Name: a filtration-based method of preparing high-quality nuclei from cross-linked skeletal muscle for chromatin immunoprecipitation
Uploaded: 2017-07-06T15:00:00.000+00:00
Duration: 10 min 4 s
Description: Watch this Scientific Journal Video about A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation at JoVE.com

Wir danken Karyn Esser, Nobuya Koike und Noheon Park für hilfsbereite Beratung. Diese Arbeit wurde zum Teil von NIH / NIGMS (R01GM114424) an S.-HY und der Robert A. Welch Foundation (AU-1731) und NIH / NIA (R01AG045828) an ZC unterstützt

Die Tierpflege wurde unter den Richtlinien des Institutional Animal Care and Use Committee (IACUC) durchgeführt und die Verfahren wurden nach einem Tierprotokoll durchgeführt, das von der University of Texas Health Science Center in Houston genehmigt wurde. 1. Kernisolierung aus vernetzten Skelettmuskeln <ol><li> Wiegen und Hackfleisch-Skelettmuskel, isoliert von etwa 20 Wochen alten C57BL / 6 männlichen Mäusen, in eiskalter Phosphat gepufferter Kochsalzlösung (PBS), wie im Detail zuvor beschrieben. HINWEIS: Wir erhalten in der Regel 1,0 - 1,5 g Skelettmuskel von einer Maus. <ol><li> Legen Sie gehacktes Skelettmuskelgewebe in ein 50-ml-konisches Röhrchen mit 10 ml PBS auf Eis ein. </li></ol></li><li> Zentrifugieren bei 300 xg bei 4 ° C für 5 min. </li><li> Den PBS-Überstand vorsichtig durch Aspiration entfernen. </li><li> Schätzung des Pelletvolumens in jedem 50-ml-Röhrchen unter Verwendung von Referenzrohren mit 1, 2, 3 und 4 ml Wasser. </li><li> 7 Bände hinzufügenEiskaltes 1% Formaldehyd in PBS und homogenisieren die Proben auf Eis unter Verwendung eines Sondengewebehomogenisators (siehe Tabelle der Materialien ). HINWEIS: Optional: Die Homogenisierung kann in einem kalten Raum durchgeführt werden. </li><li> Vernetzen Sie die Probe durch Inkubieren bei Raumtemperatur für 10 min. </li><li> Die Vernetzungsreaktion durch Zugabe von 1 M Glycin auf eine Endkonzentration von 0,125 m müngen und 5 min bei Raumtemperatur inkubieren. </li><li> Die Proben bei 3.000 xg für 5 min bei 4 ° C zentrifugieren. Den Überstand über Aspiration entfernen. </li><li> Spülen mit 10 ml eiskaltem Basenpuffer (10 mM HEPES-KOH bei pH 7,3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl 2 , 0,5 mM DTT) mit frisch zugesetzten Protease-Inhibitoren (0,2 mM Phenylmethylsulfonylfluorid (PMSF) , Und 10 &amp; mgr; g / ml Leupeptin). Bei 3000 g 5 min bei 4 ° C zentrifugieren und den Überstand vorsichtig durch Absaugen entfernen. </li><li> Das Pellet wird in 6 ml Lysepuffer (10 mM HEPES-KOH bei pH 7,3, 10 mM EDTA, 10 mM KCl, 5 mM MgCl 2 , 0,5 mM DTT, 1% Triton X-100) mit frisch zugesetzten Protease-Inhibitoren (0,2 mM PMSF und 10 μg / mL Leupeptin). </li><li> Übertragen Sie die Probe auf einen vorgekühlten 15 ml Dounce-Homogenisator und inkubieren Sie für 10 min auf Eis. Bevorzugt homogenisieren Sie jede Probe auf Eis mit 15 langsamen Schlägen mit einer losen Stößel gefolgt von 15 Schlägen mit engen Stößel, um die Kerne freizugeben. </li><li> Filtriere das Homogenat (6 ml) durch Zellsieb (Porengröße: 100 μm) und spüle mit 4 ml Lysepuffer. Die Proben bei 1000 xg für 10 min bei 4 ° C zentrifugieren. In 5 ml eiskaltes Basispuffer resuspendieren und 10 mal mit einer engen Pistille abgeben, um Kerne freizusetzen. <ol><li> Entfernen Sie ein Aliquot von 20 μl für die DNA-Konzentrationsmessung mit einem Spektrophotometer (OD260 / OD280) und mikroskopische Beobachtung mit Trypanblau, wenn nötig (siehe unten) ( Abbildung 1 A ). </li></ol></li><li> Filtriere die Suspension durchEin Zellsieb (Porengröße: 70 μm), spülen Sie das Röhrchen und filtrieren Sie erneut mit 2 mL Basispuffer wie oben. </li><li> Wiederholen Sie die Filtration wie in Schritt 1.13 mit Zellsegmenten mit allmählich reduzierter Porengröße (40 μm, 30 μm, 20 μm und 10 μm). HINWEIS: Insgesamt wurden in den Schritten 1.12-1.14 Siebe mit 6 Porengrößen verwendet. </li><li> Bei 1000 ° C bei 4 ° C für 10 min zentrifugieren Den Überstand entfernen und das Pellet in 500 μl Basispuffer resuspendieren. </li><li> Messen Sie die DNA-Konzentration wie oben. ANMERKUNG: Etwa 200 μg nukleäre DNA wurden aus der Kombination von beiden Hinterbeinen von einem Tier erhalten. Gegebenenfalls 20 μl für die mikroskopische Beobachtung mit Trypan-Blau-Färbung (Stammkonzentration 0,4%, 1: 5 Verdünnung); Die Kerne werden blau gefärbt ( Abbildung 1 B ). </li><li> Bei 1000 ° C bei 4 ° C für 10 min zentrifugieren und den Überstand verwerfen. Pellets bei -80 ° C aufbewahren. </li></ol> 2. Sonikation &lt;Ol&gt; <li> Tauproben in 500 μl SDS-Lysepuffer auffüllen und unter leichtem Pipettieren resuspendieren. </li><li> Übertragen Sie die Kerne-DNA-Suspension auf eine Glasampulle auf Eis. </li><li> Führen Sie die Beschallung mit fokussierten Bursts von