This protocol was developed in support of a Joint Genome Institute-Community Sequencing Project (#1657). The work was supported in part by the Philomathia Foundation, the National Science Foundation (#0929226) and the Energy Biosciences Institute to S. Somerville; and by Swiss National Science Foundation (#310030_163260) to B. Keller. We would like to thank our colleagues, M. Figureroa and M. Miller (University of Minnesota), R. Panstruga (RWTH Aachen University), C. Pedersen (University of Copenhagen), P. Spanu (Imperial College), J. Taneja (University of California Berkeley), M. Wildermuth (University of California Berkeley), R. Wise (Iowa State University) and S. Xiao (University of Maryland) for their generous advice and for volunteering their protocols as we developed the protocol described here.

1. Preparación de Fungal materiales <ol><li> La creciente Oidio <ol><li> Cultivar plantas en cámaras de crecimiento con las siguientes condiciones: 22 ° C día la temperatura, 20 ° C Temperatura de la noche, 80% de humedad relativa, 14-h día de longitud y una intensidad de luz de 125 E · / m 2 / s (proporcionado por la iluminación fluorescente ). </li><li> Infectar plantas de pepino (variedad sativa Cucumis Bush Champion) con Golovinomyces cichoracearum UCSC1 cepa como se ha descrito 18, 29. </li></ol></li><li> La recolección Oidio conidios <ol><li> conidios Harvest de las plantas infectadas a los 7 - 10 días después de la inoculación usando un pequeño vacío con un filtro en línea (11 m) en el que los conidios se acumulan. La aplicación de presión suave, ejecute la boquilla de vacío a lo largo de la superficie de la hoja para recoger los conidios. NOTA: El rendimiento medio de G. cichoracearum es de 20 mg de conidios de un fuertemente infected hoja de pepino de aproximadamente 130 cm 2 en la zona. </li><li> Cepillo alrededor de 150 mg de los conidios (aproximadamente 375 l de volumen, o conidios de 7-8 hojas de pepino infectadas) desde el filtro en una hoja de papel limpia. Desde aquí, la transferencia de conidios en crioviales de 2 ml con un diámetro de dos 5/32 pulgadas pre-enfriado (en nitrógeno líquido) bolas de molienda de acero. Inmediatamente volver tubos para nitrógeno líquido. tubos almacenar a -80 ° C. </li></ol></li><li> Abriendo conidios por molienda de bolas <ol><li> Flash congelar placas de aluminio de molino de bolas en nitrógeno líquido. Cargar crioviales en rack de molino de bolas. Agitar vigorosamente los crioviales con conidios y bolas de acero en el molino de bolas durante 30 s a 30 ciclos / s (a temperatura ambiente). Inmediatamente vuelva a congelar crioviales en nitrógeno líquido. NOTA: En un principio, acceder a una muestra de conidios por microscopía con un aumento de 100X para la eficiencia de la ruptura de la pared celular durante la molienda. Si es necesario, moler para un adicional de 1 - 2 rondas de 30 s durante 30 ciclos / s, but mantener el número de rondas a un mínimo. La evaluación rutinaria de rotura de conidias por microscopía en esta etapa no es necesaria una vez que se han establecido las condiciones óptimas. </li></ol></li></ol> 2. Purificación de ADN genómico <ol><li> conidios de lisis <ol><li> Trabajar con rapidez para evitar conidios descongelación, eliminar las bolas de acero de crioviales con un imán. Añadir 700! L 65 ° C tampón de lisis (Tabla 1) y agitar 5 - 10 s hasta que se forma una suspensión. </li><li> Añadir 300! L precalentado (65 ° C) 5% (v / v) sarcosil y invertir suavemente para mezclar (1 inversión por cada 3 s) cinco veces. Incubar los tubos durante 30 minutos a 65 ° C; invierta suavemente 3 veces en 10, 20 y 30 min. Utilizando una punta de pipeta de gran calibre, Trasvasar toda la solución a un nuevo tubo de microcentrífuga de 2 ml. En todas las etapas posteriores, se mezcla por inversión suave, lento y transferir las soluciones que contienen ADN con puntas de pipeta de gran calibre. </li></ol></li><li> Extracción de ADN I <ol><li> Añadir 1 volumen de cloroformulario: alcohol isoamílico (24: 1 v / v) a la solución de lisis y se invierta suavemente para mezclar cinco veces. Incubar durante 10 min a temperatura ambiente, suavemente invirtiendo para mezclar cinco veces en el punto a mitad de camino y de nuevo al final de la incubación. Centrifugar a temperatura ambiente durante 15 min a 14.000 x g. Utilizando puntas de pipeta de gran calibre, transferir cuidadosamente la capa acuosa a un nuevo tubo de microcentrífuga de 2 ml; evitar la inclusión de material de la interfaz. </li></ol></li><li> ADN precipitación I <ol><li> Añadir 1 volumen de temperatura ambiente 100% de isopropanol (aproximadamente 750 l) y invertir suavemente para mezclar seis veces. Centrifugar a temperatura ambiente durante 15 min a 14.000 x g. Retirar con cuidado el sobrenadante y desechar. </li><li> Añadir 450! L pre-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 min a temperatura ambiente a 14000 x g. Retirar con cuidado el sobrenadante y desechar. Centrifugar a 1000 xg durante 3 