면 루트 개발 8, 소금 스트레스 루트 10 9 옥신 분포 동안 세포 특정 전사 조절을 설명하고 Arabidopsis 촬영 꼭대기 분열 조직 (11)의 유전자 발현지도를 생성하는 데 사용되었습니다. 이기는하지만FACS는 이전에 autofluorescence 12,13에 따라 Arabidopsis 잎 파생 protoplasts을 정렬하는 데 사용되었습니다 잎에 GFP를 표현 Arabidopsis 줄에 FACS의 지금까지 사용 4 매우 제한된있다. 다음과 같은 프로토콜에서 우리는 원형질 생성 정권의 영향을 최소화하면서 FACS와 호환되는 Arabidopsis 잎 protoplasts를 획득하는 방법을 설명합니다. 우리는 혈관 조직 14 TP382 Arabidopsis 라인에 명시 GFP는 두 GFP를 표현 adaxial 표피 14 KC274 라인에 명시 GFP가의 핵 지방화 신호에 연결된 개념 KC464 Arabidopsis 라인을 사용하는 방법을 보여줍니다 경비 세포 (데이터 표시되지 않습니다, 그림 2). 현재 노화의 여러 단계에서 두 세포 유형의 개발과 스트레스 기간 동안 특정 표현뿐만 아니라 이기종 셀 인구를 공부하기 위해이 방법을 사용하는.

Watch this Scientific Journal Video about Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting at JoVE.com

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

생산하기위한 방법<em&gt; Arabidopsis</em&gt; 특정 세포 집단의 연구에 대한 허용, 형광 활성화 셀 정렬 (FACS)와 호환되는 잎 protoplasts. 이 방법은 어떤과 ​​호환됩니다<em&gt; Arabidopsis</em세포의 일부에서 GFP를 표현&gt; 줄입니다.

의 세포 구체적인 분석<em&gt; Arabidopsis</em&gt; 형광 활성화 셀 정렬을 사용하여 잎

After initiation of the leaf primordium, biomass accumulation is controlled mainly by cell proliferation and expansion in the leaves1. However, the ...

cell-specific-analysis-arabidopsis-leaves-using-fluorescence

Research

JoVE Journal

Biology

Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

15.2K 조회수.  University of Warwick. 생산하기위한 방법 Arabidopsis 특정 세포 집단의 연구에 대한 허용, 형광 활성화 셀 정렬 (FACS)와 호환되는 잎 protoplasts. 이 방법은 어떤과 ​​호환됩니다 Arabidopsis 줄입니다.

비디오: Cell Specific Analysis of Arabidopsis Leaves Using Fluorescence Activated Cell Sorting

Fluorescence Activated Cell Sorting of Plant Protoplasts

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental stimuli in any multicellular organism. In situ hybridization and reporter gene visualization can to a limited extent be used to this end but for high resolution quantitative RT-PCR or high-throughput transcriptome-wide analysis the isolation of RNA from particular cell types is requisite. Cellular dissociation of tissue expressing a fluorescent protein marker in a specific cell type and subsequent Fluorescence Activated Cell Sorting (FACS) makes it possible to collect sufficient amounts of material for RNA extraction, cDNA synthesis/amplification and microarray analysis.
An extensive set of cell type-specific fluorescent reporter lines is available to the plant research community. In this case, two marker lines of the Arabidopsis thaliana root are used: PSCR::GFP (endodermis and quiescent center) and PWOX5::GFP (quiescent center). Large numbers (thousands) of seedlings are grown hydroponically or on agar plates and harvested to obtain enough root material for further analysis. Cellular dissociation of plant material is achieved by enzymatic digestion of the cell wall. This procedure makes use of high osmolarity-induced plasmolysis and commercially available cellulases, pectinases and hemicellulases to release protoplasts into solution.
FACS of GFP-positive cells makes use of the visualization of the green versus the red emission spectra of protoplasts excited by a 488 nm laser. GFP-positive protoplasts can be distinguished by their increased ratio of green to red emission. Protoplasts are typically sorted directly into RNA extraction buffer and stored for further processing at a later time.
This technique is revealed to be straightforward and practicable. Furthermore, it is shown that it can be used without difficulty to isolate sufficient numbers of cells for transcriptome analysis, even for very scarce cell types (e.g. quiescent center cells). Lastly, a growth setup for Arabidopsis seedlings is demonstrated that enables uncomplicated treatment of the plants prior to cell sorting (e.g. for the cell type-specific analysis of biotic or abiotic stress responses). Potential supplementary uses for FACS of plant protoplasts are discussed.

