Wir sind dankbar, dass Gianni Scimone für hervorragende Unterstützung mit Video machen.

Behandlung von HIV-infizierten Blutproben erfordert einige wichtige Empfehlungen. Alle Proben von Blut muss in robuster auslaufsicheren Behältern transportiert werden. Vorsicht beim Sammeln der Proben eine Kontamination des Containers Außen-und einer begleitenden Unterlagen der Probe zu vermeiden. Alle Personen, die Verarbeitung infiziertes Blut muss Handschuhe tragen. Handschuhe müssen geändert werden und die Hände gewaschen nach Abschluss der Verarbeitung von Proben. Die Verarbeitung von HIV-infizierten Blutprobe muss in einer Klasse II Biohazard Kabinett Haube getan werden. Mechanische Pipettierhilfen verwendet werden sollte. Verwendung von Nadeln oder andere spitze oder scharfe Gegenstände (einschließlich Glas z. B. Pipetten oder Kapillaren) auf Situationen, in denen es keine Alternative zu beschränken. Laboratory Flächen müssen mit einem geeigneten chemischen Desinfektionsmittel nach einem Austritt von Blut dekontaminiert werden und wenn Tätigkeiten abgeschlossen sind. Verunreinigte Materialien müssen vor der Wiederverwendung dekontaminiert werden oder müssen korrekt entsorgt werden über die klinische Abfälle Route. Jeder Vorfall von beruflicher Exposition gegenüber potenziell infektiösem Blut oder Flüssigkeiten (dh diejenigen, erfordert universelle Vorsichtsmaßnahmen) sollte als medizinischer Notfall behandelt werden, da Interventionen zeitnah eingeleitet werden muss, um wirksam zu sein. Das Protokoll benötigt 5 Tage für seine Vollendung. Der Zeitrahmen ist in Abbildung 1 dargestellt sind. Bakterienarten identifiziert werden mit den Methoden in Abbildung 2 beschrieben. 1. Probengewinnung <ol><li> 9 ml Vollblut in EDTA enthaltenden Röhrchen gezogen. </li><li> Die Rohre werden bei 2000 rpm für 10 Minuten bei RT zentrifugiert, um Plasma zu erhalten. </li><li> Plasma wird in einer sterilen 2 ml Eppendorf-Röhrchen gesammelt. </li></ol> 2. DNA-Extraktion aus Plasmaproben <ol><li> Ausreichend desinfizieren Kapuze, Pipetten und Material für das Experiment nötig, um die Sterilität zu gewährleisten. </li><li> Position aller Materialien unter UV-Licht für mindestens 30 Minuten. </li><li> Wischen Sie Handschuhe mit einem Desinfektionsmittel. </li><li> Tränken Sie ein paar Papiertücher in Ethanol und legen Sie sie unter der Haube. Jedes Mal, wenn ein Trinkgeld wird verworfen wischen Sie die Pipette auf die nasse Papiertücher. </li></ol> DNA extrahiert Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Easy-DNA Kit, Invitrogen, Carlsbad CA, USA). <ol start="5"><li> 350 ul Plasma in ein steriles 2 ml Eppendorf-Röhrchen gegeben. </li><li> 350 ul gefiltert Reinstwasser als negative Kontrolle verwendet. </li><li> Add 10 l Lysozym (1mg/ml) zu den Proben. </li><li> Inkubieren für 30 Minuten bei 37 ° C. </li><li> Add 500 ul von Lysis Solution und vorsichtig mischen, um die Proben. </li><li> Inkubieren für 7 Minuten bei 65 ° C. </li><li> Add 900 ul Chloroform zu den Proben. </li><li> Vortex kräftig, bis die Proben gleichmäßig viskos sind. </li><li> Geben Sie 200 ul des Niederschlags-Lösung und kräftig vortexen. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei RT zur Trennung der Phasen und bilden die Schnittstelle. </li><li> Übertragen Sie die obere wässrige Phase in ein frisches Reaktionsgefäß mit 1 ml Ethanol 100%. </li><li> Centrifuge Proben bei 10500 rpm für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. </li><li> Add 1 ml Ethanol 70%. </li><li> Centrifuge Proben bei maximaler Geschwindigkeit für 10 Minuten bei 4 ° C. </li><li> Ethanol entfernen. Die restliche Ethanol sollte mit einem pipettator entfernt werden. </li><li> Das Pellet in 50 ul von Reinstwasser. </li><li> Lesen DNA-Konzentration mit einem Spektralphotometer. </li></ol> 3. 16S rRNA Gene PCR PCR-Amplifikation wird wie zuvor beschrieben 9 durchgeführt. <ol><li> Amplify DNA in einem 100 ul Reaktionsansatz, bestehend aus 10 ul 10x PCR-Puffer, 5 ul 25 mM MgCl2, 5 pl 2 mM insgesamt dNTPs, 1 ul 50 uM Primer RW01 (AACTGGAGGAAGGTGGGGAT), 1 ul 50 uM Primer DG74 (AGGAGGTGATCCAACCGCA), 34 ul H20 und 0,5 ul Taq-Polymerase (AmpliTaq Gold, Applied Biosystem, Foster City, CA, USA). </li><li> Transfer der PCR-Mischung Filter, um eine mögliche Kontamination durch bakterielle Taq-Polymerase zu vermeiden. </li><li> Centrifuge Filter (Microcon, Millipore, Billerica, MA, USA) für 30 Minuten bei 500 rcf bei 4 ° C. </li><li> Aliquot der PCR-Mix nach der Anzahl der Proben, die verstärkt (positive und negative PCR Kontrollen, Proben und extrahiert Wasser) werden müssen. </li><li> Verwenden Sie die folgenden Thermocycler Bedingungen: 94 ° C für 10 Minuten; 40-mal für je 1 Minute Zeit bei 94 ° C, 55 ° C und 72 ° C und 10 min bei 72 ° C. </li><li> Visualisieren Sie die PCR-Produkt auf einem 2% Agarosegel. Verwenden Sie 100 bp DNA-Leiter. PCR-Produkt beträgt ca. 360 bp (Abbildung 3). </li></ol> 4. PCR Produkt Purification Nur PCR-positiven Proben sollten gereinigt werden. Die Reinigung erfolgt mit Hilfeeines kommerziellen Kits nach den Anweisungen des Herstellers (PureLink PCR microkit, Invitrogen, Carlsbad CA, USA). <ol><li> Add 4 Volumen Binding Buffer mit Isopropanol pro 1 Volumen PCR-Produkt. </li><li> Transfer-PCR-Produkt mit Binding Buffer, um eine Spalte. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Wash-Säule mit Waschpuffer mit Ethanol. </li><li> Zentrifuge für 1 Minute bei 10000 rcf bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 1 Minute bei RT auf die Silica-Membran trocknen und entfernen Sie alle verbleibenden Waschpuffer mit Ethanol. </li><li> Add 10 l Reinstwasser. </li><li> Inkubation für 1 Minute bei RT. </li><li> Zentrifuge bei maximaler Geschwindigkeit für 2 Minuten bei RT auf die gereinigte DNA zu sammeln. </li></ol> 5. Cloning Lysogenie Broth (LB) Platte Vorbereitung <ol><li> Lösen Sie 25 g LB-Mix in ca. 800 ml Wasser. </li><li> Bringen Sie das Endvolumen auf 1 L. </li><li> Add 15 gr von Bactoagar. </li><li> Autoklaven für 20 Minuten. </li><li> Nach dem Autoklavieren kräftig Schwenken Sie die Lösung in die Flasche zu mischen geschmolzenem Agar. </li><li> Die Lösung wird auf 50 ° C. </li><li> Add Ampicillin (50 ug / ml) und schwenken, bis sie sich auflöst. </li><li> Platten gießen bis zu einer Tiefe von ca. 3mm. </li><li> Verlassen Sie die Platten bei Raumtemperatur. </li><li> Spread-X-Gal (40mg/ml) und IPTG (100 mM) auf jeder LB-Platte und bei 37 ° C bis zur Verwendung. </li></ol> Kompetente Zellen Transformation Transformation wird unter Verwendung eines kommerziellen Kits nach den Anweisungen des Herstellers (Topo TA Cloning Kit, Invitrogen, Carlsbad CA, USA). <ol><li> Bereiten Sie die Klonierungsreaktion Mix (1-4 ml frisches PCR-Produkt, 1 ul Salz-Lösung, 1 ul der Vektor-und Wasser, wenn nötig). </li><li> Mix Reaktion vorsichtig und inkubieren für 5-10 Minuten bei RT. </li><li> Legen Sie die Reaktion auf Eis. </li><li> Add 2 ul des Klonens Reaktion in ein Fläschchen mit kompetenten Zellen und vorsichtig mischen. </li><li> Inkubieren auf Eis für 30 Minuten. </li><li> Heat-Schock die Zellen für 30 Sekunden bei 42 ° C. </li><li> Sofort überweisen Sie den Schlauch in Eis. </li><li> Add 250 ul Medium. </li><li> Cap der Röhre fest sitzen und schütteln die Röhre horizontal bei 37 ° C für 1 Stunde. </li><li> Verbreiten Sie 50 ul von jeder Transformation auf eine vorgewärmte Platte selektive. </li><li> Inkubieren über Nacht bei 37 ° C. </li></ol> Nach der Inkubation zu entwickeln weiß und blaue Kolonien auf den Platten. Weiße Kolonien sind für PCR-Produkt Einsetzen positive und blaue Kolonien sind für PCR-Produkt Einsetzen negativ. 6. Sequencing Analysis Sequenzierreaktion <ol><li> Eine Mischung wird unter Verwendung dieser Reagenzien: 2,5 ul DNA, 1 ul Primer (5pmol / ul) 1,1 ul BigDye (Applied Biosystem, Foster City, CA, USA). </li><li> Thermal Cycler Bedingungen: 96 ° C für 1 Minute, 25 Mal für 96 ° C für 10 sec, 55 ° C für 15 sec und 60 ° C für 4 min. </li></ol> Säulenreinigung <ol><li> Für jede Reaktion der Vorbereitung, MicroSpin Column (Qiagen,, Mailand, Italien). </li><li> Invert Spalte und Wirbel um Harz zu mischen. </li><li> Snap off Sumpf der Kolonne, lösen Deckel ¼ Drehung, und legen Spalte in einem Reaktionsgefäß. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Transfer-Spalte, um eine saubere Mikrozentrifugenröhrchen. </li><li> Sorgfältig Pipette das gesamte PCR-Sequenzierung Reaktion in der Mitte der Säule. </li><li> Zentrifuge 3200 rpm für 1 Minute. </li><li> Gereinigte DNA wird in das Rohr (20 ul von Reinstwasser) eluite. </li></ol> Sequencing Analysis <ol><li> Laden Sie die gereinigte Probe (20 ul) in 96-Multiwellplatte. </li><li> Legen Sie die Platte in den Sequenzer. Automatisierte DNA Sequencer erzeugen ein Vier-Farben-Chromatogramm, das die Ergebnisse der Sequenzierung laufen. </li><li> Geben Sie die Nukleotidsequenz wie eine Abfrage der öffentlichen Sequenz-Datenbanken. Die Suche basiert auf der NCBI-Datenbanken und-Servern ausgeführt, mit Basic Local Alignment Search Tool (BLAST). </li><li> Betrachten Sie nur Bakterien, die mit 98-100% Homologien. </li></ol> 7. Repräsentative Ergebnisse <img src="/files/ftp_upload/2830/2830fig1.jpg" alt="Abbildung 1" /> Abbildung 1. Timeline des Verfahrens. <img src="/files/ftp_upload/2830/2830fig2.jpg" alt="Abbildung 2" /> Abbildung 2. Flussdiagramme des gesamten Identifizierung von Bakterien Verfahren. <img src="/files/ftp_upload/2830/2830fig3.jpg" alt="Abbildung 3" /> Abbildung 3. 2% Agarosegel zeigt breites Spektrum 16S rRNA-Gen PCR-Produkte. Spur 1 enthält eine 100bp DNA-Leiter, Bahn 2 die PCR positive Kontrolle enthält, zeigt Spur 3 die negative PCR-Kontrolle. Lane 4 zeigt Proben aus einem HIV-positiven Patienten, und Spur 5 enthält Wasser. Spur 6 shows Proben von gesunden Menschen und einem negativen PCR-Reaktion, Spur 7 enthält Wasser. Nur HIV-positiven Patienten zeigt eine positive PCR-Amplifikation. Reinstwasser als negative Kontrolle während der Extraktion verwendet, bedeutet, dass keine Kontamination stattgefunden. <img src="/files/ftp_upload/2830/2830fig4.jpg" alt="Abbildung 4" /> Abbildung 4. 0,7% Agarosegel zeigt Plasmid mit Miniprep-Verfahren extrahiert. Spur 1 enthält eine 1 Kilobasen DNA-Leiter, enthält Spur 2 die blaue Kontroll-Kolonie, Bahnen 3 bis 12 enthalten weiße Kolonien. Das Plasmid aus dem blauen Kolonie enthält nicht die PCR-Produkt einfügen. Alle 10 weißen Kolonien enthalten Plasmid mit dem richtigen einfügen. <img src="/files/ftp_upload/2830/2830fig5.jpg" alt="Abbildung 5" /> Abbildung 5. Zeigt ein Beispiel der bakteriellen Sequenzierung im Plasma von einem HIV-positiven Menschen. Unsere Ergebnisse zeigen, dass mikrobielle Translokation in HIV Krankheit eine polimicrobic Flora, die nicht in HIV-negativen Patienten ist zu sehen, was darauf hindeutet erheblichen Ausfall von gut Immunität in die Kontrolle der Bakterien Translokation betrifft.