s, retirar cuidadosamente el sobrenadante con punta de pipeta fina y desechar. Aire seco en el sedimento durante 15 min unatemperatura ambiente t. No seque durante más de 15 minutos. </li><li> Resuspender el precipitado en 300! L de TE (10 mM Tris-Cl, ácido tetra-acético de etileno diamina 1 mM, pH 8,0). Incubar durante la noche a 4 ° C. golpee suavemente para volver a suspender cualquier material residual que no entró en solución. </li></ol></li><li> Para eliminar la contaminación de RNA, añadir 10 l de RNasa A (10 mg / ml). Invertir suavemente para mezclar tres veces. Centrifugar a 1000 xg durante 3 s. Incubar a 37 ° C durante 2 h. </li><li> Extracción de ADN II <ol><li> Añadir 300! L de fenol: cloroformo: alcohol isoamílico (25: 24: 1 v / v) y invertir suavemente para mezclar cinco veces. Incubar 10 minutos a temperatura ambiente, suavemente invirtiendo para mezclar cinco veces a mitad de camino y de nuevo al final de la incubación. Centrifugar 15 min a temperatura ambiente a 14000 x g. Utilizando una punta de pipeta de gran calibre, transferir el sobrenadante a un nuevo tubo de microcentrífuga de 1,5 ml. </li></ol></li><li> ADN precipitación II <ol><li> Añadir 0,01 volumen de 3 M de acetato de sodio pH 5,2 (approximately 3 l), invertir suavemente para mezclar cinco veces. Añadir 2,5 volúmenes pre-enfriada (-20 ° C) 100% de etanol (aproximadamente 750 l). Invertir suavemente para mezclar cinco veces. Incubar durante la noche a -20 ° C. </li><li> Centrifugar 30 minutos a 4 ° C a 14.000 x g. Retirar con cuidado el sobrenadante y desechar. </li><li> Añadir 450! L pre-refrigerada% de etanol (-20 ° C) 70. Centrifugar durante 5 min a 4 ° C a 14.000 x g. Retirar con cuidado el sobrenadante y desechar. Centrifugar a 1000 xg durante 3 s. Retirar con cuidado el sobrenadante con pipeta de punta fina y descarte. </li><li> Aire seco en el sedimento durante 30-60 minutos a temperatura ambiente. Resuspender el precipitado en 27,5 l de TE. Incubar durante la noche a 4 ° C. golpee suavemente para volver a suspender cualquier material residual que no entró en solución. </li><li> Alícuota de 2,5 l en 22,5 l de TE (volumen final 25 l) para las pruebas de control de calidad (ver abajo). Tiendas muestras de ADN a 4 ° C hasta la presentación para la secuenciación. Para el almacenamiento, almacenar muestras a largo plazoa -80 ° C y minimizar los ciclos de congelación-descongelación para evitar cizallamiento. NOTA: Tenga cuidado al pipetear en este paso como el ADN genómico de alto peso molecular puede ser difícil de pipetear correctamente, y es importante para asegurarse de que &quot;QC Alícuota&quot; es una representación exacta de la muestra de ADN genómico. </li></ol></li></ol> 3. Control de Calidad <ol><li> pureza de la muestra <ol><li> El uso de un TE en blanco, evaluar la pureza de la muestra del ADN mediante la carga de 1 l de la QC alícuota en un espectrofotómetro de pequeño volumen. Registro A260 / A280 y A260 / A230 lecturas. ADN puro tendrá una relación A260 / A280 de la relación de aproximadamente 1,8 y A260 / A230 entre 1,8 y 2,2. </li></ol></li><li> Cuantificación de ADN genómico <ol><li> Realizar cuantificación de QC alícuota utilizando un kit de ensayo de cuantificación de ADN de doble cadena comercial de acuerdo con las instrucciones del fabricante. </li></ol></li><li> ADN I Evaluación de la Calidad <ol><li> Cargar aproximadamente 60 ng de ADN genómico y unaescalera de ADN en un gel de agarosa al 0,7% en 1X TAE (Tris 40 mM, ácido acético 20 mM, y EDTA 1 mM, pH 8,0). aparato de gel correr a 70 V durante 40 - 45 min hasta que las bandas de ADN genómico son aproximadamente 2 cm desde el pozo y cinta de separación en la escalera es aparente. Estas condiciones pueden necesitar ser ajustado basado en aparato de electroforesis de gel disponibles. </li></ol></li><li> ADN II Evaluación de la Calidad <ol><li> Cargar aproximadamente 60 ng de ADN genómico y una escalera de ADN de alto peso molecular (adecuado para la electroforesis en gel de campo pulsado) en un gel de agarosa al 1% en TBE 0,5x (Tris 44,5 mM, 44,5 mM de ácido bórico, EDTA 1 mM, pH 8,3) y correr en tampón de ejecución 0,5x TBE usando un 5 - de campo pulsado protocolo de electroforesis en gel de forma de onda de 80 kpb durante 16 h. </li></ol></li><li> Evaluación de origen bacteriano, fúngico, y contaminantes de plantas <ol><li> Realizar la reacción en cadena de la polimerasa (PCR) para amplificar los espaciadores transcritos internos apropiados (ITS) regiones de los genes ribosómicos utilizando cebadores y condiciones de amplificación de la listaed en la Tabla 2. Cargar 10 l de la reacción resultante en un gel. NOTA: una banda que representa el oidio región ITS debe ser amplificado con el hongos SU cebadores. ADN de este amplicón y cualquier amplicón generado con los cebadores, o bacterianas de las plantas debe ser secuenciado para determinar el origen de la contaminación. Sólo oidio secuencias de ITS se debe encontrar en el amplicón hongos. </li></ol></li></ol>

