Estamos muy agradecidos a Scimone Gianni por su excelente asistencia con la fabricación de video.

Manejo de las muestras de sangre infectada por VIH requiere de algunas recomendaciones importantes. Todas las muestras de sangre deben ser transportados en robusta a prueba de fugas de contenedores. Se debe tener cuidado en la recogida de la muestra para evitar la contaminación del exterior del recipiente y de cualquier documentación que acompaña la muestra. Todas las personas de procesamiento de la sangre infectada debe usar guantes. Los guantes deben ser cambiados y lavarse las manos después de la finalización del procesamiento de las muestras. Procesamiento de muestras de sangre infectadas con el VIH deben realizarse en una campana de clase II cámara de bioseguridad. Mecánicos de pipeteo debe utilizarse. El uso de agujas u otros objetos punzantes (como por ejemplo las pipetas de vidrio o tubos capilares) debe limitarse a situaciones en las que no hay otra alternativa. Superficies de laboratorio deben ser descontaminados con un desinfectante químico apropiado después de un derrame de sangre y cuando las actividades son el trabajo realizado. Los materiales contaminados utilizados deben ser descontaminados antes de su reutilización o deben ser eliminados correctamente por la vía de desechos clínicos. Todos los incidentes de exposición ocupacional a sangre o fluidos potencialmente infecciosos (es decir, aquellos que requieren precauciones universales) y debe ser tratada como una emergencia médica ya que las intervenciones deben iniciarse pronto posible para ser eficaz. El protocolo requiere 5 días para su finalización. El plazo se detalla en la Figura 1. Las especies bacterianas se identifican utilizando los métodos descritos en la Figura 2. 1. Recogida de muestras <ol><li> 9 ml de sangre entera se extrae en los tubos que contienen EDTA. </li><li> Tubos se centrifugan a 2000 rpm durante 10 minutos a temperatura ambiente para obtener el plasma. </li><li> Plasma se recoge en un estéril de 2 ml Eppendorf-tubo. </li></ol> 2. Extracción de ADN de muestras de plasma <ol><li> Desinfectar adecuadamente cubierta, pipetas y materiales necesarios para el experimento con el fin de garantizar la esterilidad. </li><li> Posición de todos los materiales bajo luz UV por lo menos durante 30 minutos. </li><li> Limpie los guantes con un desinfectante. </li><li> Remojar algunas toallas de papel en etanol y colocarlos bajo el capó. Cada vez que un extremo se descarta limpiar la pipeta sobre las toallas de papel húmedo. </li></ol> Se extrae el ADN utilizando un kit comercial siguiendo las instrucciones del fabricante (Easy-ADN Kit, Invitrogen, Carlsbad CA, EE.UU.). <ol start="5"><li> 350 L de plasma se colocan en un tubo estéril de 2 ml eppendorf. </li><li> 350 L de agua ultra pura filtrada se utilizó como control negativo. </li><li> Añadir 10 l de lisozima (1mg/ml) a las muestras. </li><li> Incubar durante 30 minutos a 37 ° C. </li><li> Añadir 500 l de solución de lisis y mezclar suavemente con las muestras. </li><li> Incubar durante 7 minutos a 65 ° C. </li><li> Añadir 900 l de cloroformo para las muestras. </li><li> Agitar vigorosamente hasta que las muestras están uniformemente viscosa. </li><li> Añadir 200 l de solución de precipitación y agitar vigorosamente. </li><li> Centrifugar las muestras a 10.500 rpm durante 10 minutos a temperatura ambiente para separar las fases y formar la interfase. </li><li> Transferir la fase acuosa superior a un tubo de microcentrífuga fresco que contiene 1 ml de etanol al 100%. </li><li> Centrifugar las muestras a 10.500 rpm durante 10 minutos a 4 ° C. </li><li> Eliminar el etanol. </li><li> Añadir 1 ml de etanol al 70%. </li><li> Centrifugar las muestras a la máxima velocidad durante 10 minutos a 4 ° C. </li><li> Eliminar el etanol. El etanol residual debe ser eliminado con un pipettator. </li><li> Resuspender el precipitado en 50 L de agua ultrapura. </li><li> Lea la concentración de ADN con un espectrofotómetro. </li></ol> 3. Gen 16S rRNA PCR Amplificación por PCR se lleva a cabo como se describió previamente 9. <ol><li> Amplificar el ADN en una mezcla de reacción 100 L consta de 10 l de buffer 10X PCR, 5 l de 25 mM MgCl2, 5 l de dNTPs 2 mM totales, 1 l de imprimación M 50 RW01 (AACTGGAGGAAGGTGGGGAT), 1 l de imprimación M 50 DG74 (AGGAGGTGATCCAACCGCA), 34 L de H20 y 0,5 l de Taq polimerasa (AmpliTaq Gold, Applied Biosystems, Foster City, CA, EE.UU.). </li><li> La transferencia de la mezcla de PCR en los filtros a fin de evitar la posible contaminación por bacterias de Taq polimerasa. </li><li> Filtros de centrífuga (Microcon, Millipore, Billerica, MA, EE.UU.) durante 30 minutos a 500 fcr a 4 ° C. </li><li> Alícuota de la mezcla de PCR en función del número de muestras que deben ser amplificado (PCR controles positivos y negativos, y las muestras de agua que se extrae). </li><li> Use las siguientes condiciones termociclador: 94 ° C durante 10 minutos, 40 veces durante 1 minuto cada vez que a 94 ° C, 55 ° C y 72 ° C, y 10 min a 72 ° C. </li><li> Visualizar