Ultraschall-Schallenergie von einem schalenförmigen Wandler aus. Siehe Materialliste für Ausstattungsdetails. Verwenden Sie folgende Einstellung: Zyklen pro Burst: 200; Intensität: 5; Arbeitszyklus: 20; Temperatur 4 - 6 ° C; 30 s ein / aus. HINWEIS: Ein Beispiel für die Bewertung der Ultraschall-Wirksamkeit ist in Abbildung 2 dargestellt . </li><li> Übertragen Sie das beschallte Chromatin auf ein 1,5 mL Röhrchen. Bei 12.000 xg für 15 min zentrifugieren und den Überstand in ein neues Röhrchen überführen. Übertragen Sie 50 μl beschallte Proben (~ 7 - 10 μg / Muskelprobe) in ein neues 1,5 mL Röhrchen für die umgekehrte Vernetzung über Nacht bei 65 ° C. Die restlichen Proben bei -80 ° C einfrieren. </li></ol> 3. Bewertung der Sonde und Quantifizierung <ol><li> Add 1.0Μl RNase A (500 U / mL RNase A: 20.000 U / ml RNase T1) zu den eingesparten 50 μl beschallten Proben und inkubieren für 30 min bei 37 ° C. </li><li> Man gibt 8 μl Protease K (10 mg / ml) zu und inkubiert 30 min bei 55 ° C. </li><li> Ernte die DNA unter Verwendung eines DNA Extraktionskits. <ol><li> Füge 5 Volumen Bindepuffer hinzu, wende sie auf Spinsäule auf und zentrifugiere bei 4.000 xg, 10 min. </li><li> Tragen Sie den Durchgang auf die gleiche Säule und zentrifugieren Sie wieder. </li><li> Waschen mit Waschpuffer zweimal bei 13.000 xg, 1 min. </li><li> Zentrifugieren Sie erneut bei 13.000 xg, 1 min, um die Säule zu trocknen. </li><li> 50 μl H 2 O zugeben und bei 13.000 xg, 1 min zentrifugieren, um DNA zu eluieren. </li><li> Tragen Sie den Durchgang auf die gleiche Säule und zentrifugieren Sie wieder. </li></ol></li><li> Quantifizierung der DNA-Menge mit einem Spektrophotometer (OD260 / OD280). Führen Sie Proben auf 0,8% Gele aus, um die Größe und Menge (1 μg) der beschallten Produkte zu bewerten ( Abbildung 2 ). HINWEIS: Die durchschnittliche Chromatinausbeute beträgt ca. ~ 20%. </li></ol> 4. ChIP <ol><li> Das zuvor gereinigte Chromatin bei -80 ° C auftauen und das Chromatin auf ~ 100 - 120 μg pro Röhrchen austauschen. Verdünnen Sie 1:10 mit Radioimmunopräzipitationstest (RIPA) -Puffer (20 mM Tris-HCl (pH 7,4), 150 mM NaCl, 1 mM EDTA, 1 mM NaF, 1 mM Na 3 VO 4, 1 mM PMSF, 1x Protease-Inhibitor-Cocktail (PIC), 0,1% Na-Desoxycholat W / v), 1% Triton X-100). <ol><li> Wenn es mehrere Proben in jeder Gruppe gibt, kombinieren Sie gleiche Mengen an Chromatin-DNA mit der Endmenge von ~ 100 - 120 μg / Probe. Sparen Sie 10% als Eingabe. </li></ol></li><li> Fügen Sie 40 μl (50% v / v Aufschlämmung in RIPA-Puffer) von BSA-vorblockierten (~ 2 h, 4 ° C) Protein A / G Agarose (Nicht-Huhn Antikörper) oder IgY Perlen (Chicken Antikörper) und inkubieren auf Ein Rotator für 3 h bei 4 ° C. </li><li> Zentrifugieren Sie bei 1000 xg, 10 min und übergeben Sie den Überstand sorgfältig auf neue Röhrchen. </li><li> Füge Antikörper bei 1 μg Antikörper pro ~ hinzu25 - 100 &amp; mgr; g Chromatin-DNA. </li><li> Bei 4 ° C über Nacht bei ca. 15 U / min leicht einwirken lassen. </li><li> Füge 10 μl BSA-vorblockierte (~ 2 h, 4 ° C) Protein A / G Agarose (Nicht-Huhn Antikörper) oder IgY Perlen (Hühner Antikörper) Mischung und drehen im kalten Raum für 2 h. </li><li> Waschen Perlen wie folgt. Mit 1 ml RIPA-Puffer für 3 min zweimal waschen, mit 1 ml hohem Salzpuffer (20 mM Tris-HCl (pH 7,4), 500 mM NaCl, 2 mM EDTA, 1 mM PMSF, 1% Triton X-100) für 3 min zweimal waschen , Mit 1 ml LiCl-Puffer (20 mM Tris-HCl (pH 7,4), 250 mM LiCl, 2 mM EDTA, 1 mM PMSF, 1% Na-Desoxycholat, 0,5% NP40) für 3 min zweimal gewaschen. <ol><li> Mit 1 ml Tris-EDTA (TE) -Puffer (10 mM Tris-HCl (pH 7,4), 1 mM EDTA) für 3 min einmal abwaschen. Dann eluierte DNA mit Elutionspuffer (20 mM Tris-HCl, 5 mM EDTA und 0,5% SDS). </li></ol></li><li> Zentrifugieren bei 1.000 g, 1 min und vorsichtig den Überstand entfernen. </li><li> Resaustieren Sie den Wulst mit 50 &amp; mgr; l Elutionspuffer. </li><li> Inkubieren für 10Min bei 65 ° C. </li><li> Zentrifugieren bei 12.000 g für 5 min. </li><li> Übertragen Sie den Überstand in ein neues Röhrchen, fügen Sie weitere 50 μl hinzu und zentrifugieren Sie noch einmal bei 12.000 g für 5 min. Das endgültige Elutionsvolumen beträgt 100 μl. </li><li> Reverse Vernetzung und DNA-Elution. <ol><li> Inkubieren des eluierten Chromatins über Nacht bei 65 ° C. </li><li> Man gibt 1,0 ul RNase A zu und inkubiert für 30 min bei 37 ° C. </li><li> Man gibt 8 μl Protease K (10 mg / ml) zu und inkubiert 30 min bei 55 ° C. </li><li> Ernte die DNA unter Verwendung eines PCR-Cleanup-Kits mit Elutionsvolumen bei 50 μL nach dem Protokoll des Herstellers. </li></ol></li><li> Analysieren Sie die Profile von Real-time qPCR wie zuvor beschrieben 25 , 26 . HINWEIS: Die Primer-Sequenzen sind in Abbildung 3 Legende aufgelistet. Die Daten werden als Mittelwert ± SEM dargestellt ( Abbildung 3 ). </li></ol>