<ol>
	<li>Agrios, G. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plant Pathology. , (1969).</li><li>Braun, U., Cook, R. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Taxonomic manual of the Erysiphales (Powdery Mildews). , (2012).</li><li>Both, M., Csukai, M., Stumpf, M. P. H., Spanu, P. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+expression+profiles+of+Blumeria+graminis+indicate+dynamic+changes+to+primary+metabolism+during+development+of+an+obligate+biotrophic+pathogen.">Gene expression profiles of Blumeria graminis indicate dynamic changes to primary metabolism during development of an obligate biotrophic pathogen.</a> Plant Cell. 17 (7), 2107-2122 (2005).</li><li>Glawe, D. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+powdery+mildews:+A+review+of+the+world's+most+familiar+(yet+poorly+known)+plant+pathogens.">The powdery mildews: A review of the world's most familiar (yet poorly known) plant pathogens.</a> Annu Rev Phytopathol. 46, 27-51 (2008).</li><li>Fabro, G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+expression+profiling+Arabidopsis+at+the+stage+of+Golovinomyces+cichoracearum+haustorium+formation.">Genome-wide expression profiling Arabidopsis at the stage of Golovinomyces cichoracearum haustorium formation.</a> Plant Physiol. 146 (3), 1421-1439 (2008).</li><li>H&#252;ckelhoven, R., Panstruga, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell+biology+of+the+plant-powdery+mildew+interaction.">Cell biology of the plant-powdery mildew interaction.</a> Curr Opin Plant Biol. 14 (6), 738-746 (2011).</li><li>Micali, C. O., Neumann, U., Grunewald, D., Panstruga, R., O'Connell, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biogenesis+of+a+specialized+plant-fungal+interface+during+host+cell+internalization+of+Golovinomyces+orontii+haustoria.">Biogenesis of a specialized plant-fungal interface during host cell internalization of Golovinomyces orontii haustoria.</a> Cell Microbiol. 13 (2), 210-226 (2011).</li><li>Chandran, D., Inada, N., Hather, G., Kleindt, C. K., Wildermuth, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Laser+microdissection+of+Arabidopsis+cells+at+the+powdery+mildew+infection+site+reveals+site-specific+processes+and+regulators.">Laser microdissection of Arabidopsis cells at the powdery mildew infection site reveals site-specific processes and regulators.</a> Proc Natl Acad Sci. 107 (1), 460-465 (2010).</li><li>Spanu, P. D., Panstruga, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Powdery+mildew+genomes+in+the+crosshairs.">Powdery mildew genomes in the crosshairs.</a> New Phytol. 195 (1), 20-22 (2012).</li><li>Vela-Corc&#237;a, D., Romero, D., Tor&#233;s, J. A., De Vicente, A., P&#233;rez-Garc&#237;a, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+transformation+of+Podosphaera+xanthii+by+electroporation+of+conidia.">Transient transformation of Podosphaera xanthii by electroporation of conidia.</a> BMC Microbiol. 15 (20), (2015).</li><li>Hacquard, S., Francis, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Advances in Botanical Research. 70, 109-142 (2014).</li><li>Spanu, P. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+expansion+and+gene+loss+in+powdery+mildew+fungi+reveal+tradeoffs+in+extreme+parasitism.">Genome expansion and gene loss in powdery mildew fungi reveal tradeoffs in extreme parasitism.</a> Science. 330 (6010), 1543-1546 (2010).</li><li>Wicker, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+wheat+powdery+mildew+genome+shows+the+unique+evolution+of+an+obligate+biotroph.">The wheat powdery mildew genome shows the unique evolution of an obligate biotroph.</a> Nat Genet. 45 (9), 1092 (2013).</li><li>Jones, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adaptive+genomic+structural+variation+in+the+grape+powdery+mildew+pathogen,+Erysiphe+necator.">Adaptive genomic structural variation in the grape powdery mildew pathogen, Erysiphe necator.</a> BMC Genomics. 15, 1081 (2014).</li><li>Thomma, B. P. H. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mind+the+gap;+seven+reasons+to+close+fragmented+genome+assemblies.">Mind the gap; seven reasons to close fragmented genome assemblies.</a> Fungal Genet Biol. 90, 24-30 (2016).</li><li>Parlange, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+major+invasion+of+transposable+elements+accounts+for+the+large+size+of+the+Blumeria+graminis+f.sp.+tritici+genome.">A major invasion of transposable elements accounts for the large size of the Blumeria graminis f.sp. tritici genome.</a> Funct Integr Genomics. 11, 671-677 (2011).</li><li>Faino, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Single-molecule+real-time+sequencing+combined+with+optical+mapping+yields+completely+finished+fungal+genome.">Single-molecule real-time sequencing combined with optical mapping yields completely finished fungal genome.</a> mBio. 6, (2015).</li><li>Adam, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+Erysiphe+cichoracearum+and+E.+cruciferarum+and+a+survey+of+360+Arabidopsis+thaliana+accessions+for+resistance+to+these+two+powdery+mildew+pathogens.">Comparison of Erysiphe cichoracearum and E. cruciferarum and a survey of 360 Arabidopsis thaliana accessions for resistance to these two powdery mildew pathogens.</a> Mol Plant Microbe In. 12 (12), 1031-1043 (1999).</li><li>Bourras, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Multiple+avirulence+loci+and+allele-specific+effector+recognition+control+the+PM3+race-specific+resistance+of+wheat+to+powdery+mildew.">Multiple avirulence loci and allele-specific effector recognition control the PM3 race-specific resistance of wheat to powdery mildew.</a> Plant Cell. 27 (10), 2991-3012 (2015).</li><li>Henry, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Plant genotyping II: SNP technology. , (2008).</li><li>Healey, A., Furtado, A., Cooper, T., Henry, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protocol:+a+simple+method+for+extracting+next-generation+sequencing+quality+genomic+DNA+from+recalcitrant+plant+species.">Protocol: a simple method for extracting next-generation sequencing quality genomic DNA from recalcitrant plant species.</a> Plant Methods. 10 (21), (2014).</li><li>Fang, G., Hammar, S., Grumet, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+quick+and+inexpensive+method+for+removing+polysaccharides+from+plant+genomic+DNA.">A quick and inexpensive method for removing polysaccharides from plant genomic DNA.</a> Biotechniques. 13 (1), 52-54 (1992).</li><li>Jordon-Thaden, I. E., Chanderbali, A. S., Gitzendanner, M. A., Soltis, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modified+CTAB+and+TRIzol+protocols+improve+RNA+extraction+from+chemically+complex+Embryophyta.">Modified CTAB and TRIzol protocols improve RNA extraction from chemically complex Embryophyta.</a> Appl Plant Sci. 3 (5), 1400105 (2015).</li><li>Murray, M. G., Thompson, W. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+isolation+of+high+molecular+weight+plant+DNA.">Rapid isolation of high molecular weight plant DNA.</a> Nucleic Acids Res. 8 (19), 4321-4325 (1980).</li><li>Greco, M., S&#225;ez, C. A., Brown, M. T., Bitonti, M. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+simple+and+effective+method+for+high+quality+co-extraction+of+genomic+DNA+and+total+RNA+from+low+biomass+Ectocarpus+siliculosus,+the+model+brown+alga.">A simple and effective method for high quality co-extraction of genomic DNA and total RNA from low biomass Ectocarpus siliculosus, the model brown alga.</a> PLoS One. 9 (5), e96470 (2014).</li><li>Wilson, I. W., Schiff, C. L., Hughes, D. E., Somerville, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+trait+loci+analysis+of+powdery+mildew+disease+resistance+in+the+Arabidopsis+thaliana+accession+Kashmir-1.">Quantitative trait loci analysis of powdery mildew disease resistance in the Arabidopsis thaliana accession Kashmir-1.</a> Genetics. 158 (3), 1301-1309 (2001).</li></ol>