el producto de PCR en un 2% en gel de agarosa. Use escalera de 100 bp de ADN. Tamaño del producto de PCR es de alrededor de 360 ​​pb (Figura 3). </li></ol> 4. PCR Purificación del producto Sólo las muestras positivas de PCR debe ser purificado. Purificación se realiza medianteun fabricante de equipo comercial de las instrucciones siguientes (PCR PureLink MICROKIT, Invitrogen, Carlsbad CA, EE.UU.). <ol><li> Agregar 4 volúmenes de tampón de unión que contiene isopropanol por un volumen de producto de PCR. </li><li> Transferencia del producto de PCR con tampón de unión a una columna. </li><li> Centrifugar durante 1 minuto a 10.000 RCF a temperatura ambiente. </li><li> Lavar la columna con el tampón de lavado con etanol. </li><li> Centrifugar durante 1 minuto a 10.000 RCF a temperatura ambiente. </li><li> Centrifugar a máxima velocidad durante 1 minuto a temperatura ambiente para secar la membrana de sílice y eliminar cualquier solución de lavado residual con etanol. </li><li> Añadir 10 l de agua ultrapura. </li><li> Incubar durante 1 minuto a temperatura ambiente. </li><li> Centrifugar a máxima velocidad durante 2 minutos a temperatura ambiente para recoger el ADN purificado. </li></ol> 5. La clonación Lisogenia caldo (LB) Preparación Plate <ol><li> Disolver 25 gr de la mezcla de LB en aproximadamente 800 ml de agua. </li><li> Llevar el volumen final de 1 L. </li><li> Añadir 15 gr de Bactoagar. </li><li> Autoclave durante 20 minutos. </li><li> Después del autoclave, removerlo vigorosamente la solución en el matraz para mezclar el agar fundido. </li><li> Enfriar la solución a 50 ° C. </li><li> Añadir ampicilina (50 mg / ml) y agitar hasta que se disuelva. </li><li> En placas a una profundidad de aproximadamente 3 mm. </li><li> Dejar las placas a temperatura ambiente. </li><li> Corre X-Gal (40mg/ml) y IPTG (100 mM) en cada placa de LB y se incuba a 37 ° C hasta que esté listo para su uso. </li></ol> La transformación de células competentes La transformación se realiza mediante las instrucciones de un fabricante de equipo después de comercial (Topo TA kit de clonación, Invitrogen, Carlsbad CA, EE.UU.). <ol><li> Prepare la mezcla de reacción de clonación (1-4 l de agua dulce producto de PCR, 1 l de solución de sal, 1 l de vectores y el agua si es necesario). </li><li> Mezcla de reacción suavemente y se incuba durante 5-10 minutos a temperatura ambiente. </li><li> Lugar la reacción en hielo. </li><li> Añadir 2 l de la reacción de la clonación en un vial de células competentes y mezclar suavemente. </li><li> Incubar en hielo durante 30 minutos. </li><li> De choque térmico de las células durante 30 segundos a 42 ° C. </li><li> Transferir inmediatamente el tubo en hielo. </li><li> Añadir 250 ml del medio. </li><li> Tape el tubo tighly y agitar el tubo horizontal a 37 ° C durante 1 hora. </li><li> Corre 50 L de cada transformación en un plato precalentado selectiva. </li><li> Incubar toda la noche a 37 ° C. </li></ol> Después de la incubación, las colonias de color blanco y azul se desarrollan en las placas. Las colonias blancas son positivas para la inserción de producto de PCR y las colonias azules son negativos para la inserción de producto de PCR. 6. El análisis de secuenciación La reacción de secuenciación <ol><li> Una mezcla se realiza con estos reactivos: 2,5 l de ADN, una imprimación l (5pmol / l) 1,1 l BigDye (Applied Biosystems, Foster City, CA, EE.UU.). </li><li> Condiciones termociclador: 96 ° C durante 1 minuto, 25 veces de 96 ° C durante 10 segundos, 55 ° C durante 15 segundos y 60 ° C durante 4 min. </li></ol> Columna de purificación <ol><li> Para cada reacción, preparar una columna MicroSpin (Qiagen, Milán, Italia). </li><li> Invertir columna y agitar para mezclar la resina. </li><li> Quite la parte inferior de la columna, afloje la tapa de ¼ de vuelta, y la columna en un tubo de microcentrífuga. </li><li> Centrífuga 3200 rpm durante 1 minuto. </li><li> Transferencia de columna a un tubo de microcentrífuga limpio. </li><li> Pipeta cuidadosamente toda la secuencia de reacción de PCR en el centro de la columna. </li><li> Centrífuga 3200 rpm durante 1 minuto. </li><li> ADN purificado se eluite en el tubo (20 l de agua ultrapura). </li></ol> El análisis de secuenciación <ol><li> Cargue la muestra purificada (20 l) en 96-pocillos de la placa. </li><li> La carga de la placa en el secuenciador. Secuenciadores automáticos de ADN generan un cromatograma de cuatro colores que muestra los resultados de la ejecución de la secuencia. </li><li> Entrada de la secuencia de nucleótidos como una consulta en las bases de datos públicos de secuencias. La búsqueda se realiza sobre la base de datos NCBI y servidores, con herramientas básicas de búsqueda local de alineación (BLAST). </li><li> Tenga en cuenta sólo las bacterias con homologías 98-100%. </li></ol> 7. Resultados representante <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Figura 1" /> Figura 1. Cronología del procedimiento. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Figura 2" /> Figura 2. Diagramas de flujo del procedimiento de identificación de bacterias enteras. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Figura 3" /> Figura 3. 2% en gel de agarosa que muestra una amplia gama de 16S rRNA gen PCR. El carril 1 contiene una escalera de 100 pb de ADN, el carril 2 contiene el control positivo de PCR, carril 3 muestra el control negativo de PCR. Carril 4 muestra ejemplos de un paciente VIH-positivo, y la calle 5 contiene el agua. Carril 6 SHujos de muestras de un individuo sano y una negativa reacción de PCR; carril 7 contiene agua. Sólo los pacientes con VIH positivo muestra una amplificación por PCR. Agua ultrapura utilizada como control negativo durante la etapa de extracción, indica que no hubo contaminación. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Figura 4" /> Figura 4. 0,7% en gel de agarosa mostrando plásmido extraído con el procedimiento minipreparación. El carril 1 contiene una escalera de 1 kilobase ADN, carril 2 contiene la colonia de control azul, calles 3 y 12 contienen colonias de color blanco. El plásmido de la colonia azul no contiene el prospecto del producto de PCR. Todas las 10 colonias de color blanco contienen el plásmido con el inserto correcto. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Figura 5" /> Figura 5. Muestra un ejemplo de análisis de secuenciación de bacterias en el plasma de una persona VIH-positiva individual. Nuestros resultados muestran que la translocación microbiana en la infección por VIH supone una flora polimicrobic, que no se ve en personas VIH negativas temas, lo que sugiere el fracaso sustancial de la inmunidad intestinal en el control de la translocación de bacterias.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Por la presente, muestran un protocolo de PCR / secuenciación para caracterizar la translocación de bacterias en la sangre periférica de individuos infectados con VIH.</p&gt;<p class="jove_content"&gt; Resultados de la más fiable se obtiene cuando se utiliza plasma con EDTA. Después de tomar muestras de sangre, el plasma se separa por centrifugación dentro de 2 / 3 horas, para evitar la hemólisis y la degradación del fragmento de ADN. Las muestras se almacenan primero a -20 ° C durante aproximadamente 5 días y luego a -80 ° C. Múltiples ciclos de congelación y deshielo que puede causar la pérdida de ADN de la bacteria debe ser evitado.</p&gt;<p class="jove_content"&gt; Las muestras de plasma se debe utilizar dentro de 12 horas después de la descongelación.</p&gt;<p class="jove_content"Optimización&gt; de un protocolo de extracción de ADN se realizó con el fin de obtener la máxima cantidad de ADN de la sangre de los donantes periféricos. Más específicamente, el plasma en vez de sangre entera se utiliza, ya que este último contiene pequeñas cantidades de ADN bacteriano que también está representado por la gran cantidad de ADN derivados de células de sangre periférica.</p&gt;<p class="jove_content"&gt; Nos ha elegido deliberadamente excluir de nuestros sujetos de estudio con signos y / o síntomas de infección aguda. Sin embargo, dado que los temas relacionados con el VIH immunedepression deterioro actual de la barrera gastro-intestinal y la translocación de productos bacterianos, que no podía excluir la translocación de microorganismos enteros. Así, el fundamento de la utilización de lisozima: dado que esta enzima daña la pared bacteriana, su uso permite la liberación de ADN de la bacteria de la gran escasez de circulante de microorganismos que no necesariamente representan las manifestaciones clínicas evidentes.</p&gt;<p class="jove_content"&gt; El principal problema en este experimento es el riesgo de contaminación. Dado el alto riesgo de contaminación del medio ambiente-PCR y el reactivo de las bacterias transmitidas, hemos optimizado los procedimientos de laboratorio para evitar la contaminación en cada paso del experimento, a partir de la recogida de muestras.</p&gt;<p class="jove_content"&gt; En particular, para la mejor preparación de la muestra, es esencial para evitar la contaminación de las muestras de plasma y las superficies de los consumibles de plástico y contenedores. Esto se logra mediante el uso de desinfectantes, guantes libres de polvo y respetando los procedimientos estándar de laboratorio. Dentro del protocolo que se describe los pasos más importantes en términos de riesgo de contaminación son la extracción de ADN y amplificación, debido a la posible presencia de contaminación de ADN bacteriano, derivadas, por ejemplo, de Taq polimerasa.</p&gt;<p class="jove_content"&gt; El uso de este enfoque, hemos demostrado que los pacientes con VIH pantalla translocación de bacterias en la sangre periférica polimicrobiana. No se detectan los microbios en la sangre periférica de individuos sanos, posiblemente como reflejo de la integridad de la barrera gastrointestinal. La investigación futura se centrará en la investigación del papel de la microbiota de sangre periférica en la patogénesis del VIH / SIDA y la respuesta a la terapia antirretroviral.</p