A method for isolating specific cell types from plant material is demonstrated. This technique employs transgenic marker lines expressing fluorescent proteins in particular cell types, cellular dissociation and Fluorescence Activated Cell Sorting. Additionally, a growth setup is established here that facilitates treatment of Arabidopsis thaliana seedlings prior to cell sorting.

식물 Protoplasts의 형광 활성 세포 정렬

High-resolution, cell type-specific analysis of gene expression greatly enhances understanding of developmental regulation and responses to environmental ...

연구

생물학

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called photoreceptors to sense and adapt to light. The red/far-red light-absorbing phytochrome photoreceptors have been studied extensively. Phytochromes exist as a family of proteins with distinct and overlapping functions in all higher plant systems in which they have been studied1. Phytochrome-mediated light responses, which range from seed germination through flowering and senescence, are often localized to specific plant tissues or organs2. Despite the discovery and elucidation of individual and redundant phytochrome functions through mutational analyses, conclusive reports on distinct sites of photoperception and the molecular mechanisms of localized pools of phytochromes that mediate spatial-specific phytochrome responses are limited. We designed experiments based on the hypotheses that specific sites of phytochrome photoperception regulate tissue- and organ-specific aspects of photomorphogenesis, and that localized phytochrome pools engage distinct subsets of downstream target genes in cell-to-cell signaling. We developed a biochemical approach to selectively reduce functional phytochromes in an organ- or tissue-specific manner within transgenic plants. Our studies are based on a bipartite enhancer-trap approach that results in transactivation of the expression of a gene under control of the Upstream Activation Sequence (UAS) element by the transcriptional activator GAL43. The biliverdin reductase (BVR) gene under the control of the UAS is silently maintained in the absence of GAL4 transactivation in the UAS-BVR parent4. Genetic crosses between a UAS-BVR transgenic line and a GAL4-GFP enhancer trap line result in specific expression of the BVR gene in cells marked by GFP expression4. BVR accumulation in Arabidopsis plants results in phytochrome chromophore deficiency in planta5-7. Thus, transgenic plants that we have produced exhibit GAL4-dependent activation of the BVR gene, resulting in the biochemical inactivation of phytochrome, as well as GAL4-dependent GFP expression. Photobiological and molecular genetic analyses of BVR transgenic lines are yielding insight into tissue- and organ-specific phytochrome-mediated responses that have been associated with corresponding sites of photoperception4, 7, 8. Fluorescence Activated Cell Sorting (FACS) of GFP-positive, enhancer-trap-induced BVR-expressing plant protoplasts coupled with cell-type-specific gene expression profiling through microarray analysis is being used to identify putative downstream target genes involved in mediating spatial-specific phytochrome responses. This research is expanding our understanding of sites of light perception, the mechanisms through which various tissues or organs cooperate in light-regulated plant growth and development, and advancing the molecular dissection of complex phytochrome-mediated cell-to-cell signaling cascades.

Investigating Tissue- and Organ-specific Phytochrome Responses using FACS-assisted Cell-type Specific Expression Profiling in Arabidopsis thaliana

The molecular basis of spatial-specific phytochrome responses is being investigated using transgenic plants that exhibit tissue- and organ-specific phytochrome deficiencies. The isolation of specific cells exhibiting induced phytochrome chromophore depletion by Fluorescence-Activated Cell Sorting followed by microarray analyses is being utilized to identify genes involved in spatial-specific phytochrome responses.

