Name: quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation
Uploaded: 2014-11-26T14:00:00.000+00:00
Duration: 12 min 42 s
Description: Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

We thank Hongjae Sunwoo for helpful advice for oligonucleotide design in RNA FISH. We also thank Serenity Curtis for editing the manuscript. N.Y. was supported by a Postdoctoral Fellowship for Research Abroad of the Japan Society for the Promotion of Science (JSPS). This work was supported by the NIH (RO1-GM102184), the March of Dimes Research Foundation (#6-FY12-337), and the Developmental Fund and Trustee Grant at Cincinnati Children's Hospital Medical Center to Y.O.

1. Preparación de la sonda <ol><li> Obtener múltiples oligonucleótidos únicos en Xist (oligonucleótidos 20-30 nucleótidos de longitud, 63-65 ºC de temperatura de fusión, Tabla 1) con una modificación 5&#39;-amino y suspender en agua. </li><li> Piscina cantidades equimolares de los oligonucleótidos con 5&#39;-amino modificación (en total 4,5 g) y la etiqueta con colorante fluorescente-amina reactiva siguiendo las instrucciones del fabricante. <ol><li> Disolver los oligonucleótidos agrupados en últimos 5 l de agua libre de nucleasa y añadir 3 l de 1 M de bicarbonato de sodio a la solución de oligonucleótidos. </li><li> Añadir 2 l DMSO al vial de tinte y de vórtice-amina reactiva brevemente. </li><li> Mezclar la solución de oligonucleótido con el colorante reactivo en DMSO y se incuba la mezcla a temperatura ambiente durante 1 h en la oscuridad. </li></ol></li><li> Purificar las sondas de oligonucleótidos marcados con fluorescencia por la columna G-25 seguido por precipitación con etanol. <ol><li&gt; Centrifugar la columna G-25 a 750 xg durante 1 min para eliminar el exceso de tampón de almacenamiento. </li><li> Añadir 40 l de agua libre de nucleasa a la mezcla de etiquetado producido en la Etapa 1.2.3 y aplicar a la columna G-25. Centrifugar a 750 xg durante 2 min. </li><li> Añadir 50 l de agua libre de nucleasa, 10 l 3 M acetato de sodio (pH 5,2) y 250 l de etanol a la sonda purificada de la etapa 1.3.2. Conservar a -80 ° C durante 30 minutos y se centrifuga a 21.000 xg durante 15 min a 4 ° C. </li><li> Lavar los oligonucleótidos precipitados una vez con 1 ml de etanol al 70%. </li><li> Vuelva a suspender en 50 l de agua libre de nucleasa o TE (10 mM Tris-HCl, pH 7,5; EDTA 1 mM) para una concentración final de aproximadamente 10 mM. </li></ol></li><li> Diluir las sondas de oligonucleótidos marcados con fluorescencia a una concentración final de 250 nM con tampón de hibridación (10% formamida; 2x SSC [NaCl 300 mM; citrato de sodio 30 mM]; 2 mg / ml BSA; sulfato de dextrano al 10%). NOTA: Con este protocolo FISH rápida, oligonucleótido pbatas en Xist fueron diseñados y utilizados a una concentración mayor que el protocolo normal de FISH usando sondas de oligonucleótidos con el fin de acortar el tiempo de incubación para la hibridación. </li></ol> 2. Preparación de los portaobjetos NOTA: Los portaobjetos se puede preparar para la inmuno-FISH utilizando madre de ratón embrionarias (ES) o el cuerpo embrioide (EB) diferenciación de las células 20, 21 ya sea por crecimiento de ellos directamente en un portaobjetos tratados con poli-lisina o utilizando cytospin con suspensión celular. Aquí, se muestra la preparación de diapositivas cytospin. <ol><li> Aspirar el medio de cultivo en una placa de 6 pocillos. Lavar con PBS (temperatura ambiente), y aspirar a fondo. </li><li> Añadir 0,5 ml de tripsina al plato de 6 pocillos, se incuba durante 5-10 minutos a 37 ° C. </li><li> Añadir 5 ml de medio y dispersar las células pipeteando suavemente hacia arriba y abajo varias veces. </li><li> Transferir las células a un tubo de 15 ml, centrifugar durante 5 min a 200 xg a temperatura ambiente. </li><li> Deseche el medio de unad suspender suavemente las células en 2 ml de PBS. </li><li> Contar las células usando un hemocitómetro, y se diluye la suspensión celular en 4 x 10 5 células / ml de PBS. </li><li> Montar una diapositiva, una tarjeta de filtro y una cámara con un clip y colocarlos en las ranuras correspondientes en el rotor de la cytospin. Añadir 250 l de cada muestra preparada en el paso 2.6 en cada cámara de las unidades ensambladas en el cytospin. Centrifugar a 1500 rpm durante 10 min a temperatura ambiente. </li><li> Llenar 3 frascos de Coplin en hielo con 40 ml cada uno de tampón PBS, CSK enfriado con hielo (tubos 10 mM, pH 6,8; NaCl 100 mM; sacarosa 300 mM; 3 mM de MgCl 2), y de amortiguamiento CSKT (tampón CSK con 0,5% Triton X-100), respectivamente. </li><li> Después de que se terminó la cytospin, transferir rápidamente el portaobjetos en PBS enfriado con hielo y se incuba durante 5 min. </li><li> Transferir el portaobjetos en tampón de CSK enfriado con hielo y se incuba durante 1 min. </li><li> Transferir el portaobjetos en tampón de CSKT enfriado con hielo y se incuba durante 5 min. </li><li> Transferir el portaobjetos de nuevo en helada CSK buffer e incubar durante 1 min. </li><li> Transferir el portaobjetos en 4% de paraformaldehído en PBS y se incuba durante 10 min a temperatura ambiente. </li></ol> 3. La inmunofluorescencia <ol><li> Colocar los portaobjetos en un tarro Coplin con PBST (1x PBS con 0,1% de Tween-20) durante varios segundos. </li><li> Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido fuera de la diapositiva y colocarla en una caja de pipeta de punta vacío con agua. Superposición de la diapositiva con 40 l de solución de bloqueo (1x PBS, 1% de BSA, 0,1% de Tween-20), colocar suavemente un cubreobjetos, y se incuba durante 10 min a temperatura ambiente. </li><li> Retire el cubreobjetos, eliminar la solución de bloqueo, y añadir 40 l de anticuerpo primario diluido H3K27me3 histona a una concentración de 1: 500 en solución de bloqueo. Coloque el cubreobjetos de nuevo en el porta y se incuba durante 30 min a temperatura ambiente. NOTA: Un inhibidor de RNasa en la solución de bloqueo podría ser útil para preservar ARN en este ARN FISProtocolo H cuando se utilizan anticuerpos policlonales. </li><li> Lave deslice 2 veces en frascos Coplin llenos de PBST, durante 5 minutos cada uno, agitando suavemente durante el lavado. </li><li> Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido y coloque el portaobjetos de nuevo en la caja de propina. Superposición con 40 l de anticuerpo secundario (1: 500) diluido en solución de bloqueo, colocar un cubreobjetos, y se incuba durante 15 min en la oscuridad. Para los pasos siguientes, mantenga la diapositiva en la oscuridad en todo momento. </li><li> Lavar 2 veces en Coplin frascos con PBST como en el paso 3.4. </li></ol> 4. ARN FISH con sondas de oligonucleótidos <ol><li> Pre-calentar un cuadro de pipeta de punta vacío con agua en la parte inferior para evitar que las diapositivas de secado a 37 ° C para el ARN FISH en el paso 4.3. </li><li> Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido fuera de la diapositiva desde el paso 3.6 y colocar la placa en la caja de pipeta de punta con water en la parte inferior. Añadir 500 l de tampón de lavado FISH (10% de formamida en 2x SSC) en la diapositiva y se incuba durante 5 min a temperatura ambiente. </li><li> Retire la solución de lavado FISH, añadir 8 l de sondas de oligonucleótidos en la diapositiva, coloque una hoja de la cubierta, y la transferencia de la diapositiva a una caja de pipeta de punta pre calentado con agua en el fondo; incubar a 37 ° C durante 1-2 horas. </li><li> Coloque 3 frascos pre-calentado Coplin en un baño de agua a 37 ° C con tampón de lavado FISH, FISH tampón de lavado con DAPI, y 2x SSC. </li><li> Después de 1-2 horas de incubación de ARN FISH, poner la diapositiva en el tampón de lavado FISH precalentado. </li><li> Incubar el portaobjetos durante unos minutos hasta que el cubreobjetos se cae de la diapositiva. </li><li> Colocar el portaobjetos de nuevo en el tampón de lavado, y continuar la incubación durante 5 min. </li><li> Transferir la diapositiva a otra jarra Coplin con tampón de lavado pre-calentado FISH con 0,5 ng / ml DAPI y se incuba durante 5 min. </li><li> Transferir la diapositiva a otra jarra Coplin con pre-calentado 2x SSC y se incuba durante 5 millasn. </li><li> Colocar los portaobjetos en una inclinación que permite buffer restante a fluir por el tobogán. Limpie cuidadosamente el exceso de líquido y coloque el portaobjetos de nuevo en una caja de punta seca. Añadir 4 l de antifade con DAPI sobre el portaobjetos y colocar un cubreobjetos. </li><li> Sellar el cubreobjetos con esmalte de uñas y observar con un microscopio. La corredera se puede almacenar a 4 ° C en la oscuridad durante unos pocos meses. </li></ol>