<ol>
	<li>Hooper, L. V., Macpherson, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+adaptations+that+maintain+homeostasis+with+the+intestinal+microbiota.">Immune adaptations that maintain homeostasis with the intestinal microbiota.</a> Nat Rev Immunol. 10, 159-169 (2010).</li><li>Macpherson, A. J., Harris, N. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+between+commensal+intestinal+bacteria+and+the+immune+system.">Interactions between commensal intestinal bacteria and the immune system.</a> Nat Rev Immunol. 4, 478-485 (2004).</li><li>Kanauchi, O., Mitsuyama, K., Araki, Y., Andoh, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modification+of+intestinal+flora+in+the+treatment+of+inflammatory+bowel+disease.">Modification of intestinal flora in the treatment of inflammatory bowel disease.</a> Curr Pharm Des. 9, 333-346 (2003).</li><li>Brenchley, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+a+cause+of+systemic+immune+activation+in+chronic+HIV+infection.">Microbial translocation is a cause of systemic immune activation in chronic HIV infection.</a> Nat Med. 12, 1365-1371 (2006).</li><li>Brenchley, J. M., Price, D. A., Douek, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HIV+disease:+fallout+from+a+mucosal+catastrophe.">HIV disease: fallout from a mucosal catastrophe.</a> Nat Immunol. 7, 235-239 (2006).</li><li>Jiang, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Plasma+levels+of+bacterial+DNA+correlate+with+immune+activation+and+the+magnitude+of+immune+restoration+in+persons+with+antiretroviral-treated+HIV+infection.">Plasma levels of bacterial DNA correlate with immune activation and the magnitude of immune restoration in persons with antiretroviral-treated HIV infection.</a> J Infect Dis. 199, 1177-1185 (2009).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbial+translocation+is+associated+with+sustained+failure+in+CD4++T-cell+reconstitution+in+HIV-infected+patients+on+long-term+highly+active+antiretroviral+therapy.">Microbial translocation is associated with sustained failure in CD4+ T-cell reconstitution in HIV-infected patients on long-term highly active antiretroviral therapy.</a> AIDS. 22, 2035-2038 (2008).</li><li>Marchetti, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+Microbial+Translocation+and+Immune+Hyperactivation+in+Disease+Progression+of+HIV++Patients+with+Preserved+CD4+Count+in+the+Absence+of+ART.">Role of Microbial Translocation and Immune Hyperactivation in Disease Progression of HIV+ Patients with Preserved CD4 Count in the Absence of ART.</a> , (2010).</li><li>Greisen, K., Loeffelholz, M., Purohit, A., Leong, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR+primers+and+probes+for+the+16S+rRNA+gene+of+most+species+of+pathogenic+bacteria,+including+bacteria+found+in+cerebrospinal+fluid.">PCR primers and probes for the 16S rRNA gene of most species of pathogenic bacteria, including bacteria found in cerebrospinal fluid.</a> J Clin Microbiol. 32, 335-351 (1994).</li></ol>