에서 외과를 이용한 셀 타입 특정 표현식 프로파일을 사용하여 조직 및 장기 특정 Phytochrome 응답 조사 Arabidopsis thaliana</em

Light mediates an array of developmental and adaptive processes throughout the life cycle of a plant. Plants utilize light-absorbing molecules called ...

Heterokaryon Technique for Analysis of Cell Type-specific Localization

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling. These proteins display a diverse array of cellular functions including nuclear import/export of RNA and protein, transcriptional regulation, and apoptosis. Interestingly, major cellular reorganizations including cell division, differentiation and transformation, often involve such activities3,4,8,10. The detailed study of these proteins and their respective regulatory mechanisms can be challenging as the stimulation for these localization changes can be elusive, and the movements themselves can be quite dynamic and difficult to track. Studies involving cellular oncogenesis, for example, continue to benefit from understanding pathways and protein activities that differ between normal primary cells and transformed cells6,7,11,12. As many proteins show altered localization during transformation or as a result of transformation, methods to efficiently characterize these proteins and the pathways in which they participate stand to improve the understanding of oncogenesis and open new areas for drug targeting.
Here we present a method for the analysis of protein trafficking and shuttling activity between primary and transformed mammalian cells. This method combines the generation of heterokaryon fusions with fluorescence microscopy to provide a flexible protocol that can be used to detect steady-state or dynamic protein localizations. As shown in Figure 1, two separate cell types are transiently transfected with plasmid constructs bearing a fluoroprotein gene attached to the gene of interest. After expression, the cells are fused using polyethylene glycol, and protein localizations may then be imaged using a variety of methods. The protocol presented here is a fundamental approach to which specialized techniques may be added.

A flexible and efficient method for the characterization of cell type-specific protein localization and nucleocytoplasmic shuttling is described. This heterokaryon approach uses fluorescently-labeled fusion proteins to image protein localizations after cell fusion. The protocol is amenable to steady-state localizations or more dynamic determinations based on live cell imaging.

셀 유형 - 구체적인 현지화의 분석을 위해 Heterokaryon 기법

A significant number of proteins are regulated by subcellular trafficking or nucleocytolasmic shuttling.  These proteins display a diverse array of ...

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting (LIMACS): a Novel Method to Analyze Protein-lipid Interaction

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification procedures. As an alternative, lipids can be coated on flat surfaces as used for lipid ELISA and Plasmon resonance spectroscopy. However, surface coating lipids do not form microdomain structures, which may be important for the lipid binding properties. Further, these methods do not allow for the purification of larger amounts of proteins binding to their target lipids.
 To overcome these limitations of testing lipid protein interaction and to purify lipid binding proteins we developed a novel method termed lipid vesicle-mediated affinity chromatography using magnetic-activated cell sorting (LIMACS). In this method, lipid vesicles are prepared with the target lipid and phosphatidylserine as the anchor lipid for Annexin V MACS. Phosphatidylserine is a ubiquitous cell membrane phospholipid that shows high affinity to the protein Annexin V. Using magnetic beads conjugated to Annexin V the phosphatidylserine-containing lipid vesicles will bind to the magnetic beads. When the lipid vesicles are incubated with a cell lysate the protein binding to the target lipid will also be bound to the beads and can be co-purified using MACS. This method can also be used to test if recombinant proteins reconstitute a protein complex binding to the target lipid. 
 We have used this method to show the interaction of atypical PKC (aPKC) with the sphingolipid ceramide and to co-purify prostate apoptosis response 4 (PAR-4), a protein binding to ceramide-associated aPKC. We have also used this method for the reconstitution of a ceramide-associated complex of recombinant aPKC with the cell polarity-related proteins Par6 and Cdc42. Since lipid vesicles can be prepared with a variety of sphingo- or phospholipids, LIMACS offers a versatile test for lipid-protein interaction in a lipid environment that resembles closely that of the cell membrane. Additional lipid protein complexes can be identified using proteomics analysis of lipid binding protein co-purified with the lipid vesicles.