<ol>
	<li>Bouzakri, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=siRNA-based+gene+silencing+reveals+specialized+roles+of+IRS-1/Akt2+and+IRS-2/Akt1+in+glucose+and+lipid+metabolism+in+human+skeletal+muscle.">siRNA-based gene silencing reveals specialized roles of IRS-1/Akt2 and IRS-2/Akt1 in glucose and lipid metabolism in human skeletal muscle.</a> Cell Metab. 4 (1), 89-96 (2006).</li><li>Boucher, J., Kleinridders, A., Kahn, C. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insulin+receptor+signaling+in+normal+and+insulin-resistant+states.">Insulin receptor signaling in normal and insulin-resistant states.</a> Cold Spring Harb Perspect Biol. 6 (1), (2014).</li><li>Green, C. B., Takahashi, J. S., Bass, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+meter+of+metabolism.">The meter of metabolism.</a> Cell. 134 (5), 728-742 (2008).</li><li>Liu, A. C., Lewis, W. G., Kay, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+circadian+signaling+networks+and+therapeutic+targets.">Mammalian circadian signaling networks and therapeutic targets.</a> Nat Chem Biol. 3 (10), 630-639 (2007).</li><li>Harfmann, B. D., Schroder, E. A., Esser, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Circadian+rhythms,+the+molecular+clock,+and+skeletal+muscle.">Circadian rhythms, the molecular clock, and skeletal muscle.</a> J Biol Rhythms. 30 (2), 84-94 (2015).</li><li>Nohara, K., Yoo, S. H., Chen, Z. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Manipulating+the+circadian+and+sleep+cycles+to+protect+against+metabolic+disease.">Manipulating the circadian and sleep cycles to protect against metabolic disease.</a> Front Endocrinol (Lausanne). 6, 35 (2015).</li><li>Harfmann, B. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscle-specific+loss+of+Bmal1+leads+to+disrupted+tissue+glucose+metabolism+and+systemic+glucose+homeostasis.">Muscle-specific loss of Bmal1 leads to disrupted tissue glucose metabolism and systemic glucose homeostasis.</a> Skelet Muscle. 6, 12 (2016).</li><li>Pedersen, B. K., Febbraio, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Muscles,+exercise+and+obesity:+skeletal+muscle+as+a+secretory+organ.">Muscles, exercise and obesity: skeletal muscle as a secretory organ.</a> Nat Rev Endocrinol. 8 (8), 457-465 (2012).</li><li>Solomon, M. J., Varshavsky, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Formaldehyde-mediated+DNA-protein+crosslinking:+a+probe+for+in+vivo+chromatin+structures.">Formaldehyde-mediated DNA-protein crosslinking: a probe for in vivo chromatin structures.</a> Proc Natl Acad Sci U S A. 82 (19), 6470-6474 (1985).</li><li>Jackson, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Studies+on+histone+organization+in+the+nucleosome+using+formaldehyde+as+a+reversible+cross-linking+agent.">Studies on histone organization in the nucleosome using formaldehyde as a reversible cross-linking agent.</a> Cell. 15 (3), 945-954 (1978).</li><li>Gilmour, D. S., Lis, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Detecting+protein-DNA+interactions+in+vivo:+distribution+of+RNA+polymerase+on+specific+bacterial+genes.">Detecting protein-DNA interactions in vivo: distribution of RNA polymerase on specific bacterial genes.</a> Proc Natl Acad Sci U S A. 81 (14), 4275-4279 (1984).</li><li>Takahashi, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+RNA-seq+methods+to+study+circadian+control+of+transcription+in+mammals.">ChIP-seq and RNA-seq methods to study circadian control of transcription in mammals.</a> Methods Enzymol. 551, 285-321 (2015).</li><li>Kuo, M. H., Allis, C. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+cross-linking+and+immunoprecipitation+for+studying+dynamic+Protein:DNA+associations+in+a+chromatin+environment.">In vivo cross-linking and immunoprecipitation for studying dynamic Protein:DNA associations in a chromatin environment.</a> Methods. 19 (3), 425-433 (1999).</li><li>Chen, Z., Manley, J. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Core+promoter+elements+and+TAFs+contribute+to+the+diversity+of+transcriptional+activation+in+vertebrates.">Core promoter elements and TAFs contribute to the diversity of transcriptional activation in vertebrates.</a> Mol Cell Biol. 23 (20), 7350-7362 (2003).</li><li>Menet, J. S., Abruzzi, K. C., Desrochers, J., Rodriguez, J., Rosbash, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dynamic+PER+repression+mechanisms+in+the+Drosophila+circadian+clock:+from+on-DNA+to+off-DNA.">Dynamic PER repression mechanisms in the Drosophila circadian clock: from on-DNA to off-DNA.</a> Genes Dev. 24 (4), 358-367 (2010).</li><li>Miki, T., Matsumoto, T., Zhao, Z., Lee, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=p53+regulates+Period2+expression+and+the+circadian+clock.">p53 regulates Period2 expression and the circadian clock.</a> Nat Commun. 4, 2444 (2013).</li><li>Furey, T. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIP-seq+and+beyond:+new+and+improved+methodologies+to+detect+and+characterize+protein-DNA+interactions.">ChIP-seq and beyond: new and improved methodologies to detect and characterize protein-DNA interactions.</a> Nat Rev Genet. 13 (12), 840-852 (2012).</li><li>Koike, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+and+chromatin+landscape+of+the+core+circadian+clock+in+mammals.">Transcriptional architecture and chromatin landscape of the core circadian clock in mammals.</a> Science. 338 (6105), 349-354 (2012).</li><li>Zhou, J., Yu, W., Hardin, P. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ChIPping+away+at+the+Drosophila+clock.">ChIPping away at the Drosophila clock.</a> Methods Enzymol. 551, 323-347 (2015).</li><li>Takahashi, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptional+architecture+of+the+mammalian+circadian+clock.">Transcriptional architecture of the mammalian circadian clock.</a> Nat Rev Genet. , (2016).</li><li>Edelman, J. C., Edelman, P. M., Kniggee, K. M., Schwartz, I. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+skeletal+muscle+nuclei.">Isolation of skeletal muscle nuclei.</a> J Cell Biol. 27 (2), 365-377 (1965).</li><li>Ohkawa, Y., Mallappa, C., Vallaster, C. S., Imbalzano, A. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+nuclei+from+skeletal+muscle+satellite+cells+and+myofibers+for+use+in+chromatin+immunoprecipitation+assays.">Isolation of nuclei from skeletal muscle satellite cells and myofibers for use in chromatin immunoprecipitation assays.</a> Methods Mol Biol. 798, 517-530 (2012).</li><li>Wilkie, G. S., Schirmer, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Purification+of+nuclei+and+preparation+of+nuclear+envelopes+from+skeletal+muscle.">Purification of nuclei and preparation of nuclear envelopes from skeletal muscle.</a> Methods Mol Biol. 463, 23-41 (2008).</li><li>Hahn, C. G., Covault, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+transcriptionally+active+nuclei+from+striated+muscle+using+Percoll+density+gradients.">Isolation of transcriptionally active nuclei from striated muscle using Percoll density gradients.</a> Anal Biochem. 190 (2), 193-197 (1990).</li><li>Jeong, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dual+attenuation+of+proteasomal+and+autophagic+BMAL1+degradation+in+Clock+Delta19/++mice+contributes+to+improved+glucose+homeostasis.">Dual attenuation of proteasomal and autophagic BMAL1 degradation in Clock Delta19/+ mice contributes to improved glucose homeostasis.</a> Scientific reports. 5, 12801 (2015).</li><li>Nohara, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ammonia-lowering+activities+and+carbamoyl+phosphate+synthetase+1+(Cps1)+induction+mechanism+of+a+natural+flavonoid.">Ammonia-lowering activities and carbamoyl phosphate synthetase 1 (Cps1) induction mechanism of a natural flavonoid.</a> Nutrition &amp; metabolism. 12, 23 (2015).</li><li>Zhang, L., Rubins, N. E., Ahima, R. S., Greenbaum, L. E., Kaestner, K. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Foxa2+integrates+the+transcriptional+response+of+the+hepatocyte+to+fasting.">Foxa2 integrates the transcriptional response of the hepatocyte to fasting.</a> Cell Metab. 2 (2), 141-148 (2005).</li><li>Gade, P., Kalvakolanu, D. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chromatin+immunoprecipitation+assay+as+a+tool+for+analyzing+transcription+factor+activity.">Chromatin immunoprecipitation assay as a tool for analyzing transcription factor activity.</a> Methods Mol Biol. 809, 85-104 (2012).</li><li>Kondratov, R. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BMAL1-dependent+circadian+oscillation+of+nuclear+CLOCK:+posttranslational+events+induced+by+dimerization+of+transcriptional+activators+of+the+mammalian+clock+system.">BMAL1-dependent circadian oscillation of nuclear CLOCK: posttranslational events induced by dimerization of transcriptional activators of the mammalian clock system.</a> Genes Dev. 17 (15), 1921-1932 (2003).</li><li>Ripperger, J. A., Schibler, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rhythmic+CLOCK-BMAL1+binding+to+multiple+E-box+motifs+drives+circadian+Dbp+transcription+and+chromatin+transitions.">Rhythmic CLOCK-BMAL1 binding to multiple E-box motifs drives circadian Dbp transcription and chromatin transitions.</a> Nat Genet. 38 (3), 369-374 (2006).</li><li>Laplante, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DEPTOR+cell-autonomously+promotes+adipogenesis,+and+its+expression+is+associated+with+obesity.">DEPTOR cell-autonomously promotes adipogenesis, and its expression is associated with obesity.</a> Cell Metab. 16 (2), 202-212 (2012).</li><li>Blechman, J., Amir-Zilberstein, L., Gutnick, A., Ben-Dor, S., Levkowitz, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+metabolic+regulator+PGC-1alpha+directly+controls+the+expression+of+the+hypothalamic+neuropeptide+oxytocin.">The metabolic regulator PGC-1alpha directly controls the expression of the hypothalamic neuropeptide oxytocin.</a> J Neurosci. 31 (42), 14835-14840 (2011).</li></ol>