<p class="jove_content"&gt; Hiermit zeigen ein PCR / Sequenzierung Protokoll, um die Translokation von Bakterien im peripheren Blut von HIV-infizierten Personen zu charakterisieren.</p&gt;<p class="jove_content"&gt; Die meisten zuverlässige Ergebnisse werden erzielt, wenn mittels Plasma in EDTA-haltige Röhrchen gesammelt. Nach der Blutentnahme sollte Plasma durch Zentrifugation in 2 / 3 Stunden auseinander liegen, um Hämolyse und DNA-Fragment Abbau zu vermeiden. Die Proben werden zunächst bei -20 ° C für ca. 5 Tage und dann bei -80 ° C gelagert Mehrere einfrieren und Auftau-Zyklen, die den Verlust der bakteriellen DNA verursachen können, sollten vermieden werden.</p&gt;<p class="jove_content"&gt; Plasma-Proben sollten innerhalb von 12 Stunden nach dem Auftauen verwendet werden.</p&gt;<p class="jove_content"&gt; Optimierung der DNA-Extraktion-Protokoll wurde durchgeführt, um die maximale Menge an DNA von Spender peripheren Blut zu erhalten. Genauer gesagt, ist Plasma anstelle von Vollblut verwendet, da letztere enthält geringe Mengen an Bakterien-DNA, die auch durch die große Menge an DNA aus peripheren Blutzellen abgeleiteten unterrepräsentiert.</p&gt;<p class="jove_content"&gt; Wir haben bewusst auf unserer Studie Patienten mit Zeichen und / oder Symptome einer akuten Infektion auszuschließen. Dennoch, da die Patienten mit einer HIV-bezogenen immunedepression gegenwärtigen Beeinträchtigung des Magen-Darm-Barriere und Translokation von bakteriellen Produkten, konnten wir nicht ausschließen, Translokation von ganzen Mikroorganismen. So ist die Logik hinter der Verwendung von Lysozym: Da dieses Enzym der bakteriellen Wand Schäden, erlaubt den Einsatz für die Freilassung von bakterieller DNA aus extrem niedrige Zahl der zirkulierenden Mikroorganismus, der nicht unbedingt Rechnung für offene klinische Manifestationen.</p&gt;<p class="jove_content"&gt; Das größte Problem in dem vorliegenden Experiment ist das Risiko einer Kontamination. Angesichts des hohen Risikos einer Kontamination durch PCR Umwelt-und Reagenz-übertragene Bakterien, optimierten wir Laborverfahren, um eine Verunreinigung in jedem Schritt des Experiments zu vermeiden, angefangen von der Probenentnahme.</p&gt;<p class="jove_content"&gt; Insbesondere für die besten Probenvorbereitung, ist es unerlässlich, um eine Kontamination der Plasma-Proben und Oberflächen von Kunststoff-Verbrauchsmaterialien und Behälter zu vermeiden. Dies wird durch Verwendung von Desinfektionsmitteln, puderfrei Handschuhe und durch die Einhaltung Standard-Laborverfahren erreicht. Innerhalb des beschriebenen Protokolls der wichtigsten Schritte in Bezug auf die Kontamination gefährdet sind DNA-Extraktion und Amplifikation, durch das mögliche Vorhandensein von kontaminierenden Bakterien-DNA, abgeleitet, zum Beispiel von Taq-Polymerase.</p&gt;<p class="jove_content"&gt; Mit diesem Ansatz konnten wir zeigen, dass HIV-infizierte Patienten Translokation von Bakterien polymicrobic Display im peripheren Blut. Keine Mikroben im peripheren Blut von gesunden Personen festgestellt, was möglicherweise auf die Integrität des Magen-Darm-Barriere. Zukünftige Forschung wird sich auf die Untersuchung der Rolle der peripheren Blut-Mikroflora in der Pathogenese der HIV / AIDS und das Ansprechen auf antiretrovirale Therapie konzentrieren.</p