<table border="1"><tbody><tr><th> Nombre del reactivo </th><th> Empresa </th><th> Número de catálogo </th><th> Comentarios (opcional) </th></tr><tr><td> Easty ADN Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Cloroformo </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Etanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lisozima </td><td> Fluka </td><td> 62970 </td><td> 10 mg / ml en agua destilada </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystems </td><td> 26478701 </td><td></td></tr><tr><td> Microcontrolador 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR primers </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarosa </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> ADN escalera </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> PureLink PCR kit de micro </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> Agar LB, en polvo </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicilina </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / ml en agua destilada </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/ml en DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100 mm de agua destilada </td></tr><tr><td> Topo TA kit de clonación </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> PureLink rápida kit plásmido Miniprep </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big Dye </td><td> Applied Biosystems </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 spin kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

El tracto gastrointestinal es fisiológicamente sanos colonizados por una gran variedad de microbios comensales que influyen en el desarrollo de la humoral y celular 1,2 mucosa del sistema inmunológico. Microbiota está protegido del sistema inmune a través de una fuerte barrera de la mucosa. Las infecciones y los antibióticos son conocidos por alterar la barrera normales del tracto gastrointestinal y la composición de las bacterias residentes, lo que puede resultar en posibles anomalías inmunológicas 3. El VIH causa una brecha en la barrera gastrointestinal con insuficiencia progresiva de la inmunidad de la mucosa y la fuga hacia la circulación sistémica de bioproductos bacterianos, tales como lipopolisacárido y fragmentos de ADN bacteriano, lo que contribuye a la activación inmune sistémica 4-7. Translocación microbiana está implicado en el VIH / SIDA inmunopatogénesis y respuesta al tratamiento 4,8. El objetivo fue caracterizar la composición de las bacterias translocación en la sangre periférica de los pacientes infectados por VIH. Para perseguir nuestro objetivo hemos creado una reacción de PCR para el gen 16S panbacteric ribosomial seguido de un análisis de secuenciación. En pocas palabras, toda la sangre de ambos sujetos infectados por el VIH y saludable se utiliza. Dado que los individuos sanos presentan homeostasis intestinal normal sin desplazamiento de la microflora se espera que en estos pacientes. Tras la recogida de sangre entera por punción venosa y la separación del plasma, el ADN se extrae del plasma y se utiliza para llevar a cabo una amplia gama de reacción de PCR para el gen 16S panbacteric ribosomial 9. Tras la purificación análisis de productos PCR, clonación y secuenciación se llevan a cabo.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Nuestro experimento muestra cómo realizar un análisis de la secuencia de translocación de especies de bacterias en la sangre periférica de los pacientes VIH positivos.