Die Autoren haben nichts zu offenbaren.

Hier beschreiben wir eine robuste Methode, bei der vernetzte Skelettmuskelgewebe verwendet wurden, um qualitativ hochwertige Kerne zu isolieren. Eine sequenzielle Filtration wurde durchgeführt, um die Kerne effektiv von Trümmern zu trennen, und die akustische Ultraschall-Energie aus dem schalenförmigen Wandler scherte das Chromatin für die ChIP-Analyse. Die Ergebnisse zeigten eine zirkadiane zeitspezifische Bindung von BMAL1 an Zielpromotoren. ChIP kann verwendet werden, um Echtzeit-Protein-Belegung auf genomische DNA zu erfassen, wenn Quervernetzung stattfindet. Um dieses Potenzial auszunutzen, zielten wir darauf ab, eine Methode zu entwickeln, um die Vernetzung des Skelettmuskels zum Zeitpunkt der Gewebedissektion zu ermöglichen und die Keimisolation ohne Gradienten-Ultrazentrifugation zu rationalisieren. Aufgrund der Schwierigkeit, den faserreichen Skelettmuskel im Vergleich zu weichen Geweben wie Leber zu homogenisieren, haben wir das Muskelgewebe in eiskaltem PBS gehackt und dann die Probe in einem Formaldehydpuffer homogenisiert. Nach dem Abschrecken, Gewebe Suspension waS zentrifugiert und mit eiskaltem Basispuffer gespült, um den restlichen Formaldehyd auszuspülen. Nuklei wurden durch Dounce-Homogenisierung freigesetzt, und die Homogenate wurden nacheinander filtriert, um allmählich Zelltrümmer und Myofibrillen zu entfernen. Wir haben die Filtrationsreihe entwickelt, um die Filterverstopfung zu minimieren, die die Ausbeute nachteilig beeinflussen könnte. Nur sehr kurze Myofibrillen blieben, als die sequentielle Filtration abgeschlossen war. Die Beschallungs- und ChIP-Prozeduren wurden von einem vorherigen Bericht 12 mit Modifikationen einschließlich Ultraschallzeitpunkt und SDS-Puffermenge angepasst. Der schalenförmige Sonicator ermöglicht die Exposition gegenüber zentraler Ultraschallwelle für Proben in Glasfläschchen in einem kalten Wasserbad. Im Vergleich zu Sonden-Sonicatoren steuert dieser Ultraschallgerät die Probentemperatur, um eine Überhitzung zu vermeiden, und verhindert auch eine Proben-Kreuzkontamination. Wenn Sondenschallgeber verwendet werden, müssen optimale Beschallungsbedingungen empirisch bestimmt werden. Wir haben auch die amoun reduziertT SDS-Puffer, da die Ausbeute an Muskelchromatin niedriger ist als in der Leber 12 . Mehrere Protokolle 28 , 31 , 32 umfassen die Inkubation auf Eis oder bei Raumtemperatur vor der Beschallung. Doch in unserer Erfahrung hat die Vorinkubation auf Eis nicht die Ultraschall-Effizienz verbessert. In der Tat wurde in einigen Fällen die Beschallung kompromittiert. Es ist möglich, dass restliche Myofibrillen die Chromatin-DNA während der Inkubation und der abgeschwächten Ultraschall-Wirksamkeit verstrickt haben. Mit sofortiger Beschallung nach Keimsuspension im SDS-Lysepuffer gelang es uns, eine progressive Chromatin-Fragmentierung mit zunehmenden Ultraschallzyklen zu erhalten ( Abbildung 2 ). Wir bestätigten die Qualität von Chromatin mit ChIP qPCR. Wie in Fig. 3 gezeigt , war die BMAL1-Promotorbelegung bei ZT6 robust und bei ZT18 minimal, im Einklang mit dem zuvor gezeigten BMAL1 circaDian Promotorbindung 18 Dieser funktionelle Assay bestätigte die Qualität von Kernen und Chromatin. In den letzten Jahren eröffnete die rasante Entwicklung in NGS einen neuen Horizont für die ChIP-Applikation, wo ChIP-seq die genomische Bindung mit hoher Empfindlichkeit quantitativ abfragen kann. Besonders für ChIP-seq sind qualitativ hochwertige Kerne und Chromatine erforderlich, um die Protein-DNA-Wechselwirkung konsequent zu erfassen. Das hier beschriebene Verfahren kann eine wertvolle Ressource für ChIP-seq-Studien unter Verwendung des Skelettmuskels darstellen. Die ChIP-seq-Bibliotheksvorbereitung erfordert zusätzliche Maßnahmen zur Verbesserung der Signalauflösung, wie z. B. PAGE-basierte Größenauswahl 18 . Abschließend haben wir ein filtrationsbasiertes Protokoll entwickelt, um qualitativ hochwertige Kerne aus vernetzten Skelettmuskeln herzustellen. Wir entfernen die Notwendigkeit für die Ultrazentrifugation, so dass es leicht anwendbar ist. Zusätzlich zu ChIP für Gene von Interesse, die Kerne und Chromatin prWie beschrieben, kann breit auf ChIP-seq-Studien anwendbar sein.

Skelettmuskel spielt eine wichtige Rolle in Physiologie und Verhalten. Die mehrkernige Muskelfaser besteht aus Myofibrillen, in denen Aktin und Myosin funktionale Einheiten bilden, die Sarkomere genannt werden, um kontraktile Kraft zu erzeugen. Skelettmuskel ist auch das größte Stoffwechselorgan im Körper, das für&gt; 80% postprandiale Glukoseaufnahme und regulierende Insulinreaktion und metabolische Homöostase 1 , 2 verantwortlich ist . Die Muskelphysiologie und der Stoffwechsel werden durch die zirkadiane Uhr, einen intrinsischen biologischen Timer 3 , 4 , 5 , 6, genau reguliert. Zum Beispiel führte die Skelettmuskelspezifische Deletion von Bmal1 , einer der Kern-zirkadianen Taktkomponenten , zu einer Insulinresistenz und einer verminderten Glukoseaufnahme im Skelettmuskel, und die Tiere wurden gefunden, um Typ-2-Diabetes 7 zu entwickeln . ichNeben der Skelettmuskulatur wird auch zunehmend ein endokrines Organ 8 geschätzt, das Myokine sekretiert, um den systemischen Stoffwechsel und die Physiologie zu regulieren. Mechanistische Studien sind erforderlich, um diese regulatorischen Funktionen im Skelettmuskel vollständig zu verstehen. ChIP ist ein leistungsfähiger Ansatz zur Abgrenzung der Promotorrekrutierung von DNA-bindenden Proteinen. ChIP wurde ursprünglich entwickelt, um die Nukleosomenorganisation auf Chromatin-DNA 9 , 10 zu identifizieren. Es wurde bisher eine Vielzahl von Verfahren zur Vernetzung von Proteinen und Chromatin-DNA unter Verwendung von Formaldehyd, Dimethylsulfat oder Ultraviolettbestrahlung (UV) 11 , 12 beschrieben . Die Formaldehyd-Vernetzung ist die am häufigsten verwendete, konservierende Chromatinstruktur und DNA-Protein-Wechselwirkungen 9 , 13 , 14 . Vernetztes ChromatIn wird durch Beschallung zerkleinert und mit Antikörper gegen das jeweilige DNA-bindende Protein von Interesse 15 , 16 immunpräzipitiert. In den letzten Jahren wurde die ChIP-Sequenzierung (ChIP-seq), eine Methode, die ChIP mit NGS kombiniert, entwickelt, um die genomweite Transkriptionsfaktorbindung 17 zu untersuchen und in einigen Fällen die dynamischen Veränderungen über einen Zeitverlauf 18 , 19 , 20 zu überwachen . Zum Beispiel haben zirkadiane ChIP-seq-Studien eine hochorchestrierte Sequenz der genomischen Bindung von zirkadianen Taktkomponenten und Histonmarkern, die eine zeitlich präzise Genexpression während des gesamten 24h-zirkadischen Zyklus 18 antreibt. Die meisten verfügbaren ChIP-Protokolle sind für Weichgewebe ( zB Leber, Gehirn, etc. ) konzipiert, und nur sehr wenige wurden für harte Gewebe einschließlich Skele veröffentlichtTal muskel Es ist technisch anspruchsvoll, den faserreichen Skelettmuskel zu homogenisieren und die hochwertigen Kerne 21 zu isolieren, insbesondere für ChIP-Experimente, die eine Vernetzung erfordern. In einer neueren Muskel-ChIP-Studie 22 wurden Satelliten-Zellen von Myofasern getrennt, und die Kerne wurden aus beiden Zelltypen durch ein verlängertes Verfahren mit Gewebeverdauung hergestellt. Der gesamte Prozeß dauerte etwa drei Stunden, bis die Formaldehyd-Vernetzung an isolierten Kernen durchgeführt wurde. Während dieses Verfahren eine vernetzte Muskelfaser vermeidet, die das Muskelgewebe für eine effiziente Homogenisierung noch widerstandsfähiger macht und in der Lage war, qualitativ hochwertige Kerne herzustellen, entsteht die signifikante Zeitverzögerung von der Gewebsansammlung zur Keimvernetzung das Risiko einer veränderten DNA -protein-interaktion Im Gegensatz dazu führten die meisten Studien eine Vernetzung unmittelbar nach der experimentellen Behandlung oder Gewebesammlung durch, um das Echtzeit-DNA-Protei zu erhaltenN Bindung 12 Ein zweiter Nachteil der Kerneisolation vor der Vernetzung besteht darin, dass sie zeitempfindliche Anwendungen wie zirkadiane Probensammlungen ausschließt, die typischerweise in Intervallen von 3 - 4 h auftreten. Ohne Vernetzung der Kerne muss die Isolierung unmittelbar nach der Sezierung erfolgen, während vernetzte Proben nach Beendigung des gesamten Zeitverlaufs zusammen verarbeitet werden können, so dass eine größere experimentelle Konsistenz gewährleistet ist. Andere Protokolle für die Kernenisolation aus dem unvernetzten Skelettmuskel wurden ebenfalls berichtet. Zwei Studien beschreiben die Verwendung von Gradienten-Ultrazentrifugation, um Kerne von verbleibenden Myofibrillen und Zelltrümmern 23 , 24 zu trennen. Während die Saccharose- oder Kolloidgradienten-Ultrazentrifugation mit unvernetzten Muskelgeweben wirksam ist, zeigten unsere Experimente, dass nach der Vernetzung die Gradienten-Ultrazentrifugation die Kerne nicht von der Zelle d trennteEbris auf dem gradienten Wir haben daher ein Verfahren entwickelt, um qualitativ hochwertige Kerne unter Verwendung von vernetzten Maus-Skelettmuskelgeweben zu isolieren. Statt der Gradienten-Ultrazentrifugation haben wir eine serielle Filtrationsmethode entwickelt, um die Kerne effektiv von Trümmern zu trennen. Nach der Ultraschallbehandlung wurden die Chromatinproben erfolgreich für ChIP-Studien angewendet, die ein zirkadianes Muster der BMAL1-Proteinbindung an Ziel-Promotoren zeigten. Unsere Methode kann breit auf verschiedene mechanistische Studien von Muskelgeweben anwendbar sein.