<table border="1"><tbody><tr><th> Name des Reagenz </th><th> Firma </th><th> Katalog-Nummer </th><th> Kommentare (optional) </th></tr><tr><td> Easty-DNA Kit </td><td> Invitrogen </td><td> K 180001 </td><td></td></tr><tr><td> Chloroform </td><td> Sigma-Aldrich </td><td> C2432 </td><td></td></tr><tr><td> Ethanol </td><td> Sigma-Aldrich </td><td> E7203 </td><td></td><tr/><tr><td> UltraPure Waer </td><td> Invitrogen </td><td> 10977049 </td><td></td></tr><tr><td> Lysozym </td><td> Fluka </td><td> 62970 </td><td> 10 ug / ml in destilliertem Wasser </td></tr><tr><td> AmpliTaq Gold </td><td> Applied Biosystem </td><td> 26478701 </td><td></td></tr><tr><td> Microcon 100 </td><td> Millipore </td><td> 42413 </td><td></td></tr><tr><td> PCR-Primer </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Agarose </td><td> Eppendorf </td><td> C1343 </td><td></td></tr><tr><td> DNA-Leiter </td><td> Invitrogen </td><td> 15628019 </td><td></td></tr><tr><td> Purelink PCR Mikro-Kit </td><td> Invitrogen </td><td> K310050 </td><td></td></tr><tr><td> LB-Agar, Pulver </td><td> Invitrogen </td><td> 22700025 </td><td></td></tr><tr><td> Bactoagar </td><td> Invitrogen </td><td></td><td></td></tr><tr><td> Ampicillin </td><td> Invitrogen </td><td> 11593027 </td><td> 10 mg / mL in destilliertes Wasser </td></tr><tr><td> X-gal </td><td> Invitrogen </td><td> 15520034 </td><td> 40mg/mL in DMF </td></tr><tr><td> IPTG </td><td> Invitrogen </td><td> 15529019 </td><td> 100 mM in destilliertes Wasser </td></tr><tr><td> Topo TA Cloning Kit </td><td> Invitrogen </td><td> K450002 </td><td></td></tr><tr><td> Purelink Schnelle Plasmid Miniprep Kit </td><td> Invitrogen </td><td> K210010 </td><td></td></tr><tr><td> Big Farbstoff </td><td> Applied Biosystem </td><td> 4337455 </td><td></td></tr><tr><td> DyeEx 2,0 Spin Kit </td><td> Qiagen </td><td> 63204 </td><td></td></tr></tbody></table>