The authors have nothing to disclose.

Con el fin de obtener ADN puro, de alto peso molecular genómico de la obligado hongos oidio biotrófico, una versión modificada de los métodos descritos anteriormente se desarrolló 30. El rendimiento promedio utilizando este protocolo optimizado es 7 g de ADN por 150 conidios mg, una duplicación de los rendimientos obtenidos con un protocolo anterior. Además, el tamaño promedio se incrementó de aproximadamente 20 kpb a más de 48,5 kpb. Este protocolo se ha optimizado en el sistema cichoracearum G. cucumber-. Con el fin de obtener la mejor calidad y la más alta de ADN pureza en otra oidio o obligar a los hongos biotróficos, puede ser necesaria una modificación adicional de este protocolo. En el futuro, este protocolo puede utilizarse para obtener ADN de alto peso molecular adecuado para la secuenciación de ADN de lectura larga a partir de otros hongos biotróficos obligados, aunque puede ser necesaria la modificación adicional. Equilibrar la alta producción de ADN y de alto peso molecular de ADN extraído se una preocupacióndurante la optimización de este protocolo. Pasos incluyendo agitación en vórtex fueron eliminados con el fin de minimizar el cizallamiento del ADN, y fueron reemplazados por mezcla suavemente por inversión. Este cambio aumenta la calidad del ADN extraído sin reducir significativamente el rendimiento. Además, la eliminación de las bolas de acero en el comienzo de la etapa de lisis celular aumentó significativamente el rendimiento de ADN en comparación con dejar las bolas en la solución hasta el final de la etapa de lisis. No G. cichoracearum conidios permaneció intacta después del procedimiento de molienda con bolas en el paso 1.3. Para obtener buenos rendimientos de ADN genómico de alto peso molecular, es crucial que la pared celular de los hongos se interrumpe durante este paso. integridad de los conidios se puede evaluar microscópicamente, y molienda de bolas adicional o métodos alternativos de interrupción puede ser necesario para otras especies de hongos. Algunos conidios de hongos, en particular el Blumeria sp., Contienen pigmentos que pueden CONTaminar de extracción y purificación de ADN intentos. En estos casos, se recomienda incluir la etapa de filtración de ADN como se indica en la Bourras et al. (2015) de protocolo 19 y una etapa de lavado adicional con TE después de la etapa de filtración. La adición de la etapa de filtración dio lugar a un aumento pequeño pero significativo en la degradación del ADN, y sólo debe ser incluido si la pigmentación excesiva permanece después de la segunda etapa de precipitación de ADN. Estos pigmentos, si se les permite permanecer en solución, pueden interferir con el análisis posterior de la calidad y cantidad de ADN y potencialmente podrían interferir con las reacciones de secuenciación. Este protocolo incluye tanto una etapa de electroforesis en gel de agarosa tradicional y una etapa de electroforesis en gel de campo pulsado. La primera es una evaluación inicial de la fracción de ADN que es&gt; 20 kpb y la fracción que se ejecuta como un frotis a &lt;20 kpb. A los efectos de las reacciones de secuenciación aguas abajo requerida para mil pulverulentogenomas de rocío, la fracción de ADN &lt;20 kpb deben ser mínimos (véase la Figura 1, carril 2 frente a carril 4). La evaluación de la electroforesis en gel de campo pulsado proporciona una mejor estimación del tamaño como ADN&gt; 20 kpb se pueden separar por tamaño. ADN de&gt; 48,5 kpb es deseable para su uso en reacciones de secuenciación posteriores (véase la figura 2, carril 4). El material fúngico usado en estos experimentos se propagó en cámaras de crecimiento y la contaminación se limitó utilizando estrictos protocolos de aislamiento y controles de personal. Debido a esto, la contaminación con patógenos de moho otra, no en polvo fue mínimo, y la secuenciación de la región ITS amplificado utilizando cebadores hongos específica recuperaron sólo secuencias cichoracearum G.. Esto puede no ser el caso de la mildiú recogidos de los sitios de campo o invernaderos que carecen de los mismos controles de aislamiento y evaluación de la contaminación en estas casES serán críticos para el ensamblaje de los genomas de alta calidad a partir del ADN extraído. No una modificación de los diversos protocolos de aislamiento de ADN fúngico era únicamente importante. Más bien ligeras modificaciones en muchos pasos resultaron en los rendimientos relativamente altos de ADN moho peso molecular en polvo de alta informado aquí.