<ol>
	<li>Payer, B., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+chromosome+dosage+compensation:+how+mammals+keep+the+balance.">X chromosome dosage compensation: how mammals keep the balance.</a> Annu Rev Genet. 42, 733-772 (2008).</li><li>Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gracefully+ageing+at+50,+X-chromosome+inactivation+becomes+a+paradigm+for+RNA+and+chromatin+control.">Gracefully ageing at 50, X-chromosome inactivation becomes a paradigm for RNA and chromatin control.</a> Nat Rev Mol Cell Biol. 12, 815-826 (2011).</li><li>Gendrel, A. V., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fifty+years+of+X-inactivation+research.">Fifty years of X-inactivation research.</a> Development. 138, 5049-5055 (2011).</li><li>Froberg, J. E., Yang, L., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guided+by+RNAs:+X-inactivation+as+a+model+for+lncRNA+function.">Guided by RNAs: X-inactivation as a model for lncRNA function.</a> J Mol Biol. 425, 3698-3706 (2013).</li><li>Penny, G. D., Kay, G. F., Sheardown, S. A., Rastan, S., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Requirement+for+Xist+in+X+chromosome+inactivation.">Requirement for Xist in X chromosome inactivation.</a> Nature. 379, 131-137 (1996).</li><li>Marahrens, Y., Panning, B., Dausman, J., Strauss, W., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xist-deficient+mice+are+defective+in+dosage+compensation+but+not+spermatogenesis.">Xist-deficient mice are defective in dosage compensation but not spermatogenesis.</a> Genes Dev. 11, 156-166 (1997).</li><li>Clemson, C. M., McNeil, J. A., Willard, H. F., Lawrence, J. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=XIST+RNA+paints+the+inactive+X+chromosome+at+interphase:+evidence+for+a+novel+RNA+involved+in+nuclear/chromosome+structure.">XIST RNA paints the inactive X chromosome at interphase: evidence for a novel RNA involved in nuclear/chromosome structure.</a> J Cell Biol. 132, 259-275 (1996).</li><li>Sado, T., Brockdorff, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+understanding+chromosome+silencing+by+the+long+non-coding+RNA.">Advances in understanding chromosome silencing by the long non-coding RNA.</a> Xist. Phil Trans R Soc B. 368, 20110325-20 (2013).</li><li>Zhao, J., Sun, B. K., Erwin, J. A., Song, J. J., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polycomb+proteins+targeted+by+a+short+repeat+RNA+to+the+mouse+X+chromosome.">Polycomb proteins targeted by a short repeat RNA to the mouse X chromosome.</a> Science. 322, 750-756 (2008).</li><li>Plath, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+histone+H3+lysine+27+methylation+in+X+inactivation.">Role of histone H3 lysine 27 methylation in X inactivation.</a> Science. 300, 131-135 (2003).</li><li>Silva, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Establishment+of+histone+h3+methylation+on+the+inactive+X+chromosome+requires+transient+recruitment+of+Eed-Enx1+polycomb+group+complexes.">Establishment of histone h3 methylation on the inactive X chromosome requires transient recruitment of Eed-Enx1 polycomb group complexes.</a> Dev Cell. 4, 481-495 (2003).</li><li>Gall, J. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differential+synthesis+of+the+genes+for+ribosomal+RNA+during+amphibian+oogenesis.">Differential synthesis of the genes for ribosomal RNA during amphibian oogenesis.</a> Proc Natl Acad Sci U S A. 60, 553-560 (1968).</li><li>Femino, A. M., Fay, F. S., Fogarty, K., Singer, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+of+single+RNA+transcripts+in+situ.">Visualization of single RNA transcripts in situ.</a> Science. 280, 585-590 (1998).</li><li>Raj, A., van den Bogaard, P., Rifkin, S. A., van Oudenaarden, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Imaging+individual+mRNA+molecules+using+multiple+singly+labeled+probes.">Imaging individual mRNA molecules using multiple singly labeled probes.</a> Nat Methods. 5, 877-879 (2008).</li><li>Chaumeil, J., Augui, S., Chow, J. C., Heard, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Combined+immunofluorescence,+RNA+fluorescent+in+situ+hybridization,+and+DNA+fluorescent+in+situ+hybridization+to+study+chromatin+changes,+transcriptional+activity,+nuclear+organization,+and+X-chromosome+inactivation.">Combined immunofluorescence, RNA fluorescent in situ hybridization, and DNA fluorescent in situ hybridization to study chromatin changes, transcriptional activity, nuclear organization, and X-chromosome inactivation.</a> Methods Mol Biol. 463, 297-308 (2008).</li><li>Katayama, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antisense+transcription+in+the+mammalian+transcriptome.">Antisense transcription in the mammalian transcriptome.</a> Science. 309, 1564-1566 (2005).</li><li>Ogawa, Y., Xite Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X-inactivation+intergenic+transcription+elements+that+regulate+the+probability+of+choice.">X-inactivation intergenic transcription elements that regulate the probability of choice.</a> Mol Cell. 11, 731-743 (2003).</li><li>Panning, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=X+inactivation+in+mouse+ES+cells:+histone+modifications+and+FISH.">X inactivation in mouse ES cells: histone modifications and FISH.</a> Methods Enzymol. 376, 419-428 (2004).</li><li>Khalil, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Many+human+large+intergenic+noncoding+RNAs+associate+with+chromatin-modifying+complexes+and+affect+gene+expression.">Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression.</a> Proc Natl Acad Sci U S A. 106, 11667-11672 (2009).</li><li>Martin, G. R., Evans, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Differentiation+of+clonal+lines+of+teratocarcinoma+cells:+formation+of+embryoid+bodies+in+vitro.">Differentiation of clonal lines of teratocarcinoma cells: formation of embryoid bodies in vitro.</a> Proc Natl Acad Sci U S A. 72, 1441-1445 (1975).</li><li>Lee, J. T., Lu, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+mutagenesis+of+Tsix+leads+to+nonrandom+X+inactivation.">Targeted mutagenesis of Tsix leads to nonrandom X inactivation.</a> Cell. 99, 47-57 (1999).</li><li>Zhang, L. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Telomeric+RNAs+mark+sex+chromosomes+in+stem+cells.">Telomeric RNAs mark sex chromosomes in stem cells.</a> Genetics. 182, 685-698 (2009).</li><li>Raj, A., Tyagi, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detection+of+individual+endogenous+RNA+transcripts+in+situ+using+multiple+singly+labeled+probes.">Detection of individual endogenous RNA transcripts in situ using multiple singly labeled probes.</a> Methods Enzymol. 472, 365-386 (2010).</li><li>Kimura, H., Hayashi-Takanaka, Y., Goto, Y., Takizawa, N., Nozaki, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+organization+of+histone+H3+modifications+as+revealed+by+a+panel+of+specific+monoclonal+antibodies.">The organization of histone H3 modifications as revealed by a panel of specific monoclonal antibodies.</a> Cell Struct Funct. 33, 61-73 (2008).</li><li>Ogawa, Y., Sun, B. K., Lee, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intersection+of+the+RNA+interference+and+X-inactivation+pathways.">Intersection of the RNA interference and X-inactivation pathways.</a> Science. 320, 1336-1341 (2008).</li><li>Kohlmaier, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+chromosomal+memory+triggered+by+Xist+regulates+histone+methylation+in+X+inactivation.">A chromosomal memory triggered by Xist regulates histone methylation in X inactivation.</a> PLoS Biol. 2, 171 (2004).</li><li>Wang, K. C., Chang, H. Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+long+noncoding+RNAs.">Molecular mechanisms of long noncoding RNAs.</a> Mol Cell. 43, 904-914 (2011).</li></ol>