sequencing of bacterial microflora in peripheral blood: our experience with hiv-infected patients

Der gesunde Magen-Darm-Trakt ist physiologisch kolonisierten durch eine Vielzahl von kommensalen Mikroben, die die Entwicklung der humoralen und zellulären mukosalen Immunsystems 1,2 beeinflussen. Microbiota vom Immunsystem über eine starke Schleimhaut-Barriere abgeschirmt. Infektionen und Antibiotika sind dafür bekannt, sowohl die normale Magen-Darm-Schranke und die Zusammensetzung der ansässigen Bakterien, die in möglichst immun Anomalien Ergebnis 3. Mai zu ändern. HIV verursacht einen Bruch in der Magen-Darm-Barriere mit progressiven Versagen der Schleimhaut-Immunität und Leckagen in die systemische Zirkulation von bakteriellen Bioprodukte, wie Lipopolysaccharid und bakterielle DNA-Fragmente, die zu systemischen Immunaktivierung 4-7 beitragen. Mikrobielle Translokation ist in HIV / AIDS-Immunpathogenese und Ansprechen auf die Therapie 4,8 gebracht. Unser Ziel war die Zusammensetzung der Bakterien translozierenden im peripheren Blut von HIV-infizierten Patienten zu charakterisieren. Um zu verfolgen unser Ziel wir eine PCR-Reaktion für die panbacteric 16S ribosomial Gen durch eine Sequenzanalyse gefolgt. Kurz gesagt, ist Vollblut sowohl HIV-infizierten und gesunden Probanden verwendet. Da die gesunden Individuen normalen intestinalen Homöostase derzeit keine Translokation der Mikroflora wird bei diesen Patienten zu erwarten. Nach Vollblutspende durch Venenpunktion und Plasma-Trennung wird die DNA aus dem Plasma extrahiert und verwendet werden, um eine breite Palette PCR-Reaktion für die panbacteric 16S ribosomial Gen 9 Führen. Nach PCR-Produkt Reinigung, Klonierung und Sequenzierung Analysen durchgeführt.