<html> Cenicillas son un grupo de obligado planta de hongos patógenos que biotrófica, tomados en conjunto, son la principal causa de enfermedades de las plantas en todo el mundo 1. Hay más de 900 especies descritas de oídio, que se han agrupado en cinco tribus taxonómicamente dentro de la familia Erisyphaceae 2. Debido tanto a su importancia económica y la relación íntima que desarrollan con sus anfitriones, las enfermedades de moho han sido objeto de investigación para&gt; 100 años. Tras la infección, oídios provocan cambios drásticos en la estructura celular, el metabolismo y la biología molecular de sus anfitriones, en beneficio de este patógeno. Sin embargo, el estudio de oídios es particularmente difícil debido a su estilo de vida obligado, y el crecimiento del hongo en cultivo puro todavía no se ha descrito 3, 4, 5,&quot;xref&quot;&gt; 6, 7, 8. Fiable transformación, estable genética de cenicillas aún no ha logrado también ha sido, a pesar de la transformación transitoria se ha reportado en algunas especies 9, 10. La secuenciación y ensamblaje de genomas de moho en polvo ha demostrado ser difícil debido a una serie de características de la propia genoma. Genomas de moho en polvo son grandes (120 a 180 Mbp) en relación con otros genomas de hongos, y se componen de 60 - 90% de elementos repetitivos distribuidas uniformemente 11. Estos elementos incluyen repeticiones terminales no largos, así como elementos repetitivos no categorizados. Dos formas especiales de una sola especie oídio, Blumeria graminis f. sp. hordei y f. sp. tritici (Bgh y Bgt, respectivamente), así como el polvo de uva moho Erysiphe necator, tienen abejan secuenciaron, y los proyectos de genomas de varios otros se han completado 12, 13, 14. La naturaleza repetitiva de los genomas ha hecho ensamblaje difícil, y el genoma Bgh terminado fue ensamblado en 6.989 supercontigs con un L50 de 2 Mb 12. A pesar del gran genoma, los oídios parecen tener un pequeño número de genes de proteínas de codificación, con 5.845 y 6.540 genes predichos en Bgh y Bgt, respectivamente. Los mildius pulverulentos secuenciados también parecen carecer de al menos 99 genes esenciales que son esenciales en otros hongos, que es consistente con la dependencia de los hongos en su planta huésped para la supervivencia 11, 12, 13, 14. Las secuencias repetitivas cerca de telómeros, centrómeros, RN ribosomalA arrays y regiones enriquecidas en elementos de transposición de genes están mal ensambladas a partir de estrategias de secuenciación-leer cortas y son a menudo insuficientemente representadas en asambleas del genoma 15. Se cree que estas regiones para ser responsable de muchos de los huecos que se producen en secuencias del genoma, y esto se aplica a los oídios con su amplia expansión de elementos repetitivos 16. Altamente regiones del genoma de plástico se encuentran a menudo en tales regiones repetitivas 3. Ellos sirven como un sitio de reordenamientos cromosómicos y, a menudo codifican genes bajo fuerte presión selectiva, tales como los genes que codifican las proteínas efectoras y los genes que codifican enzimas del metabolismo secundario. Los avances en una sola molécula de tecnologías de secuenciación de lectura larga proporcionan una solución potencial para la secuenciación a través de las regiones repetitivas de genomas 15. Por ejemplo, FAINO et al. (2015) encontraron que la inclusión de la secuencia larga leer tecnologías y m ópticoapping les permitió producir una secuencia de genoma GAP-menos por dos cepas de la planta de hongos patógenos dalia Verticillium, triplicando la proporción de secuencias repetitivas de ADN en el genoma, aumentando el número de anotaciones de genes (y reducir el número de parcial o falta anotaciones de genes ) y el genoma revelador reordenamientos 17. Para emplear estas tecnologías de secuenciación de larga leer, altas concentraciones de ADN genómico de alta calidad, con un mínimo de tamaños&gt; 20 kpb, son necesarios. Aquí describimos nuestros métodos para la recolección de conidial, la purificación de ADN de alto peso molecular a partir de conidios y nuestras evaluaciones de control de calidad utilizando las especies de moho en polvo Golovinomyces cichoracearum cultivadas en pepino 18. Este protocolo se basa en un protocolo desarrollado en el grupo de laboratorio B. Keller (Universidad de Zürich, Zürich Suiza) 13, 19e incluye varias modificaciones que condujeron a un aumento de los rendimientos de ADN y una mayor proporción de ADN&gt; 48,5 kpb de tamaño. El protocolo también incluye medidas de control de calidad basado en las recomendaciones del Departamento de Energía de los Estados Unidos Joint Genome Institute 20, 21, 22. La función de cada reactivo incluido en el tampón de lisis, y la justificación de cada etapa de purificación, son como se describe en Henry (2008) 23. Disponibles protocolos publicados para el aislamiento de ADN genómico de alto peso molecular a partir de tejidos vegetales y microbianas también fueron consultados durante el diseño de este protocolo 24, 25, 26, 27, 28.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>MM400 Ball Mill</td>
			<td>Retsch</td>
			<td>20.745.0001</td>
			<td>Or equivalent ball mill</td>
		</tr>
		<tr>
			<td>2mL tubes for ball milling</td>
			<td>Sarstedt&#160;</td>
			<td>72.694.007</td>
			<td></td>
		</tr>
		<tr>
			<td>5/32&#34; stainless steel milling balls</td>
			<td>OPS Diagnostics</td>
			<td>GBSS 165-5000-01</td>
			<td></td>
		</tr>
		<tr>
			<td>Microprocessor controlled 280 Series Water Bath Preset to 65&#176;C&#160;</td>
			<td>Thermo Fisher Scientific</td>
			<td>2825</td>
			<td>Or equivalent water bath</td>
		</tr>
		<tr>
			<td>Microprocessor controlled 280 Series Water Bath Preset to 37&#176;C</td>
			<td>Thermo Fisher Scientific</td>
			<td>2825</td>
			<td>Or equivalent water bath</td>
		</tr>
		<tr>
			<td>Eppendorf 5417R refrigerated microcentrifuge</td>
			<td>Krakeler Scientific&#160;</td>
			<td>38-022621807</td>
			<td>Or equivalent microcentrifuge</td>
		</tr>
		<tr>
			<td>Chlorform:IAA (24:1 v/v)</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>C0549</td>
			<td>Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood</td>
		</tr>
		<tr>
			<td>Phenol:Chloroform:IAA (25:24:1 v/v)</td>
			<td>Thermo Fisher Scientific</td>
			<td>15593031</td>
			<td>Hazardous in case of skin contact or inhalation. Wear nitrile gloves, protective eyewear, lab coat and work in chemical hood</td>
		</tr>
		<tr>
			<td>100% Isopropanol</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>W292907</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>34923</td>
			<td>Chill to -20&#176;C prior use</td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>S2889</td>
			<td></td>
		</tr>
		<tr>
			<td>Rnase, Dnase-free (10mg/ml)</td>
			<td>Thermo Fisher Scientific</td>
			<td>EN0531</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium metabisulfite</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>P2522</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Lauryl Sacroinate</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>L9150</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris base</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>10708976001</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic acid (EDTA)</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>EDS</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium chloride (NaCl)</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>S9888</td>
			<td></td>
		</tr>
		<tr>
			<td>Cetyltrimethyl ammonium bromide (CTAB)</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>H6269</td>
			<td></td>
		</tr>
		<tr>
			<td>Uvex by Honeywell Futura Goggles S345C, Uvextreme</td>
			<td>Staples</td>
			<td>423263</td>
			<td>Or equivalent eyewear</td>
		</tr>
		<tr>
			<td>High Five COBALT nitrile gloves, LARGE</td>
			<td>Neta Scientific</td>
			<td>HFG-N193</td>
			<td>Or equivalent gloves</td>
		</tr>
		<tr>
			<td>GelRed Nucleic Acid Gel Stain 10,000X in water</td>
			<td>Biotium</td>
			<td>41003</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium Bromide 10mg/ml</td>
			<td>Biotium</td>
			<td>40042</td>
			<td>Hazardous in case of skin contact. Wear nitrile gloves and protective eyewear</td>
		</tr>
		<tr>
			<td>&#160;Agarose Ultrapure Bioreagent</td>
			<td>VWR International LLC</td>
			<td>JT4063</td>
			<td></td>
		</tr>
		<tr>
			<td>GeneRuler 1kb Plus DNA Ladder</td>
			<td>Thermo Fisher Scientific</td>
			<td>FERSM1332</td>
			<td></td>
		</tr>
		<tr>
			<td>8-48kb CHEF DNA size standards</td>
			<td>Bio-Rad</td>
			<td>170-3707</td>
			<td></td>
		</tr>
		<tr>
			<td>Pippin Prep&#160;&#160;</td>
			<td>Life Technologies Corporation</td>
			<td>4472172</td>
			<td>Or equivalent pulse-field gel aparatus</td>
		</tr>
		<tr>
			<td>Whatman&#160;qualitative filter paper, Grade 1</td>
			<td>Sigma-Aldrich&#160;</td>
			<td>WHA1001042</td>
			<td>Or equivalent growth chamber</td>
		</tr>
		<tr>
			<td>Percival&#160; Growth Chamber</td>
			<td>Percival</td>
			<td>AR66LXC9</td>
			<td></td>
		</tr>
		<tr>
			<td>NanoDrop 8000 UV-Vis Spectrophotometer</td>
			<td>Thermo Fisher Scientific</td>
			<td>ND-8000-GL</td>
			<td>Or equivalent spectrophotometer</td>
		</tr>
		<tr>
			<td>Quant-iT PicoGreen dsDNA Assay Kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>P11496</td>
			<td></td>
		</tr>
		<tr>
			<td>TAE Buffer (Tris-acetate-EDTA) (50X)</td>
			<td>Thermo Fisher Scientific</td>
			<td>B49</td>
			<td>Dilute 1/50 with water before use (to 1X)</td>
		</tr>
		<tr>
			<td>TE Buffer</td>
			<td>Thermo Fisher Scientific</td>
			<td>12090015&#160;</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris-Borate-EDTA, 10X Solution (Electrophoresis)</td>
			<td>Thermo Fisher Scientific</td>
			<td>BP13334</td>
			<td>Dilute 1/10 with water before use (to 1X)</td>
		</tr>
		<tr>
			<td>Liquid Nitrogen</td>
			<td></td>
			<td></td>
			<td>Liquid nitrogen (-196 &#176;C) is a freezing hazard. It will also expand rapidly upon warming and should not keep in a tightly closed container</td>
		</tr>
	</tbody>
</table>