No conflicts of interest declared.

En este trabajo, hemos presentado un protocolo de inmuno-FISH rápida que tarda menos de 5 horas para completar la preparación de diapositivas, Xist ARN FISH, y la inmunofluorescencia para H3K27me3. En comparación con el enfoque general de inmuno-FISH para Xist ARN de detección, que por lo general tiene una noche de incubación de ARN FISH, este protocolo no sólo reduce significativamente el tiempo pasado sino que también mejora la sensibilidad inmune-FISH usando sondas de oligonucleótidos. Desde Xist es altamente transcrito durante la inactivación del cromosoma X-y su transcripción se encuentra a acumularse intensamente en el Xi en cis, es fácil de detectar Xist RNA señal en la diferenciación de células diferenciadas y por ARN FISH utilizando un tiempo relativamente breve incubación. Este protocolo inmuno-FISH podría aplicarse para otras proteínas de interés y abundante ARN, aunque la optimización de inmunofluorescencia y ARN FISH puede ser requerida. Con el fin de aplicar el Protocolo a otros ARN, el numtendría que ser considerado, seguido de optimización de ensayo y error de la concentración de la sonda, tiempo de incubación y la temperatura para el ARN FISH BER de posibles sondas de oligonucleótidos. Un ejemplo de otras aplicaciones es nuestro éxito anterior en la detección de ARN telomérico utilizando sondas LNA individuales 22. Para el diseño de la sonda y la preparación para la detección de blancos bajos de ARN abundantes, consulte el artículo de Raj y Tyagi 23. Otra cuestión que debe considerarse es el paso de permeabilización. Se requiere una cuidadosa consideración respecto diferente condición permeabilización; por ejemplo, los efectos más suaves que lo que se describe en el protocolo pueden ocurrir con la permeabilización después de la fijación 15. Varios procedimientos de permeabilización también deben tenerse en cuenta al llevar a cabo la inmuno-FISH utilizando diferentes tipos de células. El orden de inmunofluorescencia y ARN FISH también puede afectar a la detección de proteínas diana, modificaciones y ARN mediante inmuno-FISH. Si ARN FISH es realizared antes de inmunofluorescencia, una hora de incubación durante el segmento de ARN FISH es suficiente para detectar Xist RNA señal. Sin embargo, desde la formamida contenida en el tampón de hibridación y tampón de lavado FISH afecta negativamente H3K27me3 inmunofluorescencia, siempre realizamos H3K27me3 inmunofluorescencia antes de Xist ARN FISH en este protocolo. Para otras aplicaciones, el orden de los procedimientos dependerá de las proteínas diana y modificaciones epigenéticas a ser observados por inmunofluorescencia. A medida que el anticuerpo primario se utilizó para H3K27me3 inmunofluorescencia tiene un alto título y especificidad para H3K27me3 24, que son capaces de utilizar un tiempo de incubación más corto para inmunofluorescencia. Sin embargo, el tiempo de reacción y la temperatura para la inmunotinción dependen del anticuerpo utilizado y por lo tanto se necesita optimización para cada anticuerpo. El uso de sondas de oligonucleótidos, Xist ARN de detección por el ARN FISH se mejoró significativamente. En nuestros estudios anteriores, encontramos que un subconjunto de difcélulas dife- con tinción H3K27me3 en el Xi no están asociados con la señal de Xist ARN 25. Desde modificación H3K27me3 en el Xi está asociada con el reclutamiento PRC2 por Xist RNA 9-11, 26, especulamos que esto era debido a la penetración ineficiente de ribosondas en los núcleos en comparación con el anticuerpo para inmunofluorescencia. Mediante el uso de sondas de oligonucleótidos en este protocolo, se observó que la señal H3K27me3 en la diferenciación de las células femeninas casi siempre co-localizados con Xist ARN (Figura 1). Este protocolo inmuno-FISH rápida nos permite obtener una instantánea de los cambios dinámicos en torno Xist lncRNA y ofrece una nueva herramienta para ayudar a obtener una mejor comprensión de la forma en lncRNA funciona. IncRNAs afectar varias funciones celulares como la impronta genómica, regulación génica, la traducción del ARN y ARN maduración 27. El desarrollo de una mayor comprensión de la función diversas desempeñado por lncRNA ayudaría a impulsar el campo hacia adelante y permitir futuros descubrimientos en la regulación de procesos celulares vitales en el cuerpo humano, así como contribuir al desarrollo de posibles objetivos para los tratamientos de la enfermedad. Dado que este protocolo puede ser fácilmente optimizado con respecto a otros marcadores y lncRNAs de interés, es una gran herramienta para ayudar a enfrentar los misterios de diversos lncRNAs en las células.