La secuenciación de la microflora bacteriana en la sangre periférica: Nuestra experiencia con pacientes infectados por VIH

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Nanyang Technological University

Research

JoVE Journal

Medicine

12.2K vistas.  San Paolo Hospital University of Milan, Italy. Nuestro experimento muestra cómo realizar un análisis de la secuencia de translocación de especies de bacterias en la sangre periférica de los pacientes VIH positivos.

Video: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Modelado Hemorragia intracerebral en ratones: La inyección de sangre autóloga o colagenasa bacteriana

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Investigación

Medicina

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

La fragilidad en las personas infectadas por el VIH de medición. La identificación de los pacientes frágiles es el primer paso para la mejora y la Inversión de la fragilidad

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Posturografía dinámica computarizada para la evaluación de control postural en pacientes con claudicación intermitente

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Evaluación de la función vascular en pacientes con enfermedad renal crónica

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Collection and Extraction of Saliva DNA for Next Generation Sequencing

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality DNA. However, DNA extraction from saliva can yield high quality DNA with little to no degradation/fragmentation that is suitable for a variety of DNA assays without the expense of a phlebotomist and can even be acquired through the mail. However, at present, no saliva DNA collection/extraction protocols for next generation sequencing have been presented in the literature. This protocol optimizes parameters of saliva collection/storage and DNA extraction to be of sufficient quality and quantity for DNA assays with the highest standards, including microarray genotyping and next generation sequencing.