Lipid Vesicle-mediated Affinity Chromatography using Magnetic Activated Cell Sorting LIMACS: a Novel Method to Analyze Protein-lipid Interaction

To test the interaction of a protein with its target lipid we used MACS and Annexin V-conjugated magnetic beads and lipid vesicles synthesized from the target lipid and Annexin V-binding phosphatidylserine. Proteins bound to the target lipid are co-purified and analyzed after elution from the beads.

자기 활성 셀 정렬 (LIMACS)를 사용하여 지질 소포 - 중재 동질 크로마 토그래피 : 단백질 지질 상호 작용을 분석하는 소설 방법

The analysis of lipid protein interaction is difficult because lipids are embedded in cell membranes and therefore, inaccessible to most purification ...

Bromodeoxyuridine (BrdU) Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification of bacterial taxa that transform specific pools of DOC in nature poses a technical challenge. 
Here we describe an approach that couples bromodeoxyuridine (BrdU) incorporation, fluorescence activated cell sorting (FACS), and 16S rRNA gene-based molecular analysis that allows culture-independent identification of bacterioplankton capable of degrading a specific DOC compound in aquatic environments. Triplicate bacterioplankton microcosms are set up to receive both BrdU and a model DOC compound (DOC amendments), or only BrdU (no-addition control). BrdU substitutes the positions of thymidine in newly synthesized bacterial DNA and BrdU-labeled DNA can be readily immunodetected 1,2. Through a 24-hr incubation, bacterioplankton that are able to use the added DOC compound are expected to be selectively activated, and therefore have higher levels of BrdU incorporation (HI cells) than non-responsive cells in the DOC amendments and cells in no-addition controls (low BrdU incorporation cells, LI cells). After fluorescence immunodetection, HI cells are distinguished and physically separated from the LI cells by fluorescence activated cell sorting (FACS) 3. Sorted DOC-responsive cells (HI cells) are extracted for DNA and taxonomically identified through subsequent 16S rRNA gene-based analyses including PCR, clone library construction and sequencing.

Bromodeoxyuridine BrdU Labeling and Subsequent Fluorescence Activated Cell Sorting for Culture-independent Identification of Dissolved Organic Carbon-degrading Bacterioplankton

Environmental bacterioplankton are incubated with a model dissolved organic carbon (DOC) compound and a DNA labeling reagent, bromodeoxyuridine (BrdU). Afterward, DOC-degrading cells are separated from the bulk community based on their elevated BrdU incorporation using fluorescence activated cell sorting (FACS). These cells are then identified by subsequent molecular analyses.

Bromodeoxyuridine (BrdU) 레이블과 녹아 유기 문화 독립적인 확인을위한 후속 형광 활성 세포 정렬 탄소 굴욕 Bacterioplankton

Microbes are major agents mediating the degradation of numerous dissolved organic carbon (DOC) substrates in aquatic environments. However, identification ...

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of plant leaves or vertebrate lungs further difficulties arise from multiple transitions in refractive index between cellular components, between cells and airspaces and between the biological tissue and the rest of the optical system. Moreover, refractive index mismatches lead to attenuation of fluorophore excitation and signal emission in fluorescence microscopy. We describe here the application of the perfluorocarbon, perfluorodecalin (PFD), as an infiltrative imaging medium which optically improves laser scanning confocal microscopy (LSCM) sample imaging at depth, without resorting to damaging increases in laser power and has minimal physiological impact2. We describe the protocol for use of PFD with Arabidopsis thaliana leaf tissue, which is optically complex as a result of its structure (Figure 1). PFD has a number of attributes that make it suitable for this use3. The refractive index of PFD (1.313) is comparable with that of water (1.333) and is closer to that of cytosol (approx. 1.4) than air (1.000). In addition, PFD is readily available, non-fluorescent and is non-toxic. The low surface tension of PFD (19 dynes cm-1) is lower than that of water (72 dynes cm-1) and also below the limit (25 - 30 dyne cm-1) for stomatal penetration4, which allows it to flood the spongy mesophyll airspaces without the application of a potentially destructive vacuum or surfactant. Finally and crucially, PFD has a great capacity for dissolving CO2 and O2, which allows gas exchange to be maintained in the flooded tissue, thus minimizing the physiological impact on the sample. These properties have been used in various applications which include partial liquid breathing and lung inflation5,6, surgery7, artificial blood8, oxygenation of growth media9, and studies of ice crystal formation in plants10. Currently, it is common to mount tissue in water or aqueous buffer for live confocal imaging. We consider that the use of PFD as a mounting medium represents an improvement on existing practice and allows the simple preparation of live whole leaf samples for imaging.