Mamíferos inactivación del cromosoma X (XCI) es una estrategia para compensar el desequilibrio en la dosificación del gen ligado al cromosoma X entre XX y XY, en el que uno de los dos cromosomas X en las mujeres es transcripcionalmente inactiva 1. Inactivación del cromosoma X es un gran modelo para el sistema a largo ARN no codificante (lncRNA) investigación. Inactivación del cromosoma X está regulado por múltiples lncRNAs, y ha sido ampliamente estudiado en los últimos decenios para descubrir los mecanismos de diafonía entre lncRNAs, transcripción, estructura de la cromatina y la organización nuclear 2, 3. El centro de la inactivación X (XIC), ubicado en el cromosoma X es un locus genético complejo compuesto de un número de genes que producen ARN no codificantes 4. -X inactivo transcripción específico (Xist) lncRNA en los mamíferos euterios es uno de esos lncRNA que desempeña un papel crucial en la inactivación del cromosoma X 5,6. Transcripciones Xist rodean la ubicación de la futura Xi para iniciar inactivación del cromosoma X, y aparece como una nube cuando se visualizan utilizando ARN FISH; esta formación se denomina como el &quot;Xist nube&quot; 7. Desde Xist ARN interactúa con varias enzimas de modificación de la cromatina, se observa co-localización de las nubes Xist con diferentes modificaciones epigenéticas de la cromatina y la transcripción en silencio durante represivo X-inactivación del cromosoma 8. Por ejemplo, Xist ARN interactúa con polycomb complejo represivo 2 (PRC2) que es responsable de H3K27me3 e induce un estado represivo cromatina 9. La aparición de la nube Xist en el Xi y su co-localización con la modificación intensiva H3K27me3 representa un paisaje heterocromatina facultativa de la Xi 10,11. Técnicas citogenéticas, como el ADN / ARN FISH han recorrido un largo camino desde el método tradicional utilizando sondas radiomarcado 12 a las técnicas más recientes y avanzados con mayor sensibilidad yimágenes fluorescentes utilizando múltiples sondas de oligonucleótidos 13,14. ADN / ARN FISH junto con inmunofluorescencia se ha utilizado de forma rutinaria como una herramienta citológico de entender la organización espacio-temporal nuclear, la localización del ARN, la estructura de la cromatina y modificaciones. La preparación de la sonda estándar de la mayoría de ARN FISH implica el uso de plásmido o cromosoma artificial (BAC) clones bacterianos y su posterior etiquetado ya sea con la traducción nick o cebado aleatorio 15. Sin embargo, casi el 70% de los genes en ratones y 40% de los genes en los seres humanos muestran una superposición de sentido y antisentido transcripciones 16, por lo que requieren un método FISH específica de hebra a fin de distinguir sentido y antisentido transcripciones. In vitro sondas de ARN transcritos (ribosonda ) se utilizan a menudo para el capítulo específico de ARN FISH 17,18; sin embargo, esto implica la preparación de un clon de plásmido o producto de PCR con T7, SP6, o el promotor T3 y sintetizar ribosondas. Además, ribosondas derivado de genomaic ADN o ADNc a menudo contienen regiones no específicas y elementos repetitivos, que resultan en alto ruido de fondo. Otra cuestión es que ribosondas, que son unos pocos cientos de nucleótidos de longitud y contienen múltiples fluoróforos, no pueden penetrar de manera eficiente en el núcleo. Para evitar esto, múltiples sondas de oligonucleótidos más cortos marcados con un solo fluoróforo en el extremo han sido desarrollados que tienen una buena sensibilidad, potencia de la señal uniforme, y la facilidad de purificación y el manejo de 14. Además, los oligonucleótidos de ADN son generalmente más estable que el ARN. Se aplicó una estrategia similar de utilizar oligonucleótidos en Xist ARN FISH 19 con inmunofluorescencia para comprender la dinámica epigenéticas de la Xi inducidos por Xist lncRNA durante el proceso de inactivación del cromosoma X. Este protocolo describe la creación de sondas de oligonucleótidos y la preparación apropiada de las células, así como la utilización de inmunofluorescencia y ARN FISH. Xist ARN FISH utilizando múltiples oligonucleOtides es enfoque rentable en el largo plazo si Xist ARN FISH se realiza de forma rutinaria en el laboratorio de uno. Esta técnica se puede utilizar para identificar lncRNAs en las células mientras que la cartografía simultáneamente su co-localización con modificaciones o factores epigenéticos. Una ventaja importante del protocolo es la capacidad de modificar fácilmente para adaptarse a los propios intereses de investigación.