<table><tbody><tr><td>&lt;strong&gt;Materials&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Formaldehyde solution</td><td>Sigma Aldrich</td><td>F8775&amp;nbsp;</td><td></td></tr><tr><td>Glycine</td><td>Fisher Scientific</td><td>BP381-5</td><td></td></tr><tr><td>Trypan Blue solution (0.4%)</td><td>Fisher Scientific</td><td>15250061</td><td></td></tr><tr><td>RNase A</td><td>Sigma Aldrich</td><td>10109142001</td><td></td></tr><tr><td>Protease K</td><td>Sigma Aldrich</td><td>3115887001</td><td></td></tr><tr><td>Chicken Anti-BMAL1 antibody</td><td></td><td></td><td>Generated in chicken (Cocalico Biologicals) against antigen aa 318 - 579, and IgY was affinity purified using the same antigen.&amp;nbsp;</td></tr><tr><td>Chicken IgY Precipitating Resin</td><td>GenScript</td><td>L00405</td><td></td></tr><tr><td>&lt;strong&gt;Equipment&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>KINEMATICA&amp;nbsp;Polytron PT2100 Benchtop Homogenizer</td><td>Fisher Scientific</td><td>08-451-178</td><td></td></tr><tr><td>15 mL Dounce tissue grinder</td><td>Whearton</td><td>357544</td><td></td></tr><tr><td>Falcon Cell Strainers 100 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-19</td><td></td></tr><tr><td>Falcon Cell Strainers 70 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-1</td><td></td></tr><tr><td>Falcon Cell Strainers 40 &amp;micro;m</td><td>Fisher Scientific</td><td>08-771-2</td><td></td></tr><tr><td>pluriStrainer 30 &amp;micro;m</td><td>PluriSelect</td><td>43-50030-03</td><td></td></tr><tr><td>pluriStrainer 20 &amp;micro;m</td><td>PluriSelect</td><td>43-50020-03</td><td></td></tr><tr><td>pluriStrainer 10 &amp;micro;m</td><td>PluriSelect</td><td>43-50010-03</td><td></td></tr><tr><td>Covaris S2 Focused-ultrasonicator</td><td>Covaris</td><td>Model S2</td><td></td></tr><tr><td>Labquake&amp;nbsp;</td><td>Thermo Scientific</td><td>C415110</td><td></td></tr><tr><td>CCD Microscope Camera</td><td>&amp;nbsp;Leica Microsystems</td><td>DFC3000 G</td><td></td></tr><tr><td>&lt;strong&gt;Reagent Kit&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DNA extraction kit</td><td>Thermo Scientific</td><td>K0691</td><td></td></tr><tr><td>&lt;strong&gt;Buffers&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>All buffer components are discribed in the protocol. Each component was purchased from Sigma Aldrich</td><td></td><td></td><td></td></tr></tbody></table>

a filtration-based method of preparing high-quality nuclei from cross-linked skeletal muscle for chromatin immunoprecipitation

Chromatin-Immunpräzipitation (ChIP) ist eine leistungsfähige Methode zur Bestimmung der Proteinbindung an Chromatin-DNA. Faserreicher Skelettmuskel war jedoch eine Herausforderung für ChIP aufgrund technischer Schwierigkeiten bei der Isolierung von hochwertigen Kernen mit minimaler Kontamination von Myofibrillen. Bisherige Protokolle haben versucht, Kerne vor der Vernetzung zu reinigen, was das Risiko einer veränderten DNA-Protein-Wechselwirkung während des verlängerten Keimpräparationsverfahrens verursacht. In dem aktuellen Protokoll haben wir zuerst das Skelettmuskelgewebe, das von Mäusen gesammelt wurde, vernetzt und die Gewebe wurden gehackt und beschallt. Da wir festgestellt haben, dass die Ultrazentrifugation nicht in der Lage war, Kerne von Myofibrillen unter Verwendung von vernetzten Muskelgeweben zu trennen, entwickelten wir ein sequentielles Filtrationsverfahren, um qualitativ hochwertige Kerne ohne signifikante Myofibrillenverunreinigung zu erhalten. Anschließend wurden Chromatin unter Verwendung eines Ultraschallgerätes hergestellt und ChIP-Assays mit anti-BMAL1-Antikörper zeigten eine robuste zirkadiane BindungMuster von BMAL1 zu Zielgen-Promotoren. Dieses Filtrationsprotokoll stellt eine leicht anwendbare Methode dar, um qualitativ hochwertige Kerne aus vernetzten Skelettmuskelgeweben zu isolieren, was eine konsistente Probenverarbeitung für zirkadiane und andere zeitempfindliche Studien ermöglicht. In Kombination mit der Sequenzierung der nächsten Generation (NGS) kann unsere Methode für verschiedene mechanistische und genomische Studien eingesetzt werden, die sich auf die Skelettmuskelfunktion konzentrieren.