purification of high molecular weight genomic dna from powdery mildew for long-read sequencing

Los hongos oídio son un grupo de económicamente importantes patógenos fúngicos de plantas. Se sabe relativamente poco acerca de la biología molecular y la genética de estos patógenos, en parte debido a la falta de recursos genéticos y genómicos bien desarrolladas. Estos organismos tienen, genomas repetitivas grandes, que han hecho la secuenciación del genoma y montaje prohibitivamente difícil. A continuación, describimos métodos para la recogida, extracción, purificación y control de calidad de la evaluación de ADN genómico de alto peso molecular a partir de especies de moho uno pulverulentos, Golovinomyces cichoracearum. El protocolo descrito incluye la rotura mecánica de las esporas, seguido de una extracción de ADN genómico optimizado fenol / cloroformo. Un rendimiento típico fue de 7 g de ADN por cada 150 conidios mg. El ADN genómico que se aísla usando este procedimiento es adecuado para la secuenciación de larga leer (es decir,&gt; 48,5 kpb). medidas de control de calidad para asegurar el tamaño, el rendimiento y pureza del ADN genómico son tambiéndescrito en este método. La secuenciación del ADN genómico de la calidad descrita aquí permitirá que para el montaje y la comparación de varios genomas oídio, que a su vez dará lugar a una mejor comprensión y un mejor control de este patógeno agrícola.

Un ejemplo representativo de 60 ng de ADN genómico purificado de G. cichoracearum ejecuta en un gel de agarosa usando electroforesis en gel y usando electroforesis en gel de campo pulsado se muestra en las Figuras 1 y 2, respectivamente. preparaciones de ADN genómico que pasan, marginalmente aprobación y rechazo del control de calidad se representan. preparaciones de ADN genómico que pasan completamente el control de calidad son ideales para la secuenciación utilizando enfoques de secuenciación del genoma de lectura largo. Preparaciones que pasan marginalmente control de calidad son aceptables, pero se prefieren las preparaciones que pasan completamente. Preparaciones que fallan el control de calidad no son aceptables para leídos largo enfoques de secuenciación del genoma. <img alt="Figura 1" src="/files/ftp_upload/55463/55463fig1.jpg" /> Figura 1: Gel de Agarosa Electroforesis de ADN genómico purificado. Carril 1: </strong&gt; A escalera de ADN, con bandas que van desde 20 kpb a 75 pb; Carril 2: ADN genómico que pasó el control de calidad; Carril 3: ADN genómico que se consideró marginal; y Carril 4: ADN genómico que falló control de calidad. muestras de ADN genómico aceptables y marginales tienen una sola banda que corre por encima de 20 kpb con manchas mínimo a &lt;20 kpb. muestras de ADN genómico que fallan el control de calidad han corra por debajo de 20 kpb, y pueden incluir fragmentos de bajo peso molecular a aproximadamente 100 pb (*). se requiere electroforesis en gel de campo pulsado para distinguir entre muestras de ADN aceptables y marginales. El bromuro de etidio se añadió al gel antes de la electroforesis para la visualización del ADN genómico. Las muestras se sometieron a electroforesis a 60 V durante 50 min. El gel fue fotografiado bajo luz UV utilizando un sistema de documentación de gel. <img alt="Figura 2" src="/files/ftp_upload/55463/55463fig2.jpg" /> Figura2: Pulsada-Field Gel Electroforesis (PFGE) de ADN genómico oidio purificada. Carril 1: patrones de peso molecular, con la banda más alta a 48,5 kpb y el más bajo en 8,1 kpb. Los carriles 2 y 5: patrones de peso molecular que muestran bandas de 20, 10, 7, 5, 4, 3, 2 y 1,5 kpb (en la parte inferior de la imagen del gel). Carril 3: una muestra de ADN marginal, con la mayoría del ADN entre 20 y 48,5 kpb de tamaño. Carril 4: una muestra de ADN aceptable, con la mayoría del ADN&gt; 48,5 kpb (*). Las muestras se realizaron a 75 V durante 15 h utilizando un programa de forma de onda de PFGE 5-80 kpb. tinte de ADN-tinción se añadió al gel después de la electroforesis y el gel se visualizó bajo luz UV utilizando un sistema de documentación de gel. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Reactivo </td><td> Concentración final </td></tr><tr><td> Metab de potasioisulfite (K 2 S 2 O 5) </td><td> 0,25 M </td></tr><tr><td> Tampón Tris pH 7,5 </td><td> 0,2 M </td></tr><tr><td> ácido etilendiaminotetraacético (EDTA) </td><td> 50 mM </td></tr><tr><td> El cloruro de sodio (NaCl) </td><td> 2 M </td></tr><tr><td> bromuro de cetiltrimetilamonio (CTAB) </td><td> 2% v / v </td></tr></tbody></table> Tabla 1: Preparación de tampón de lisis. Llevar a un volumen de 5 ml con dH 2 O. <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td> Objetivo </td><td> Nombre imprimación </td><td fo:width="2.8in"> Secuencia del cebador </td><td> Tm (° C) </td><td> Tamaño esperado del Producto (pb) </td></tr><tr><td rowspan="2"> ITS2 fúngica </td><td> FW (ITS9) </td><td> GAACGCAGCRAAIIGYGA </td><td> 56-61,3 </td><td rowspan="2"> 336 </td></tr><tr><td> RV (ITS4) </td><td> TCCTCCGCTTATTGATATGC </td><td> 52.1 </td></tr><tr><td rowspan="2"> Bacteriana 16S V4 </td><td> FW (515F) </td><td> GTGCCAGCMGCCGCGGTAA </td><td> 63,8-66,5 </td><td rowspan="2"> 331 </td></tr><tr><td> RV (805R) </td><td> GGACTACHVGGGTWTCTAAT </td><td> 46,9-53,8 </td></tr><tr><td rowspan="2"> Bacterianas 16S V4-V5 </td><td> FW (515F-Y) </td><td> GTGYCAGCMGCCGCGGTAA </td><td> 60,8-66,5 </td><td rowspan="2"> 450 </td></tr><tr><td> RV (926R) </td><td> CCGYCAATTYMTTTRAGTTT </td><td> 43,9-53,8 </td></tr><tr><td rowspan="2"> Hongos 18S V4 </td><td> FW </td><td> CCAGCASCYGCGGTAATTCC </td><td> 58,7-61,5 </td><td rowspan="2"> 431 </td></tr><tr><td> RV </td><td> ACTTTCGTTCTTGATYRA </td><td> 43,2-48,3 </td></tr><tr><td rowspan="2"> Cucumis sativus PDS (LOC101204524) </td><td> CsPDS F </td><td> GTGAGTAAGGTTACCGTTTGGGGCTTATCCCAAT </td><td> 63.8 </td><td rowspan="2"> 750 </td></tr><tr><td> R CsPDS </td><td> GCGTGAGCTCGGTACTCTCATCCACTCTTGCAC </td><td> 66.6 </td></tr></tbody></table> Tabla 2: Cebadores para la Evaluación de la contaminación.