<table><tbody><tr><td>oligonucleotides with 5&amp;rsquo;-amino modification</td><td>IDT</td><td></td><td></td></tr><tr><td>Alexa Fluor 488 Reactive Dye</td><td>Life Technologies</td><td>A32750</td><td></td></tr><tr><td>MicroSpin G-25 columns</td><td>GE Healthcare</td><td>27-5325-01</td><td></td></tr><tr><td>Cytospin 2</td><td>Shandon</td><td>59900102</td><td></td></tr><tr><td>Bovine Serum Albumin, Molecular Biology Grade (for hybridization buffer)</td><td>Roche</td><td>10715859103</td><td></td></tr><tr><td>Histone H3K27me3 antibody</td><td>Active Motif</td><td>61017</td><td></td></tr><tr><td>Alexa Fluor 555 Goat Anti-Mouse, highly cross-adsorbed</td><td>Life Technologies</td><td>A21424</td><td></td></tr><tr><td>ProLong Gold antifade reagent</td><td>Life Technologies</td><td>P36931</td><td></td></tr></tbody></table>

quick fluorescent in situ hybridization protocol for xist rna combined with immunofluorescence of histone modification in x-chromosome inactivation

La combinación de ARN hibridación in situ fluorescente (FISH) con inmunofluorescencia (inmuno-FISH) crea una técnica que se puede emplear en el nivel de células individuales para detectar la dinámica espacial de la localización del ARN con la penetración simultánea en la localización de las proteínas, las modificaciones epigenéticas y otros detalles que puede ser resaltado mediante inmunofluorescencia. Inactivación del cromosoma X es un paradigma para largo ARN no codificante (lncRNA) mediada por silenciamiento génico. Transcripción específico (Xist) la acumulación lncRNA-X inactivo (llamado una nube de Xist) sobre uno de los dos cromosomas X en las hembras de mamíferos es un paso crítico para iniciar X-inactivación del cromosoma. ARN Xist interactúa directamente o indirectamente con diversas enzimas de la cromatina modificar y presenta distintos paisajes epigenéticos al cromosoma X inactivo (Xi). Una conocida seña de identidad de la epigenética Xi es la histona H3 trimetil-lisina 27 (H3K27me3) modificación. A continuación, describimos una forma sencilla y rápida inmuno-FISHProtocolo para la detección de Xist ARN utilizando ARN FISH con múltiples sondas de oligonucleótidos junto con inmunofluorescencia de H3K27me3 a examinar la localización de Xist ARN y modificaciones epigenéticas asociadas. El uso de sondas de oligonucleótidos resultados en un tiempo de incubación más corto y la detección más sensible de Xist ARN en comparación con el transcrito in vitro sondas de ARN (ribosondas). Este protocolo proporciona una poderosa herramienta para la comprensión de la dinámica de lncRNAs y su modificación epigenética asociada, la estructura de la cromatina, organización nuclear y la regulación transcripcional.

Imágenes representativas de rápida inmuno-FISH se muestran en la Figura 1A. Se detectó co-localización de la nube y H3K27me3 señal de Xist ARN en el Xi en la diferenciación de las células femeninas. Al día 12 de la diferenciación, más del 90% de las células EB tenía una nube Xist (Figura 1B). Sondas de oligonucleótidos corto penetraron de manera eficiente en los núcleos, que conduce a una visualización de casi todas las señales H3K27me3 co-localizada con Xist ARN (Figura 1C; 97%, n = 150). <img alt="Figura 1" src="/files/ftp_upload/52053/52053fig1highres.jpg" /> Figura 1: ARN Xist y H3K27me3 co-localizar en el Xi en la diferenciación de ratón EB (A) Inmuno-FISH para Xist ARN con H3K27me3 modificación en la diferenciación de las células EB femeninos en el día 12 en la diferenciación.. Sondas Xist fueron etiquetados con Alexa Fluor 488, y anti-H3K27me3 anticuerpo primario era elprotegidos por anti-IgG de ratón Alexa Fluor 555-anticuerpo secundario conjugado. Los núcleos se counterstained con DAPI. La región en caja se magnifica en los paneles inferiores. Las barras de escala:... 10 micras (B) Frecuencia de células cloud- y H3K27me3-positivos Xist en EB en 12 días a la diferenciación (C) Frecuencia de co-localización de Xist nube con la señal H3K27me3 en EB en 12 días a la diferenciación <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/52053/52053fig1large.jpg" target="_blank">favor haga clic aquí para ver una versión más grande de esta figura.</a> <table><tbody><tr><td> Xp1 </td><td> ggtaagtatccaaaaccccgttgg </td></tr><tr><td> Xp2 </td><td> cgatcagcagcaacagtacacg </td></tr><tr><td> Xp3 </td><td> gcaattggttgcttttatccagtcc </td></tr><tr><td> XP4 </td><td> cgcaacaccgcacactaatacg </td></tr><tr><td> XP5 </td><td> gccatcttagacacattcaagagcat </td></tr><tr><td> XP6 </td><td> cacacgtgaagtaccaagcgaaac </td></tr><tr><td> XP7 </td><td> gccacgtatagagcactgtaagagactatg </td></tr><tr><td> XP8 </td><td> caaagcacactatcagacgtgtcg </td></tr><tr><td> Xp9 </td><td> ggagaatctagatgccataaaggcaag </td></tr><tr><td> XP10 </td><td> tgatggacactgcattttagcactg </td></tr><tr><td> Xp11 </td><td> ggacactgcattttagcaatacgattc </td></tr><tr><td> XP12 </td><td> gtgatgggcactgcattttagc </td></tr><tr><td> Xp13 </td><td> agatgggctatctcagtcttataggct </td></tr><tr><td> XP14 </td><td> ggaagtcagtatggagggggtatg </td></tr><tr><td> Xp15 </td><td> tgggactgtgactactacagcaatga </td></tr><tr><td> Xp16 </td><td> aagactcaattcctagtcaggattatccac </td></tr><tr><td> XP17 </td><td> gggctgtagctctatgacagtgcttt </td></tr><tr><td> Xp18 </td><td> gtcttcaccagatgcagattactacagtg </td></tr><tr><td> Xp19 </td><td> aatagtttgaggaaggggtttcaagtg </td></tr><tr><td> XP20 </td><td> gctgttcaggtttccttctgtagtga </td></tr><tr><td> Xp21 </td><td> gcaagagatacaatggtccgaaaagt </td></tr><tr><td> Xp22 </td><td> agcacttcgtacaaccctctttctg </td></tr><tr><td> Xp23 </td><td> gaagagagcaggtcattcgtcagag </td></tr><tr><td> XP24 </td><td> gcaactgagacactgtagccatatgaag </td></tr><tr><td> Xp25 </td><td> ttcctggaggaagaacggaaaga </td></tr><tr><td> XP26 </td><td> tgattagaaggcttaggtcatcttcca </td></tr><tr><td> Xp27 </td><td> ttttgttcagagtagcgaggacttga </td></tr><tr><td> Xp28 </td><td> aatagagcagaatggcttcctcgaa </td></tr><tr><td> Xp29 </td><td> acattgcttgatcacgctgaagac </td></tr><tr><td> XP30 </td><td> gcaaggaagaaatagacacacaaagc </td></tr><tr><td> Xp31 </td><td> ggaagaaatagatgtaacaaagaattagacaca </td></tr><tr><td> XP32 </td><td> cacttcagagccacttgaatcctg </td></tr><tr><td> Xp33 </td><td> agtcacaggtgtcctgtagaaacagttc </td></tr><tr><td> Xp34 </td><td> cctttatgggcaatggcaacaat </td></tr><tr><td> Xp35 </td><td> ggcacatctgcatattgcttgtcta </td></tr><tr><td> Xp36 </td><td> gcaactaagaccatgaacccacaa </td></tr><tr><td> Xp37 </td><td> aaacacactggccttaagtatatggactg </td></tr><tr><td> Xp38 </td><td> cattcatttgcacacatggaacaat </td></tr><tr><td> Xp39 </td><td> tgggagacaatatttagcctccaggt </td></tr><tr><td> Xp40 </td><td> cctagcaagggcactgttttgtaataa </td></tr><tr><td> Xp41 </td><td> taacatttagcacactgccttgcac </td></tr><tr><td> Xp42 </td><td> cagtgatctacactaggtccacctcaca </td></tr><tr><td> Xp43 </td><td> ttatgttgaaggaatcttggccttg </td></tr><tr><td> XP44 </td><td> aagtgagagctgtagtctcaaggtgtga </td></tr><tr><td> Xp45 </td><td> gtattcaacctctgaggcaaactgtg </td></tr><tr><td> Xp46 </td><td> agattgtggaacttagatggctgtca </td></tr><tr><td> Xp47 </td><td> tggaactgcattaaagtcccaacttag </td></tr><tr><td> Xp48 </td><td> gaactcccagacctcttcaacctg </td></tr></tbody></table&gt; Tabla 1: Secuencia de oligonucleótidos marcados con fluorescencia para Xist ARN FISH. Los 48 oligonucleótidos fueron sintetizados con una modificación 5&#39;-amino para preparar sondas de oligonucleótidos marcados con fluorescencia para Xist ARN FISH.