Watch this Scientific Journal Video about Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients at JoVE.com

Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Die Sequenzierung der bakteriellen Mikroflora im peripheren Blut: Unsere Erfahrung mit HIV-infizierten Patienten

The healthy gastrointestinal tract is physiologically colonized by a large variety of commensal microbes that influence the development 
	of the humoral ...

sequencing-bacterial-microflora-peripheral-blood-our-experience-with

Nanyang Technological University

Research

JoVE Journal

Medicine

12.2K Aufrufe.  San Paolo Hospital University of Milan, Italy. Unser Experiment zeigt, wie eine Sequenzierung von bakteriellen Spezies translozierenden im peripheren Blut von HIV-positiven Patienten.

Serie: Sequencing of Bacterial Microflora in Peripheral Blood: our Experience with HIV-infected Patients

Modeling Intracerebral Hemorrhage in Mice: Injection of Autologous Blood or Bacterial Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related hospitalizations and for which no effective treatments are available to date1,2. Because of the heterogeneity of ICH in humans, various preclinical models are needed to thoroughly explore prospective therapeutic strategies3. Experimental ICH is commonly induced in rodents by intraparenchymal injection of either autologous blood or bacterial collagenase4. The appropriate model is selected based on the pathophysiology of hemorrhage induction and injury progression. The blood injection model mimics a rapidly progressing hemorrhage. Alternatively, bacterial collagenase enzymatically disrupts the basal lamina of brain capillaries, causing an active bleed that generally evolves over several hours5. Resultant perihematomal edema and neurofunctional deficits can be quantified from both models. In this study, we described and evaluated a modified double injection model of autologous whole blood6 as well as an ICH injection model of bacterial collagenase7, both of which target the basal ganglia (corpus striatum) of male CD-1 mice. We assessed neurofunctional deficits and brain edema at 24 and 72 hr after ICH induction. Intrastriatal injection of autologous blood (30 &mu;l) or bacterial collagenase (0.075U) caused reproducible neurofunctional deficits in mice and significantly increased brain edema at 24 and 72 hr after surgery (p&lt;0.05). In conclusion, both models yield consistent hemorrhagic infarcts and represent basic methods for preclinical ICH research.

Clinically relevant animal models of intracerebral hemorrhage (ICH) are needed to extend our knowledge of hemorrhagic stroke and to examine novel therapeutic strategies. In this study, we describe and evaluate two ICH models that implement unilateral injections of either autologous whole blood or bacterial collagenase into the basal ganglia (corpus striatum) of mice.

Modeling Hirnblutung in Mice: Injektion von Eigenblut oder bakterielle Collagenase

Spontaneous intracerebral hemorrhage (ICH) defines a potentially life-threatening neurological malady that accounts for 10-15% of all stroke-related ...