Watch this Scientific Journal Video about Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing at JoVE.com

Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing

Described here is a method for the extraction, purification, and quality control of genomic DNA from the obligate biotrophic fungal pathogen, powdery mildew, for use in long-read genome sequencing.

Purificación de ADN de alto peso molecular genómico de oídio para Long-Read Sequencing

The powdery mildew fungi are a group of economically important fungal plant pathogens. Relatively little is known about the molecular biology and genetics ...

purification-high-molecular-weight-genomic-dna-from-powdery-mildew

Nanyang Technological University

Research

JoVE Journal

Genetics

11.6K vistas.  University of California Berkeley. Described here is a method for the extraction, purification, and quality control of genomic DNA from the obligate biotrophic fungal pathogen, powdery mildew, for use in long-read genome sequencing.

Video: Purification of High Molecular Weight Genomic DNA from Powdery Mildew for Long-Read Sequencing

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Secuenciación de captura de ADN de unión a metil-para tejidos del paciente

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Investigación

Genética

Optimization and Comparative Analysis of Plant Organellar DNA Enrichment Methods Suitable for Next-generation Sequencing

Plant organellar genomes contain large, repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic fragments. Organellar genomes also exist in admixtures within a given cell or tissue type (heteroplasmy), and an abundance of subtypes may change throughout development or when under stress (sub-stoichiometric shifting). Next-generation sequencing (NGS) technologies are required to obtain deeper understanding of organellar genome structure and function. Traditional sequencing studies use several methods to obtain organellar DNA: (1) If a large amount of starting tissue is used, it is homogenized and subjected to differential centrifugation and/or gradient purification. (2) If a smaller amount of tissue is used (i.e., if seeds, material, or space is limited), the same process is performed as in (1), followed by whole-genome amplification to obtain sufficient DNA. (3) Bioinformatics analysis can be used to sequence the total genomic DNA and to parse out organellar reads. All these methods have inherent challenges and tradeoffs. In (1), it may be difficult to obtain such a large amount of starting tissue; in (2), whole-genome amplification could introduce a sequencing bias; and in (3), homology between nuclear and organellar genomes could interfere with assembly and analysis. In plants with large nuclear genomes, it is advantageous to enrich for organellar DNA to reduce sequencing costs and sequence complexity for bioinformatics analyses. Here, we compare a traditional differential centrifugation method with a fourth method, an adapted CpG-methyl pulldown approach, to separate the total genomic DNA into nuclear and organellar fractions. Both methods yield sufficient DNA for NGS, DNA that is highly enriched for organellar sequences, albeit at different ratios in mitochondria and chloroplasts. We present the optimization of these methods for wheat leaf tissue and discuss major advantages and disadvantages of each approach in the context of sample input, protocol ease, and downstream application.

The comparison and optimization of two plant organellar DNA enrichment methods are presented: traditional differential centrifugation and fractionation of the total gDNA based on methylation status. We assess the resulting DNA quantity and quality, demonstrate performance in short-read next-generation sequencing, and discuss the potential for use in long-read single-molecule sequencing.

Optimización y Análisis Comparativo de Métodos de Enriquecimiento de ADN de Organelos Vegetales Adecuados para Secuenciación de Próxima Generación

Plant organellar genomes contain large, repetitive elements that may undergo pairing or recombination to form complex structures and/or sub-genomic ...

Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution based analysis methodology (nucleosome density ChIP-seq; ndChIP-seq) that enables the generation of combined measurements of micrococcal nuclease (MNase) accessibility with histone modification genome-wide. Nucleosome position and local density, and the posttranslational modification of their histone subunits, act in concert to regulate local transcription states. Combinatorial measurements of nucleosome accessibility with histone modification generated by ndChIP-seq allows for the simultaneous interrogation of these features. The ndChIP-seq methodology is applicable to small numbers of primary cells inaccessible to cross-linking based ChIP-seq protocols. Taken together, ndChIP-seq enables the measurement of histone modification in combination with local nucleosome density to obtain new insights into shared mechanisms that regulate RNA transcription within rare primary cell populations.

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) methodology for the generation of sequence datasets suitable for a nucleosome density ChIP-seq analytical framework integrating micrococcal nuclease (MNase) accessibility with histone modification measurements.

Generación de inmunoprecipitación de la cromatina nativa secuenciación bibliotecas para el análisis de densidad de nucleosoma

We present a modified native chromatin immunoprecipitation sequencing (ChIP-seq) experimental protocol compatible with a Gaussian mixture distribution ...

G2-seq: A High Throughput Sequencing-based Technique for Identifying Late Replicating Regions of the Genome

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have been directed toward elucidation of the location and timing of initiation of genome duplication rather than its completion. However, it is critical that we understand regions of the genome that are last to complete replication, because these regions suffer elevated levels of chromosomal breakage and mutation, and they have been associated with both disease and aging. Here we describe how we have extended a technique that has been used to monitor replication initiation to instead identify those regions of the genome last to complete replication. This approach is based on a combination of flow cytometry and high throughput sequencing. Although this report focuses on the application of this technique to yeast, the approach can be used with any cells that can be sorted in a flow cytometer according to DNA content.