Watch this Scientific Journal Video about Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation at JoVE.co

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level.

Fluorescente Rápida<em&gt; In Situ</em&gt; Protocolo de hibridación para Xist ARN combinado con inmunofluorescencia de histona Modificación de inactivación del cromosoma X.

Combining RNA fluorescent in situ hybridization (FISH) with immunofluorescence (immuno-FISH) creates a technique that can be employed at the single cell ...

quick-fluorescent-situ-hybridization-protocol-for-xist-rna-combined

Nanyang Technological University

Research

JoVE Journal

Biology

Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

13.9K vistas.  Cincinnati Children's Hospital Medical Center. We developed an easily customized strand-specific fluorescent in situ hybridization (FISH) protocol combined with immunofluorescence. This allows for a detailed examination of RNA dynamics with simultaneous insight into the chromatin structure, nuclear organization, and transcriptional regulation at the single cell level. 

Video: Quick Fluorescent In Situ Hybridization Protocol for Xist RNA Combined with Immunofluorescence of Histone Modification in X-chromosome Inactivation

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development. The Xenopuslaevis embryo is very useful for studying organogenesis because their large size makes them very suitable for identifying organs at the earliest steps in organogenesis. At this time, the primary method used for identifying a specific organ or primordium is whole mount in situ hybridization with labeled antisense RNA probes specific to a gene that is expressed in the organ of interest. In addition, it is relatively easy to manipulate genes or signaling pathways in Xenopus and in situ hybridization allows one to then assay for changes in the presence or morphology of a target organ. Whole mount in situ hybridization is a multi-day protocol with many steps involved. Here we provide a simplified protocol with reduced numbers of steps and reagents used that works well for routine assays. In situ hybridization robots have greatly facilitated the process and we detail how and when we utilize that technology in the process. Once an in situ hybridization is complete, capturing the best image of the result can be frustrating. We provide advice on how to optimize imaging of in situ hybridization results. Although the protocol describes assessing organogenesis in Xenopus laevis, the same basic protocol can almost certainly be adapted to Xenopus tropicalis and other model systems.

Understanding Early Organogenesis Using a Simplified In Situ Hybridization Protocol in Xenopus

The Xenopus laevis embryo continues to be exceptionally useful in the study of early development due to its large size and ease of manipulation. A simplified protocol for whole mount in situ hybridization protocol is provided that can be used in the identification of specific organs in this model system.

La comprensión temprana Organogenesis Usando una simplificado<em&gt; In Situ</em&gt; Protocolo de hibridación en<em&gt; Xenopus</em

Organogenesis is the study of how organs are specified and then acquire their specific shape and functions during development.  The Xenopuslaevis embryo ...

Investigación

Biología del Desarrollo

Using Fluorescence In Situ Hybridization (FISH) to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk of conceiving an aneuploid fetus increases dramatically and this phenomenon is known as the maternal age effect. One requirement for accurate chromosome segregation during the meiotic divisions is maintenance of sister chromatid cohesion during the extended prophase period that oocytes experience. Cytological evidence in both humans and model organisms suggests that meiotic cohesion deteriorates during the aging process. In addition, segregation errors in human oocytes are most prevalent during meiosis I, consistent with premature loss of arm cohesion. The use of model organisms is critical for unraveling the mechanisms that underlie age-dependent loss of cohesion. Drosophila melanogaster offers several advantages for studying the regulation of meiotic cohesion in oocytes. However, until recently, only genetic tests were available to assay for loss of arm cohesion in oocytes of different genotypes or under different experimental conditions. Here, a detailed protocol is provided for using fluorescence in situ hybridization (FISH) to directly visualize defects in arm cohesion in prometaphase I and metaphase I arrested Drosophila oocytes. By generating a FISH probe that hybridizes to the distal arm of the X chromosome and collecting confocal Z stacks, a researcher can visualize the number of individual FISH signals in three dimensions and determine whether sister chromatid arms are separated. The procedure outlined makes it possible to quantify arm cohesion defects in hundreds of Drosophila oocytes. As such, this method provides an important tool for investigating the mechanisms that contribute to cohesion maintenance as well as the factors that lead to its demise during the aging process.

Using Fluorescence In Situ Hybridization FISH to Monitor the State of Arm Cohesion in Prometaphase and Metaphase I Drosophila Oocytes

This manuscript presents a detailed method for generating X-chromosome arm probes and performing fluorescence in situ hybridization (FISH) to examine the state of sister chromatid cohesion in prometaphase and metaphase I arrested Drosophila oocytes. This protocol is suitable for determining whether meiotic arm cohesion is intact or disrupted in different genotypes.

Con fluorescencia In Situ hibridación (pescado) para supervisar el estado de la cohesión de brazo en Prometafase y metafase I ovocitos de Drosophila

In humans, chromosome segregation errors in oocytes are responsible for the majority of miscarriages and birth defects. Moreover, as women age, their risk ...