Hier haben wir die Formaldehyd-Vernetzung unmittelbar nach der Gewebesammlung durchgeführt, um die DNA-Protein-Wechselwirkung in Echtzeit zu bewahren. Jedoch fanden wir, dass Saccharose oder kolloidaler Gradient, der üblicherweise für die Kerneisolation 23 , 24 verwendet wurde , bei der Trennung von Kernen von Myofibrillen (Daten nicht gezeigt) wirksam war. Der Grund mag sein, dass die Vernetzung eine ähnliche Schwerkraft für Kerne und Myofibrillen verlieh. Daher entwickelten wir ein serielles Filtrationsverfahren, um effektiv große Myofibrillen und andere Ablagerungen aus der Kernefraktion zu entfernen. Nach 100 μm Filtration gab es noch große Gewebeablagerungen und Myofibrillen ( Abbildung 1 A ). Im Vergleich dazu wurden am Ende der sequentiellen Filtration die meisten großen Gewebeablagerungen, intakten Zellen und großen Myofibrillen erfolgreich entfernt ( Abbildung 1 B ). <p clAss = &quot;jove_content&quot; fo: keep-together.within-page = &quot;1&quot;&gt; Diese Kerne wurden für die schalenförmige Ultraschallbehandlung verwendet. Die bei -80 ° C gespeicherten Kerne wurden in SDS-Lysepuffer suspendiert und sofort einer Beschallung unterworfen. Obwohl die Inkubation von Kernen im SDS-Lysepuffer auf Eis oder Raumtemperatur die Beschallung für etwas Gewebe wie Leber 27 oder Maus-Embryonal-Fibroblasten (MEF) 28 verbessern kann, störte er in unserer Erfahrung die Beschallung von Skelettmuskelkernen und führte zu einem breiten Verschmieren Ineffektive sonication Unter Verwendung des aktuellen Protokolls mit sofortiger Beschallung nach Suspension in SDS-Lysepuffer beobachteten wir eine effiziente Ultraschallbehandlung mit Chromatin, die allmählich zyklusabhängig zerkleinert wurde und schließlich ~ 500 bp DNA-Fragmente produzierte ( Abbildung 2 ). Die Vorinkubation im Lysepuffer beeinträchtigte die Beschallungseffizienz nachweisbar. BetrügenFeste die Qualität der Chromatinpräparation für ChIP, untersuchten wir die DNA-Bindung des zirkadianen Transkriptionsfaktors BMAL1, der bei Zeitgeberzeit (ZT) 6 bzw. ZT18 bzw. 18 , 29 Bindungspeak und Trog zeigte. Skelettmuskelproben von C57B / 6J-Mäusen wurden bei ZT6 und ZT18 gesammelt und Chromatinproben wurden wie oben hergestellt. Kurz nach der Beschallung wurden zerkleinerte Chromatinproben mit IgY-Kügelchen vorbereitet, die mit BSA vorblockiert worden waren, gefolgt von einer Inkubation mit anti-BMAL1-Antikörper bei 4ºC über Nacht. Nach der Elution und Reinigung von Chromatin haben wir RT-qPCR durchgeführt, um die BMAL1-Bindung an E-Box-Elementen von zwei Zielgenen Nr1d1 und Dbp 30 zu detektieren . Wir erkannten eine robuste Bindung von BMAL1 an die E-Box-Elemente bei ZT6 und eine minimale Bindung an ZT18 ( Nr1d1 : 0,452 ± 0,022 vs. 0,039 ± 0,002, Dbp -0,4: 0,627 ± 0,013 gegenüber 0,062 ± 0,009, Dbp+0,8: 0,176 ± 0,013 gegenüber 0,008 ± 0,001, Dbp +2,4: 0,466 ± 0,010 gegenüber 0,122 ± 0,014; Alle Werte sind Mittelwert ± SEM) ( Abbildung 3 ), Validierung des Protokolls für die zeitempfindliche Transkriptionsfaktor-Bindungsanalyse im Skelettmuskel. <img alt="Abbildung 1" class="xfigimg" src="/files/ftp_upload/56013/56013fig1.jpg" /> Abbildung 1 : Sequentielle Filtration wirksam entnommene Tissue Debris. (A) Repräsentative Bilder, die Proben nach 100 μm Filtration zeigen. Große Gewebe- und Faserablagerungen werden beobachtet. (B) Repräsentative Bilder, die Proben nach serieller Filtration zeigen. Große Faserablagerungen wurden geräumt. Es werden nur isolierte Kerne und kleine Myofibrillenfragmente beobachtet. Bilder wurden mit einem Lichtmikroskop bei 10X, 20X und 40X Vergrößerungen aufgenommen. Maßstäbe werden auf der rechten Seite angezeigt.<a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig1large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Figur 2" class="xfigimg" src="/files/ftp_upload/56013/56013fig2.jpg" /> Abbildung 2 : Progressive Chromatin-Zerkleinerung durch 10 Zyklen der Sonikation. Zehn Zyklen der Beschallung mit verdauter Chromatin-DNA bis ~ 500 bp, wie in einem 0,8% Agarosegel offenbart, laufen bei 150 V für 60 min. Das rechte Panel zeigt eine niedrigere Ultraschallwirkung nach der Vorinkubation in eiskaltem SDS-Lysepuffer für 1 h an. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig2large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a> <img alt="Abbildung 3" class="xfigimg" src="/files/ftp_upload/56013/56013fig3.jpg" /> FiAbbildung 3 : Repräsentative qPCR Ergebnisse für BMAL1 ChIP mit Maus Skelettmuskelproben bei ZT6 und ZT18 gesammelt. Die Daten werden als Mittelwert ± SEM dargestellt. Dbp -0.4, +0.8 und +2.4 geben Orte der E-Box-Elemente auf dem Dbp- Gen an. NC: Negativkontrolle mit IgY. Das zeitliche Muster der BMAL1-Bindung stimmt mit den bisherigen Ergebnissen überein, die den BMAL1-Bindungspeak um etwa ZT6 18 zeigen . Die Vorwärts- und Rückwärtsprimer sind wie folgt. Rev-erba: 5&#39;-GTAGACTACAAATCCCAACAATCCTG und 5&#39;-TGGAGCAGGTACCATGTGATTC; Dbp -0,4: 5&#39;-ACACCCGCATCCGATAGC und 5&#39;-CCACTTCGGGCCAATGAG; Dbp +0,8: 5&#39;- ATGCTCACACGGTGCAGACA und 5&#39;- CTGCTCAGGCACATTCCTCAT; Dbp +2.4: 5&#39;- TGGGACGCCTGGGTACAC und 5&#39;-GGGAATGTGCAGCACTGGTT. <a href="https://ecsource-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/56013/56013fig3large.jpg" target="_blank">Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.</a>

Watch this Scientific Journal Video about A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation at JoVE.com

A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

Wir präsentieren ein Filtrations-basiertes Protokoll, um qualitativ hochwertige Kerne aus vernetzten Mäuseskelettmuskeln zu isolieren, wobei wir die Notwendigkeit einer Ultrazentrifugation entfernt haben, wodurch es leicht anwendbar ist. Wir zeigen, dass das aus den Kernen hergestellte Chromatin für die Chromatin-Immunpräzipitation und wahrscheinlich Chromatin-Immunpräzipitations-Sequenzierungsstudien geeignet ist.

Eine Filtrations-basierte Methode zur Herstellung von hochwertigen Nuklei aus vernetzten Skelettmuskeln für Chromatin-Immunpräzipitation

Chromatin immunoprecipitation (ChIP) is a powerful method to determine protein binding to chromatin DNA. Fiber-rich skeletal muscle, however, has been a ...

a-filtration-based-method-preparing-high-quality-nuclei-from-cross

Nanyang Technological University

Research

JoVE Journal

Biochemistry

8.8K Aufrufe.  University of Texas Health Science Center at Houston.  Wir präsentieren ein Filtrations-basiertes Protokoll, um qualitativ hochwertige Kerne aus vernetzten Mäuseskelettmuskeln zu isolieren, wobei wir die Notwendigkeit einer Ultrazentrifugation entfernt haben, wodurch es leicht anwendbar ist. Wir zeigen, dass das aus den Kernen hergestellte Chromatin für die Chromatin-Immunpräzipitation und wahrscheinlich Chromatin-Immunpräzipitations-Sequenzierungsstudien geeignet ist. 

Serie: A Filtration-based Method of Preparing High-quality Nuclei from Cross-linked Skeletal Muscle for Chromatin Immunoprecipitation

Improved Protocol for Chromatin Immunoprecipitation from Mouse Skeletal Muscle

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a high content of structural proteins. Dissected limb muscles from adult mice are physically disrupted by mechanical homogenisation, or a combination of mincing and douncing, in a hypotonic buffer before formaldehyde fixation of the cell lysate. The fixed nuclei are purified by further cycles of mechanical homogenisation or douncing and sequential filtrations to remove cell debris. The purified nuclei can be sonicated immediately or at a later stage after freezing. The chromatin can be efficiently sonicated and is suitable for chromatin immunoprecipitation experiments, as illustrated by the profiles obtained for transcription factors, RNA polymerase II, and covalent histone modifications. The binding events detected using chromatin prepared by this protocol are predominantly those taking place in the muscle fiber nuclei despite the presence of chromatin from other fiber-associated satellite and endothelial cells. This protocol is therefore adapted to study gene regulation in the adult mouse skeletal muscle.

A novel protocol for the preparation of chromatin from adult mouse skeletal muscle adapted to the study of gene regulation in muscle fibers by chromatin immunoprecipitation is presented.

Verbesserte Protokoll für Chromatin Immunopräzipitation aus Maus skelettartiger Muskel

We describe an efficient and reproducible protocol for the preparation of chromatin from adult mouse skeletal muscle, a physically resistant tissue with a ...