DNA extraction from saliva can provide a readily available source of high molecular weight DNA, with little to no degradation/fragmentation. This protocol provides optimized parameters for saliva collection/storage and DNA extraction to be of sufficient quality and quantity for downstream DNA assays with high quality requirements.

Recolección y extracción de ADN de la saliva de Next Generation Sequencing

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Ortotópico Implantación y Seguimiento de la célula inmune periférica en el modelo II-45 Singénico Rata Mesotelioma

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Ensayo de actividad de endotoxinas para la detección de endotoxemia de sangre completa en pacientes con enfermedades críticas

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Integration of Brain Tissue Saturation Monitoring in Cardiopulmonary Exercise Testing in Patients with Heart Failure

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction (HF). However, in clinical cardiopulmonary exercise testing (CPET), cerebral hemodynamics is not assessed. NIRS is used to measure cerebral tissue oxygen saturation (SctO2) in the frontal lobe. This method is reliable and valid and has been utilized in several studies. SctO2 is lower during both rest and peak exercise in patients with HF than in healthy controls (66.3 &#177; 13.3% and 63.4 &#177; 13.8% vs. 73.1 &#177; 2.8% and 72 &#177; 3.2%). SctO2 at rest is significantly linearly correlated with peak VO2 (r = 0.602), oxygen uptake efficiency slope (r = 0.501), and brain natriuretic peptide (r = -0.492), all of which are recognized prognostic and disease severity markers, indicating its potential prognostic value. SctO2 is determined mainly by end-tidal CO2 pressure, mean arterial pressure, and hemoglobin in the HF population. This article demonstrates a protocol that integrates SctO2 using NIRS into incremental CPET on a calibrated bicycle ergometer.

This protocol integrated near-infrared spectroscopy into conventional cardiopulmonary exercise testing to identify the involvement of the cerebral hemodynamic response in exercise intolerance in patients with heart failure.

Integración de la monitorización de la saturación del tejido cerebral en las pruebas de ejercicio cardiopulmonar en pacientes con insuficiencia cardíaca

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction ...

Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact morbidity and mortality rates. However, there is currently a lack of suitable non-invasive, real-time technologies for continuous monitoring of cerebral physiology at the bedside. Diffuse optical techniques have been proposed as a potential tool for bedside measurements of cerebral blood flow and cerebral oxygenation in case of neurocritical patients. Diffuse optical spectroscopies have been previously explored to monitor patients in several clinical scenarios ranging from neonatal monitoring to cerebrovascular interventions in adults. However, the feasibility of the technique to aid clinicians by providing real-time information at the bedside remains largely unaddressed. Here, we report the translation of a diffuse optical system for continuous real-time monitoring of cerebral blood flow, cerebral oxygenation, and cerebral oxygen metabolism during intensive care. The real-time feature of the instrument could enable treatment strategies based on patient-specific cerebral physiology rather than relying on surrogate metrics, such as arterial blood pressure. By providing real-time information on the cerebral circulation at different time scales with relatively cheap and portable instrumentation, this approach may be especially useful in low-budget hospitals, in remote areas and for&#160;monitoring in open fields (e.g., defense and sports).

Presented here is a protocol for non-invasively monitoring cerebral hemodynamics of neurocritical patients in real-time and at the bedside using diffuse optics. Specifically, the proposed protocol uses a hybrid diffuse optical systems to detect and display real-time information on cerebral oxygenation, cerebral blood flow and cerebral metabolism.

Monitorización en tiempo real de pacientes neurocríticos con espectroscopias ópticas difusas

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Análisis digital de escritura a mano de personajes en pacientes chinos con deterioro cognitivo leve

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...