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. The protocol is a modified version of the standard in situ hybridization using alkaline phosphatase and substrates such as NBT/BCIP and Fast Red 1,2. This protocol utilizes standard digoxygenin and fluorescein labeled probes along with tyramide signal amplification (TSA) 3. The commercially available TSA kits allow flexible experimental design as fluorescence emission from green to far-red can be used in combination with various nuclear stains, such as propidium iodide, or fluorescence immunohistochemistry for proteins. TSA produces a reactive fluorescent substrate that quickly covalently binds to moieties, typically tyrosine residues, in the immediate vicinity of the labeled antisense riboprobe. The resulting staining patterns are high resolution in that subcellular localization of the mRNA can be observed using laser scanning confocal microscopy 3,4. One can observe nascent transcripts at the chromosomal loci, distinguish nuclear and cytoplasmic staining and visualize other patterns such as cortical localization of mRNA. Studies in Drosophila indicate that roughly 70% of mRNAs exhibit specific patterns of subcellular localization that frequently correlate with the function of the encoded protein 5. When combined with computer-aided reconstruction of 3D confocal datasets, our protocol allows the detailed analysis of mRNA distribution with sub-cellular resolution in whole vertebrate embryos.

Zebrafish Whole Mount High-Resolution Double Fluorescent In Situ Hybridization

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology. Here, we present a high-resolution double fluorescent in situ hybridization protocol for analyzing the precise expression pattern of a single gene and for determining the overlap of the expression domains of two genes. We include a propidium iodide nuclear counter-stain to highlight tissue organization.

Pez cebra todo el montaje de alta resolución doble fluorescente In Situ La hibridación

Whole mount in situ hybridization is one of the most widely used techniques in developmental biology.  Here, we present a high-resolution double ...

Biología

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including genetic disorders, of which chromosomal abnormalities are the most common. Fluorescence in situ hybridization (FISH) is a well-known and frequently used method to detect chromosomal aberrations in humans. FISH is mainly used for the analysis of chromosomal abnormalities in the spermatozoa of males with numerical or structural chromosomal aberrations. Furthermore, this technique is also frequently applied in females to detect X chromosomal aberrations that are known to cause ovarian dysgenesis. However, information on the X chromosomal content of ovarian cells from females with X chromosomal aberrations in lymphocytes and/or buccal cells is still lacking.
The aim of this study is to advance basic research regarding X chromosomal aberrations in females, by presenting two methods based on FISH to identify the X chromosomal content of ovarian cells. First, a method is described to determine the X chromosomal content of isolated ovarian cells (oocytes, granulosa cells, and stromal cells) in non-grafted ovarian cortex tissue from females with X chromosomal aberrations. The second method is directed at evaluating the effect of chromosomal aberrations on folliculogenesis by determining the X chromosomal content of ovarian cells of newly formed secondary and antral follicles in ovarian tissue, from females with X chromosomal aberrations after long-term grafting into immunocompromised mice. Both methods could be helpful in future research to gain insight into the reproductive potential of females with X chromosomal aberrations.

Exploring X Chromosomal Aberrations in Ovarian Cells by Using Fluorescence In Situ Hybridization

This article presents two methods based on fluorescence in situ hybridization to determine the X chromosomal content of ovarian cells in non-grafted and grafted ovarian cortex tissue from females with X chromosomal aberrations.

Exploración de las aberraciones cromosómicas X en células ováricas mediante el uso de hibridación fluorescente in situ

Millions of people worldwide deal with issues concerning fertility. Reduced fertility, or even infertility, may be due to many different causes, including ...

Genética

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological processes. In particular, appropriate regulation of calcium activity patterns during embryogenesis is necessary for many aspects of vertebrate neural development, including proper neural tube closure, synaptogenesis, and neurotransmitter phenotype specification. While the observation that calcium activity patterns can differ in both frequency and amplitude suggests a compelling mechanism by which these fluxes might transmit encoded signals to downstream effectors and regulate gene expression, existing population-level approaches have lacked the precision necessary to further explore this possibility. Furthermore, these approaches limit studies of the role of cell-cell interactions by precluding the ability to assay the state of neuronal determination in the absence of cell-cell contact. Therefore, we have established an experimental workflow that pairs time-lapse calcium imaging of dissociated neuronal explants with a fluorescence in situ hybridization assay, allowing the unambiguous correlation of calcium activity pattern with molecular phenotype on a single-cell level. We were successfully able to use this approach to distinguish and characterize specific calcium activity patterns associated with differentiating neural cells and neural progenitor cells, respectively; beyond this, however, the experimental framework described in this article could be readily adapted to investigate correlations between any time-series activity profile and expression of a gene or genes of interest.

Fluorescent Calcium Imaging and Subsequent In Situ Hybridization for Neuronal Precursor Characterization in Xenopus laevis

We present a two-part protocol that combines fluorescent calcium imaging with in situ hybridization, allowing the experimenter to correlate patterns of calcium activity with gene expression profiles on a single-cell level.

Imágenes fluorescentes de calcio y posterior hibridación in situ para la caracterización de precursores neuronales en Xenopus laevis

Spontaneous intracellular calcium activity can be observed in a variety of cell types and is proposed to play critical roles in a variety of physiological ...

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can be hampered by the lack of specific primary or secondary antibodies for immunostaining. Here we describe a protocol to detect the expression of three different genes in the same brain section using double fluorescence in situ hybridization with two gene-specific probes followed by immunostaining with an antibody of high specificity directed against the protein encoded by a third gene. The Aspartoacyclase (ASPA) gene, mutations of which can lead to a rare human white matter disease - Canavan disease - is thought to be expressed in oligodendrocytes and microglia but not in astrocytes and neurons. However, the precise expression pattern of ASPA in the brain has yet to be established. This protocol has allowed us to determine that ASPA is expressed in a subset of mature oligodendrocytes and it can be generally applied to a wide range of gene expression pattern studies.

Combining Double Fluorescence In Situ Hybridization with Immunolabelling for Detection of the Expression of Three Genes in Mouse Brain Sections

Localizing gene expression to specific cell types can be challenging due to the lack of specific antibodies. Here we describe a protocol for simultaneous triple detection of gene expression by combining double fluorescence RNA in situ hybridization with immunostaining.

La combinación de doble fluorescencia<em&gt; In Situ</em&gt; La hibridación con Immunolabelling para la detección de la expresión de tres genes en las secciones de cerebro de ratón

Detection of gene expression in different types of brain cells e.g., neurons, astrocytes, oligodendrocytes, oligodendrocyte precursors and microglia, can ...

Neurociencias

Quantitative Fluorescence In Situ Hybridization (FISH) and Immunofluorescence (IF) of Specific Gene Products in KSHV-Infected Cells

Mechanistic insight arrives from careful study and quantification of specific RNAs and proteins. The relative locations of these biomolecules throughout the cell at specific times can be captured with fluorescence in situ hybridization (FISH) and immunofluorescence (IF). During lytic herpesvirus infection, the virus hijacks the host cell to preferentially express viral genes, causing changes in cell morphology and behavior of biomolecules. Lytic activities are centered in nuclear factories, termed viral replication compartments, which are discernable only with FISH and IF. Here we describe an adaptable protocol of RNA FISH and IF techniques for Kaposi's sarcoma-associated herpesvirus (KSHV)-infected cells, both adherent and in suspension. The method includes steps for the development of specific anti-sense oligonucleotides, double RNA FISH, RNA FISH with IF, and quantitative calculations of fluorescence intensities. This protocol has been successfully applied to multiple cell types, uninfected cells, latent cells, lytic cells, time-courses, and cells treated with inhibitors to analyze the spatiotemporal activities of specific RNAs and proteins from both the human host and KSHV.