Forschung

Biochemie

Chromatin Immunoprecipitation from Dorsal Root Ganglia Tissue following Axonal Injury

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after injury (Teng et al., 2006). It is recognized that transcriptional programs essential for neurite and axonal outgrowth are 
reactivated upon injury in the PNS (Makwana et al., 2005). However the tools available to analyze neuronal gene regulation in vivo are limited and 
often challenging.
The dorsal root ganglia (DRG) offer an excellent injury model system because both the CNS and PNS are innervated by a 
bifurcated axon originating from the same soma. The ganglia represent a discrete collection of cell bodies where all transcriptional events occur, 
and thus provide a clearly defined region of transcriptional activity that can be easily and reproducibly removed from the animal. Injury of nerve 
fibers in the PNS (e.g. sciatic nerve), where axonal regeneration does occur, should reveal a set of transcriptional programs that are distinct from 
those responding to a similar injury in the CNS, where regeneration does not take place (e.g. spinal cord). Sites for transcription factor binding, 
histone and DNA modification resulting from injury to either PNS or CNS can be characterized using chromatin immunoprecipitation (ChIP). 
Here, we describe a ChIP protocol using fixed mouse DRG tissue following axonal injury. This powerful combination provides a means for characterizing the pro-regeneration chromatin environment necessary for promoting axonal regeneration.

We present a method for chromatin immunoprecipitation from dorsal root ganglia tissue following axonal injury. The approach can be used to identify specific transcription factor binding sites and epigenetic modification of histone and DNA important for the regeneration of injured axons in both the peripheral and central nervous system.

Chromatin Immunopräzipitation aus Spinalganglien Tissue folgende axonale Schädigung

Axons in the central nervous system (CNS) do not regenerate while those in the peripheral nervous system (PNS) do regenerate 
to a limited extent after ...

Neurowissenschaften

Quantitative Analysis of Chromatin Proteomes in Disease

In the nucleus reside the proteomes whose functions are most intimately linked with gene regulation. Adult mammalian cardiomyocyte nuclei are unique due to the high percentage of binucleated cells,1 the predominantly heterochromatic state of the DNA, and the non-dividing nature of the cardiomyocyte which renders adult nuclei in a permanent state of interphase.2 Transcriptional regulation during development and disease have been well studied in this organ,3-5 but what remains relatively unexplored is the role played by the nuclear proteins responsible for DNA packaging and expression, and how these proteins control changes in transcriptional programs that occur during disease.6 In the developed world, heart disease is the number one cause of mortality for both men and women.7 Insight on how nuclear proteins cooperate to regulate the progression of this disease is critical for advancing the current treatment options.
Mass spectrometry is the ideal tool for addressing these questions as it allows for an unbiased annotation of the nuclear proteome and relative quantification for how the abundance of these proteins changes with disease. While there have been several proteomic studies for mammalian nuclear protein complexes,8-13 until recently14 there has been only one study examining the cardiac nuclear proteome, and it considered the entire nucleus, rather than exploring the proteome at the level of nuclear sub compartments.15 In large part, this shortage of work is due to the difficulty of isolating cardiac nuclei. Cardiac nuclei occur within a rigid and dense actin-myosin apparatus to which they are connected via multiple extensions from the endoplasmic reticulum, to the extent that myocyte contraction alters their overall shape.16 Additionally, cardiomyocytes are 40% mitochondria by volume17 which necessitates enrichment of the nucleus apart from the other organelles. Here we describe a protocol for cardiac nuclear enrichment and further fractionation into biologically-relevant compartments. Furthermore, we detail methods for label-free quantitative mass spectrometric dissection of these fractions-techniques amenable to in vivo experimentation in various animal models and organ systems where metabolic labeling is not feasible.

Advances in mass spectrometry have allowed the high throughput analysis of protein expression and modification in a host of tissues. Combined with subcellular fractionation and disease models, quantitative mass spectrometry and bioinformatics can reveal new properties in biological systems. The method described herein analyzes chromatin-associated proteins in the setting of heart disease and is readily applicable to other in vivo models of human disease.

Quantitative Analyse von Chromatin Proteome in Disease

In the nucleus reside the proteomes whose functions are most intimately linked with gene regulation. Adult mammalian cardiomyocyte nuclei are unique due ...

Medizin

Efficient Chromatin Immunoprecipitation using Limiting Amounts of Biomass

Chromatin immunoprecipitation (ChIP) is a widely-used method for determining the interactions of different proteins with DNA in chromatin of living cells. Examples include sequence-specific DNA binding transcription factors, histones and their different modification states, enzymes such as RNA polymerases and ancillary factors, and DNA repair components. Despite its ubiquity, there is a lack of up-to-date, detailed methodologies for both bench preparation of material and for accurate analysis allowing quantitative metrics of interaction. Due to this lack of information, and also because, like any immunoprecipitation, conditions must be re-optimized for new sets of experimental conditions, the ChIP assay is susceptible to inaccurate or poorly quantitative results.
Our protocol is ultimately derived from seminal work on transcription factor:DNA interactions1,2 , but incorporates a number of improvements to sensitivity and reproducibility for difficult-to-obtain cell types. The protocol has been used successfully3,4 , both using qPCR to quantify DNA enrichment, or using a semi-quantitative variant of the below protocol.
This quantitative analysis of PCR-amplified material is performed computationally, and represents a limiting factor in the assay. Important controls and other considerations include the use of an isotype-matched antibody, as well as evaluation of a control region of genomic DNA, such as an intergenic region predicted not to be bound by the protein under study (or anticipated not to show changes under the experimental conditions). In addition, a standard curve of input material for every ChIP sample is used to derive absolute levels of enrichment in the experimental material. Use of standard curves helps to take into account differences between primer sets, regardless of how carefully they are designed, and also efficiency differences throughout the range of template concentrations for a single primer set. Our protocol is different from others that are available5-8 in that we extensively cover the later, analysis phase.

We describe a robust method for chromatin immunoprecipitation using primary T cells. The method is founded on standard approaches, but uses a specific set of conditions and reagents that improve efficiency for limited a quantities of cells. Importantly, a detailed description of the data analysis phase is presented.

Effiziente Chromatin Immunopräzipitation mit limitierende Mengen an Biomasse

Chromatin immunoprecipitation (ChIP) is a  widely-used method for determining the interactions of different proteins with  DNA in chromatin of living ...

Biologie

The ChroP Approach Combines ChIP and Mass Spectrometry to Dissect Locus-specific Proteomic Landscapes of Chromatin

Chromatin is a highly dynamic nucleoprotein complex made of DNA and proteins that controls various DNA-dependent processes. Chromatin structure and function at specific regions is regulated by the local enrichment of histone post-translational modifications (hPTMs) and variants, chromatin-binding proteins, including transcription factors, and DNA methylation. The proteomic characterization of chromatin composition at distinct functional regions has been so far hampered by the lack of efficient protocols to enrich such domains at the appropriate purity and amount for the subsequent in-depth analysis by Mass Spectrometry (MS). We describe here a newly designed chromatin proteomics strategy, named ChroP (Chromatin Proteomics), whereby a preparative chromatin immunoprecipitation is used to isolate distinct chromatin regions whose features, in terms of hPTMs, variants and co-associated non-histonic proteins, are analyzed by MS. We illustrate here the setting up of ChroP for the enrichment and analysis of transcriptionally silent heterochromatic regions, marked by the presence of tri-methylation of lysine 9 on histone H3. The results achieved demonstrate the potential of ChroP in thoroughly characterizing the heterochromatin proteome and prove it as a powerful analytical strategy for understanding how the distinct protein determinants of chromatin interact and synergize to establish locus-specific structural and functional configurations.

By combining native and crosslinking chromatin immunoprecipitation with high-resolution Mass Spectrometry, ChroP approach enables to dissect the composite proteomic architecture of histone modifications, variants and non-histonic proteins synergizing at functionally distinct chromatin domains.

Der Ansatz kombiniert ChroP ChIP und Massenspektrometrie zu sezieren Locus-spezifische Proteomik Landschaften des Chromatin

Chromatin is a highly dynamic nucleoprotein complex made of DNA and proteins that controls various DNA-dependent processes. Chromatin structure and ...