We describe a technique for combining flow cytometry and high throughput sequencing to identify late replicating regions of the genome.

G2-seq: Una alto rendimiento basado en la secuencia técnica para identificar replicación tardía de regiones del genoma

Numerous techniques have been developed to follow the progress of DNA replication through the S phase of the cell cycle. Most of these techniques have ...

Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with a number of challenges including sample preservation quality, degraded DNA, and destructive sampling of rare specimens. In order to more effectively use herbarium material in large sequencing projects, a dependable and scalable method of DNA isolation and library preparation is needed. This paper demonstrates a robust, beginning-to-end protocol for DNA isolation and high-throughput library construction from herbarium specimens that does not require modification for individual samples. This protocol is tailored for low quality dried plant material and takes advantage of existing methods by optimizing tissue grinding, modifying library size selection, and introducing an optional reamplification step for low yield libraries. Reamplification of low yield DNA libraries can rescue samples derived from irreplaceable and potentially valuable herbarium specimens, negating the need for additional destructive sampling and without introducing discernible sequencing bias for common phylogenetic applications. The protocol has been tested on hundreds of grass species, but is expected to be adaptable for use in other plant lineages after verification. This protocol can be limited by extremely degraded DNA, where fragments do not exist in the desired size range, and by secondary metabolites present in some plant material that inhibit clean DNA isolation. Overall, this protocol introduces a fast and comprehensive method that allows for DNA isolation and library preparation of 24 samples in less than 13 h, with only 8 h of active hands-on time with minimal modifications.

This article demonstrates a detailed protocol for DNA isolation and high-throughput sequencing library construction from herbarium material including rescue of exceptionally poor-quality DNA.

Robusto de ADN y la secuenciación de alto rendimiento biblioteca construcción de especímenes de herbario

Herbaria are an invaluable source of plant material that can be used in a variety of biological studies. The use of herbarium specimens is associated with ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Detección de eventos raros usando ADN Error corregido y secuenciación de ARN

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Isolating, Sequencing and Analyzing Extracellular MicroRNAs from Human Mesenchymal Stem Cells

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, milk and urine. One subset of these RNAs are the posttranscriptional regulators &#8211; microRNAs (miRNAs). To delineate the miRNAs produced by specific cell types, in vitro culture systems can be used to harvest and profile exRNAs derived from one subset of cells. The secreted factors of mesenchymal stem cells are implicated in alleviating numerous diseases and is used as the in vitro model system here. This paper describes the process of collection, purification of small RNA and library generation to sequence extracellular miRNAs. ExRNAs from culture media differ from cellular RNA by being low RNA input samples, which calls for optimized procedures. This protocol provides a comprehensive guide to small exRNA sequencing from culture media, showing quality control checkpoints at each step during exRNA purification and sequencing.

This protocol demonstrates how to purify extracellular microRNAs from cell culture media for small RNA library construction and next generation sequencing. Various quality control checkpoints are described to allow readers to understand what to expect when working with low input samples like exRNAs.

Aislamiento, secuenciación y análisis de microRNA extracelular de las células madre mesenquimales humanas

Extracellular and circulating RNAs (exRNA) are produced by many cell types of the body and exist in numerous bodily fluids such as saliva, plasma, serum, ...

Sequencing of mRNA from Whole Blood using Nanopore Sequencing

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, and was deployed to West Africa during the recent Ebola virus epidemic, highlighting this possibility. In addition to its practical advantages (low cost, ease of equipment transport and use), this technology also provides fundamental advantages over second-generation sequencing approaches, particularly the very long read length, ability to directly sequence RNA, and real-time availability of data. Raw read accuracy is lower than with other sequencing platforms, which represents the main limitation of this technology; however, this can be partially mitigated by the high read depth generated. Here, we present a field-compatible protocol for sequencing of the mRNAs encoding for Niemann-Pick C1, which is the cellular receptor for ebolaviruses. This protocol encompasses extraction of RNA from animal blood samples, followed by RT-PCR for target enrichment, barcoding, library preparation, and the sequencing run itself, and can be easily adapted for use with other DNA or RNA targets.

Nanopore sequencing is a novel technology that allows cost-effective sequencing in remote locations and resource-poor settings. Here, we present a protocol for sequencing of mRNAs from whole blood that is compatible with such conditions.

Secuenciación de ARNm de sangre entera utilizando secuenciación de nanoporos

Sequencing in remote locations and resource-poor settings presents unique challenges. Nanopore sequencing can be successfully used under such conditions, ...

Identification of Circular RNAs using RNA Sequencing

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein interactions, and regulation of parental gene transcription. In classical next generation RNA sequencing (RNA-seq), circRNAs are typically overlooked as a result of poly-A selection during construction of mRNA libraries, or are found at very low abundance, and are therefore difficult to isolate and detect. Here, a circRNA library construction protocol was optimized by comparing library preparation kits, pre-treatment options and various total RNA input amounts. Two commercially available whole transcriptome library preparation kits, with and without RNase R pre-treatment, and using variable amounts of total RNA input (1 to 4 &#181;g), were tested. Lastly, multiple tissue types; including liver, lung, lymph node, and pancreas; as well as multiple brain regions; including the cerebellum, inferior parietal lobe, middle temporal gyrus, occipital cortex, and superior frontal gyrus; were compared to evaluate circRNA abundance across tissue types. Analysis of the generated RNA-seq data using six different circRNA detection tools (find_circ, CIRI, Mapsplice, KNIFE, DCC, and CIRCexplorer) revealed that a stranded total RNA library preparation kit with RNase R pre-treatment and 4 &#181;g RNA input is the optimal method for identifying the highest relative number of circRNAs. Consistent with previous findings, the highest enrichment of circRNAs was observed in brain tissues compared to other tissue types.

Circular RNAs (circRNAs) are non-coding RNAs that may have roles in transcriptional regulation and mediating interactions between proteins. Following assessment of different parameters for construction of circRNA sequencing libraries, a protocol was compiled utilizing stranded total RNA library preparation with RNase R pre-treatment and is presented here.

Identificación de ARN circulares mediante secuenciación de ARN

Circular RNAs (circRNAs) are a class of non-coding RNAs involved in functions including micro-RNA (miRNA) regulation, mediation of protein-protein ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Generación de modificaciones genómicas definidas utilizando CRISPR-CAS9 en células madre pluripotentes humanas

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...