Quantitative Fluorescence In Situ Hybridization FISH and Immunofluorescence IF of Specific Gene Products in KSHV-Infected Cells

We describe a protocol utilizing fluorescence in situ hybridization (FISH) to visualize multiple herpesviral RNAs within lytically infected human cells, either in suspension or adherent. This protocol includes quantification of fluorescence producing a nucleocytoplasmic ratio and can be extended for simultaneous visualization of host and viral proteins with immunofluorescence (IF).

Fluorescencia cuantitativa en hibridación situ (FISH) e inmunofluorescencia (IF) de productos genéticos específicos en células infectadas por KSHV

Mechanistic insight arrives from careful study and quantification of specific RNAs and proteins. The relative locations of these biomolecules throughout ...

Inmunología e Infección

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Assessing the expression pattern of a gene, as well as the subcellular localization properties of its transcribed RNA, are key features for understanding its biological function during development. RNA in situ hybridization (RNA-ISH) is a powerful method used for visualizing RNA distribution properties, be it at the organismal, cellular or subcellular levels 1. RNA-ISH is based on the hybridization of a labeled nucleic acid probe (e.g. antisense RNA, oligonucleotides) complementary to the sequence of an mRNA or a non-coding RNA target of interest 2. As the procedure requires primary sequence information alone to generate sequence-specific probes, it can be universally applied to a broad range of organisms and tissue specimens 3. Indeed, a number of large-scale ISH studies have been implemented to document gene expression and RNA localization dynamics in various model organisms, which has led to the establishment of important community resources 4-11. While a variety of probe labeling and detection strategies have been developed over the years, the combined usage of fluorescently-labeled detection reagents and enzymatic signal amplification steps offer significant enhancements in the sensitivity and resolution of the procedure 12. Here, we describe an optimized fluorescent in situ hybridization method (FISH) employing tyramide signal amplification (TSA) to visualize RNA expression and localization dynamics in staged Drosophila embryos. The procedure is carried out in 96-well PCR plate format, which greatly facilitates the simultaneous processing of large numbers of samples.

Whole Mount RNA Fluorescent in situ Hybridization of Drosophila Embryos

Here we describe a whole-mount fluorescent in situ hybridization (FISH) protocol for determining the expression and localization properties of RNAs expressed during embryogenesis in the fruit fly, Drosophila melanogaster.

Todo el monte ARN fluorescente<em&gt; In situ</em&gt; La hibridación de<em&gt; Drosophila</em&gt; Los embriones

Assessing  the expression pattern of a gene, as well as the subcellular localization  properties of its transcribed RNA, are key features for ...

Combined DNA-RNA Fluorescent In situ Hybridization (FISH) to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in cytogenetics and cancer diagnostics, and can detect aberrations of the genome, which often has important clinical implications. RNA FISH can be used to detect RNA molecules in cells and has provided important insights in regulation of gene expression. Combining DNA and RNA FISH within the same cell is technically challenging, as conditions suitable for DNA FISH might be too harsh for fragile, single stranded RNA molecules. We here present an easily applicable protocol which enables the combined, simultaneous detection of Xist RNA and DNA encoded by the X chromosomes. This combined DNA-RNA FISH protocol can likely be applied to other systems where both RNA and DNA need to be detected.

Combined DNA-RNA Fluorescent In situ Hybridization FISH to Study X Chromosome Inactivation in Differentiated Female Mouse Embryonic Stem Cells

Fluorescent in situ hybridization (FISH) allows the detection of nucleic acids in their native environment within cells. We here describe a protocol for the combined, simultaneous detection of RNA and DNA by means of FISH, which can be used to study X chromosome inactivation in mouse embryonic stem cells.

ADN-ARN combinado fluorescente<em&gt; In situ</em&gt; La hibridación (FISH) para el Estudio de inactivación del cromosoma X en las células madre embrionarias de ratón Diferenciada Mujer

Fluorescent in situ hybridization (FISH) is a molecular technique which enables the detection of nucleic acids in cells. DNA FISH is often used in ...

Simple Method for Fluorescence DNA In Situ Hybridization to Squashed Chromosomes

DNA in situ hybridization (DNA ISH) is a commonly used method for mapping sequences to specific chromosome regions. This approach is particularly effective at mapping highly repetitive sequences to heterochromatic regions, where computational approaches face prohibitive challenges. Here we describe a streamlined protocol for DNA ISH that circumvents formamide washes that are standard steps in other DNA ISH protocols. Our protocol is optimized for hybridization with short single strand DNA probes that carry fluorescent dyes, which effectively mark repetitive DNA sequences within heterochromatic chromosomal regions across a number of different insect tissue types. However, applications may be extended to use with larger probes and visualization of single copy (non-repetitive) DNA sequences. We demonstrate this method by mapping several different repetitive sequences to squashed chromosomes from Drosophila melanogaster neural cells and Nasonia vitripennis spermatocytes. We show hybridization patterns for both small, commercially synthesized probes and for a larger probe for comparison. This procedure uses simple laboratory supplies and reagents, and is ideal for investigators who have little experience with performing DNA ISH.

Simple Method for Fluorescence DNA In Situ Hybridization to Squashed Chromosomes

Here, we present a simple method for performing fluorescence DNA in situ hybridization (DNA ISH) to visualize repetitive heterochromatic sequences on slide-mounted chromosomes. The method requires minimal reagents and it is versatile for use with short or long probes, different tissues, and detection with fluorescence or non-fluorescence-based signals.

Fluorescente Rápida

Resumen

Explorar más videos

Capítulos en este video

La comprensión temprana Organogenesis Usando una simplificado

Con fluorescencia In Situ hibridación (pescado) para supervisar el estado de la cohesión de brazo en Prometafase y metafase I ovocitos de Drosophila

Pez cebra todo el montaje de alta resolución doble fluorescente In Situ La hibridación

Exploración de las aberraciones cromosómicas X en células ováricas mediante el uso de hibridación fluorescente in situ

Imágenes fluorescentes de calcio y posterior hibridación in situ para la caracterización de precursores neuronales en Xenopus laevis

La combinación de doble fluorescencia

Fluorescencia cuantitativa en hibridación situ (FISH) e inmunofluorescencia (IF) de productos genéticos específicos en células infectadas por KSHV

Todo el monte ARN fluorescente

ADN-ARN combinado fluorescente

Método simple de ADN de fluorescencia