A Simple Method for Imaging Arabidopsis Leaves Using Perfluorodecalin as an Infiltrative Imaging Medium

We describe the use of perfluorodecalin as an infiltrative mounting medium. This is a simple method for improving depth of imaging in Arabidopsis thaliana leaf tissue with minimal physiological impact.

이미징을위한 간단한 방법 Arabidopsis는 Infiltrative 영상 매체로 Perfluorodecalin를 사용하여 잎

The problem of acquiring high-resolution images deep into biological samples is widely acknowledged1. In air-filled tissue such as the spongy mesophyll of ...

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

분열 효모의 양적 라이브 세포 형광 - 현미경 분석

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Optimized Staining and Proliferation Modeling Methods for Cell Division Monitoring using Cell Tracking Dyes

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of different cell types in vitro and in vivo.1-5 Although there are literally thousands of publications using such dyes, some of the most commonly encountered cell tracking applications include monitoring of:
<ol>
	<li>stem and progenitor cell quiescence, proliferation and/or differentiation6-8</li>
	<li>antigen-driven membrane transfer9 and/or precursor cell proliferation3,4,10-18 and</li>
	<li>immune regulatory and effector cell function1,18-21.</li>
</ol>
Commercially available cell tracking dyes vary widely in their chemistries and fluorescence properties but the great majority fall into one of two classes based on their mechanism of cell labeling. "Membrane dyes", typified by PKH26, are highly lipophilic dyes that partition stably but non-covalently into cell membranes1,2,11. "Protein dyes", typified by CFSE, are amino-reactive dyes that form stable covalent bonds with cell proteins4,16,18. Each class has its own advantages and limitations. The key to their successful use, particularly in multicolor studies where multiple dyes are used to track different cell types, is therefore to understand the critical issues enabling optimal use of each class2-4,16,18,24.
The protocols included here highlight three common causes of poor or variable results when using cell-tracking dyes. These are:
<ol>
	<li>Failure to achieve bright, uniform, reproducible labeling. This is a necessary starting point for any cell tracking study but requires attention to different variables when using membrane dyes than when using protein dyes or equilibrium binding reagents such as antibodies.</li>
	<li>Suboptimal fluorochrome combinations and/or failure to include critical compensation controls. Tracking dye fluorescence is typically 102 - 103 times brighter than antibody fluorescence. It is therefore essential to verify that the presence of tracking dye does not compromise the ability to detect other probes being used.</li>
	<li>Failure to obtain a good fit with peak modeling software. Such software allows quantitative comparison of proliferative responses across different populations or stimuli based on precursor frequency or other metrics. Obtaining a good fit, however, requires exclusion of dead/dying cells that can distort dye dilution profiles and matching of the assumptions underlying the model with characteristics of the observed dye dilution profile.</li>
</ol>
Examples given here illustrate how these variables can affect results when using membrane and/or protein dyes to monitor cell proliferation.

Successful use of cell tracking dyes to monitor immune cell function and proliferation involves several critical steps. We describe methods for: 1) obtaining bright, uniform, reproducible label-ing with membrane dyes; 2) selecting fluorochromes and data acquisition conditions; and 3) choosing a model to quantify cell proliferation based on dye dilution.

셀 추적 염료를 사용하여 전지 부문 모니터링에 최적화 된 착색 및 확산 모델링 방법

Fluorescent cell tracking dyes, in combination with flow and image cytometry, are powerful tools with which to study the interactions and fates of ...