Generation and Purification of Human INO80 Chromatin Remodeling Complexes and Subcomplexes

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 complexes consist of 14 protein subunits including Ino80, a SNF2-like ATPase, which serves both as the catalytic subunit and the scaffold for assembly of the complexes. Functions of the other subunits and the mechanisms by which they contribute to the INO80 complex&#39;s chromatin remodeling activity remain poorly understood, in part due to the challenge of generating INO80 subassemblies in human cells or heterologous expression systems. This JOVE protocol describes a procedure that allows purification of human INO80 chromatin remodeling subcomplexes that are lacking a subunit or a subset of subunits. N-terminally FLAG epitope tagged Ino80 cDNA are stably introduced into human embryonic kidney (HEK) 293 cell lines using Flp-mediated recombination. In the event that a subset of subunits of the INO80 complex is to be deleted, one expresses instead mutant Ino80 proteins that lack the platform needed for assembly of those subunits. In the event an individual subunit is to be depleted, one transfects siRNAs targeting this subunit into an HEK 293 cell line stably expressing FLAG tagged Ino80 ATPase. Nuclear extracts are prepared, and FLAG immunoprecipitation is performed to enrich protein fractions containing Ino80 derivatives. The compositions of purified INO80 subcomplexes can then be analyzed using methods such as immunoblotting, silver staining, and mass spectrometry. The INO80 and INO80 subcomplexes generated according to this protocol can be further analyzed using various biochemical assays, which are described in the accompanying JOVE protocol. The methods described here can be adapted for studies of the structural and functional properties of any mammalian multi-subunit chromatin remodeling and modifying complexes.

This protocol describes a procedure for generating and purifying wild type and mutant versions of the human INO80 chromatin remodeling complex. Epitope tagged versions of INO80 subunits are stably expressed in HEK293 cells, and complete complexes and complexes lacking specific sets of subunits are purified by immunoaffinity chromatography.

Generation und Reinigung von Menschen INO80 Chromatin Remodeling Komplexe und Subkomplexe

INO80 chromatin remodeling complexes regulate nucleosome dynamics and DNA accessibility by catalyzing ATP-dependent nucleosome remodeling. Human INO80 ...

Identification of MyoD Interactome Using Tandem Affinity Purification Coupled to Mass Spectrometry

Skeletal muscle terminal differentiation starts with the commitment of pluripotent mesodermal precursor cells to myoblasts. These cells have still the ability to proliferate or they can differentiate and fuse into multinucleated myotubes, which maturate further to form myofibers. Skeletal muscle terminal differentiation is orchestrated by the coordinated action of various transcription factors, in particular the members of the Muscle Regulatory Factors or MRFs (MyoD, Myogenin, Myf5, and MRF4), also called the myogenic bHLH transcription factors family. These factors cooperate with chromatin-remodeling complexes within elaborate transcriptional regulatory network to achieve skeletal myogenesis. In this, MyoD is considered the master myogenic transcription factor in triggering muscle terminal differentiation. This notion is strengthened by the ability of MyoD to convert non-muscle cells into skeletal muscle cells. Here we describe an approach used to identify MyoD protein partners in an exhaustive manner in order to elucidate the different factors involved in skeletal muscle terminal differentiation. The long-term aim is to understand the epigenetic mechanisms involved in the regulation of skeletal muscle genes, i.e., MyoD targets. MyoD partners are identified by using Tandem Affinity Purification (TAP-Tag) from a heterologous system coupled to mass spectrometry (MS) characterization, followed by validation of the role of relevant partners during skeletal muscle terminal differentiation. Aberrant forms of myogenic factors, or their aberrant regulation, are associated with a number of muscle disorders: congenital myasthenia, myotonic dystrophy, rhabdomyosarcoma and defects in muscle regeneration. As such, myogenic factors provide a pool of potential therapeutic targets in muscle disorders, both with regard to mechanisms that cause disease itself and regenerative mechanisms that can improve disease treatment. Thus, the detailed understanding of the intermolecular interactions and the genetic programs controlled by the myogenic factors is essential for the rational design of efficient therapies.

MyoD is a myogenic transcription factor with a strong capacity to induce myogenic transdifferentiation of many fully differentiated non-muscle cell lines. The epigenetic mechanisms involved in this transdifferentiation are largely unknown. Here we describe a double-affinity purification method followed by mass spectrometry to exhaustively characterize MyoD partners.

Identifizierung von MyoD Interaktom Gekoppelt Mit Tandem Affinity Purification zu Mass Spectrometry

Skeletal muscle terminal differentiation starts with the commitment of pluripotent mesodermal precursor cells to myoblasts. These cells have still the ...

The ChIP-exo Method: Identifying Protein-DNA Interactions with Near Base Pair Precision

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA interactions. ChIP coupled to high throughput sequencing (ChIP-seq) is commonly used to determine the genomic location of proteins that interact with chromatin. However, ChIP-seq is hampered by relatively low mapping resolution of several hundred base pairs and high background signal. The ChIP-exo method is a refined version of ChIP-seq that substantially improves upon both resolution and noise. The key distinction of the ChIP-exo methodology is the incorporation of lambda exonuclease digestion in the library preparation workflow to effectively footprint the left and right 5&#39; DNA borders of the protein-DNA crosslink site. The ChIP-exo libraries are then subjected to high throughput sequencing. The resulting data can be leveraged to provide unique and ultra-high resolution insights into the functional organization of the genome. Here, we describe the ChIP-exo method that we have optimized and streamlined for mammalian systems and next-generation sequencing-by-synthesis platform.

Here, we present a protocol to achieve near base pair resolution of protein-DNA interactions. This is obtained by exonuclease treatment of DNA fragments selectively enriched by chromatin immunoprecipitation (ChIP-exo) followed by high throughput sequencing.

Der Chip-exo-Methode: Ermittlung von Protein-DNA-Wechselwirkungen mit Near-Basenpaar Precision

Chromatin immunoprecipitation (ChIP) is an indispensable tool in the fields of epigenetics and gene regulation that isolates specific protein-DNA ...

Chromatin Extraction from Frozen Chimeric Liver Tissue for Chromatin Immunoprecipitation Analysis

Crosslinking Chromatin Immunoprecipitation (X-ChIP) is a widely used technique to assess levels of histone marks and occupancy of transcription factors on host and/or pathogen chromatin. Chromatin preparation from tissues creates additional challenges that need to be overcome to obtain reproducible and reliable protocols comparable to those used for cell culture. Tissue disruption and fixation are critical steps to achieve efficient shearing of chromatin. Coexistence of different cell types and clusters may also require different shearing times to reach optimal fragment size and hinders shearing reproducibility. The purpose of this method is to achieve reliable and reproducible host chromatin preparations from frozen tissue (liver) suitable for both ChIP-qPCR and next generation sequencing (NGS) applications. We observed that the combination of liquid nitrogen tissue pulverization followed by homogenization leads to increased reproducibility compared to homogenization only, since it provides a suspension consisting mostly of dissociated single cells that can be efficiently sheared. Moreover, the fixation step should be performed under mild rotation to provide homogeneous crosslinking. The fixed material is then suitable for buffer-based nuclei isolation, to reduce contamination of cytoplasmic protein and pathogen DNAs and RNAs (when applicable), avoiding time-consuming centrifugation gradients. Subsequent sonication will complete nuclear lysis and shear the chromatin, producing a specific size range according to the chosen shearing conditions. The size range should fall between 100 and 300 nt for NGS applications, while it could be higher (300-700 nt) for ChIP-qPCR analysis. Such protocol adaptations can greatly improve chromatin analyses from frozen tissue specimens.

This protocol focuses on chromatin preparation from snap frozen tissues and it is suitable for Crosslinking Chromatin Immunoprecipitation (X-ChIP) followed by either quantitative PCR analysis (X-ChIP-qPCR) or next generation sequencing approaches (X-ChIP-seq).

Chromatinextraktion aus gefrorenem chimärem Lebergewebe für die Chromatin-Immunpräzipitationsanalyse

Crosslinking Chromatin Immunoprecipitation (X-ChIP) is a widely used technique to assess levels of histone marks and occupancy of transcription factors on ...

Immunoprecipitation of Target Protein-DNA Complexes from Motor Neuron Lysate

Source: Montanera, K. N. et al., Rhee, H. S. <a href="https://app-jove-com.remotexs.ntu.edu.sg/v/61124">High-Resolution Mapping of Protein-DNA Interactions in Mouse Stem Cell-Derived Neurons using Chromatin Immunoprecipitation-Exonuclease (ChIP-Exo).</a> J. Vis. Exp. (2020)
This video demonstrates the immunoprecipitation of DNA fragments crosslinked with target protein from stem cell-derived motor neuron lysates using target protein-specific antibody-coated magnetic beads.

Immunpräzipitation von Zielprotein-DNA-Komplexen aus Motoneuronen-Lysat

NOTE: Autoclaved distilled and deionized water (ddH2O) is recommended for making buffers and reaction master mixes.
1. Harvesting and crosslinking cells

	...