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting (FACS)

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their prominent presence is often associated with poor prognosis1,2. CAFs are an activated subpopulation of stromal fibroblasts, many of which express the myofibroblast marker &alpha;-SMA3. CAFs originate from local tissue fibroblasts as well as from bone marrow-derived cells recruited into the developing tumor and adopt a CAF phenotype under the influence of the tumor microenvironment4. CAFs were shown to facilitate tumor initiation, growth and progression through signaling that promotes tumor cell proliferation, angiogenesis, and invasion5-8. We demonstrated that CAFs enhance tumor growth by mediating tumor-promoting inflammation, starting at the earliest pre-neoplastic stages9. Despite increasing evidence of the key role CAFs play in facilitating tumor growth, studying CAFs has been an on-going challenge due to the lack of CAF-specific markers and the vast heterogeneity of these cells, with many subtypes co-existing in the tumor microenvironment10. Moreover, studying fibroblasts in vitro is hindered by the fact that their gene expression profile is often altered in tissue culture11,12 . To address this problem and to allow unbiased gene expression profiling of fibroblasts from fresh mouse and human tissues, we developed a method based on previous protocols for Fluorescence-Activated Cell Sorting (FACS)13,14. Our approach relies on utilizing PDGFR&alpha; as a surface marker to isolate fibroblasts from fresh mouse and human tissue. PDGFR&alpha; is abundantly expressed by both normal fibroblasts and CAFs9,15 . This method allows isolation of pure populations of normal fibroblasts and CAFs, including, but not restricted to &alpha;-SMA+ activated myofibroblasts. Isolated fibroblasts can then be used for characterization and comparison of the evolution of gene expression that occurs in CAFs during tumorigenesis. Indeed, we and others reported expression profiling of fibroblasts isolated by cell sorting16. This protocol was successfully performed to isolate and profile highly enriched populations of fibroblasts from skin, mammary, pancreas and lung tissues. Moreover, our method also allows culturing of sorted cells, in order to perform functional experiments and to avoid contamination by tumor cells, which is often a big obstacle when trying to culture CAFs.

Isolation of Normal and Cancer-associated Fibroblasts from Fresh Tissues by Fluorescence Activated Cell Sorting FACS

Cancer Associated Fibroblasts (CAFs) facilitate tumor initiation, growth and progression through signaling that promotes proliferation, angiogenesis, and inflammation. Here we describe a method to isolate pure populations of normal fibroblasts and CAFs from fresh mouse and human tissues by cell sorting, using PDGFR&#x03B1; as a surface marker.

형광 활성 세포 정렬 (FACS)에 의해 신선한 조직으로부터 정상 및 암 관련 섬유 아세포의 분리

Cancer-associated fibroblasts (CAFs) are the most prominent cell type within the tumor stroma of many cancers, in particular breast carcinoma, and their ...

Single Cell Micro-aspiration as an Alternative Strategy to Fluorescence-activated Cell Sorting for Giant Virus Mixture Separation

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or fluorescence activated cell sorting (FACS) applied to the viral population. However, when the viruses in the mixture have similar morphologic properties and one of the viruses multiplies slowly, the presence of two viruses is discovered at the stage of genome assembly and the viruses cannot be separated for further characterization. To solve this problem, we developed a single cell micro-aspiration procedure that allows for separation and cloning of highly similar viruses. In the present work, we present how this alternative strategy allowed us to separate the small viral subpopulations of Clandestinovirus ST1 and Usurpativirus LCD7, giant viruses that grow slowly and do not lead to amoebal lysis compared to the lytic and fast-growing Faustovirus. Purity control was assessed by specific gene amplification and viruses were produced for further characterization.

Here, we describe a single cell micro-aspiration method for the separation of infected amoebae. In order to separate viral subpopulations in Vermamoeba vermiformis infected by Faustoviruses and unknown giant viruses, we developed the protocol detailed below and demonstrated its ability to separate two low-abundance novel giant viruses.

거대한 바이러스 혼합물 분리를 위한 형광 활성화 세포 분류에 대한 대체 전략으로서의 단일 세포 마이크로 포부

During the amoeba co-culture process, more than one virus may be isolated in a single well. We previously solved this issue by end point dilution and/or ...