Forschung

Medizin

Measuring Frailty in HIV-infected Individuals. Identification of Frail Patients is the First Step to Amelioration and Reversal of Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased reserve and resistance to stressors increases in incidence with increasing age. In the elderly, frailty may pursue a step-wise loss of function from non-frail to pre-frail to frail. We studied frailty in HIV-infected patients and found that ~20% are frail using the Fried phenotype using stringent criteria developed for the elderly1,2. In HIV infection the syndrome occurs at a younger age.
HIV patients were checked for 1) unintentional weight loss; 2) slowness as determined by walking speed; 3) weakness as measured by a grip dynamometer; 4) exhaustion by responses to a depression scale; and 5) low physical activity was determined by assessing kilocalories expended in a week's time. Pre-frailty was present with any two of five criteria and frailty was present if any three of the five criteria were abnormal.
The tests take approximately 10-15 min to complete and they can be performed by medical assistants during routine clinic visits. Test results are scored by referring to standard tables. Understanding which of the five components contribute to frailty in an individual patient can allow the clinician to address relevant underlying problems, many of which are not evident in routine HIV clinic visits.

Frailty syndrome is commonly seen in the aged and reflects multi-system physiological change. However, with reduced functional reserve and resilience frailty is also known to be common in the HIV infected population. This study outlined an easily administered screening test to identify HIV patients with frailty. When significant components of frailty are identified, clinicians will be able to focus on amelioration of the problem and promote reversion to the pre-frail state.

Messen Frailty in HIV-infizierten Personen. Bezeichnung des gebrechlichen Patienten ist der erste Schritt zur Besserung und Umkehr der Frailty

A simple, validated protocol consisting of a battery of tests is available to identify elderly patients with frailty syndrome. This syndrome of decreased ...

Computerized Dynamic Posturography for Postural Control Assessment in Patients with Intermittent Claudication

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic conditions. As part of a diagnostic assessment, the early detection of postural deficits is important so that appropriate and targeted interventions can be prescribed. The Sensory Organization Test (SOT) on the EquiTest determines an individual&#39;s use of the sensory systems (somatosensory, visual, and vestibular) that are responsible for postural control. Somatosensory and visual input are altered by the calibrated sway-referenced support surface and visual surround, which move in the anterior-posterior direction in response to the individual&#39;s postural sway. This creates a conflicting sensory experience. The Motor Control Test (MCT) challenges postural control by creating unexpected postural disturbances in the form of backwards and forwards translations. The translations are graded in magnitude and the time to recover from the perturbation is computed.
Intermittent claudication, the most common symptom of peripheral arterial disease, is characterized by a cramping pain in the lower limbs and caused by muscle ischemia secondary to reduced blood flow to working muscles during physical exertion. Claudicants often display poor balance, making them susceptible to falls and activity avoidance. The Ankle Brachial Pressure Index (ABPI) is a noninvasive method for indicating the presence of peripheral arterial disease and intermittent claudication, a common symptom in the lower extremities. ABPI is measured as the highest systolic pressure from either the dorsalis pedis or posterior tibial artery divided by the highest brachial artery systolic pressure from either arm. This paper will focus on the use of computerized dynamic posturography in the assessment of balance in claudicants.

Individuals with intermittent claudication exhibit poor balance compared to healthy controls. Computerized dynamic posturography is an objective method for measuring an individual's postural responses to balance disturbances. This provides an objective reflection of the person&#x2019;s ability to respond to situations under which sensory stimuli are altered and unexpected perturbations occur.

Computerized dynamic posturography with the EquiTest is an objective technique for measuring postural strategies under challenging static and dynamic ...

Assessment of Vascular Function in Patients With Chronic Kidney Disease

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this is only partially explained by traditional CVD risk factors. Vascular dysfunction is an important non-traditional risk factor, characterized by vascular endothelial dysfunction (most commonly assessed as impaired endothelium-dependent dilation [EDD]) and stiffening of the large elastic arteries. While various techniques exist to assess EDD and large elastic artery stiffness, the most commonly used are brachial artery flow-mediated dilation (FMDBA) and aortic pulse-wave velocity (aPWV), respectively. Both of these noninvasive measures of vascular dysfunction are independent predictors of future cardiovascular events in patients with and without kidney disease. Patients with CKD demonstrate both impaired FMDBA, and increased aPWV. While the exact mechanisms by which vascular dysfunction develops in CKD are incompletely understood, increased oxidative stress and a subsequent reduction in nitric oxide (NO) bioavailability are important contributors. Cellular changes in oxidative stress can be assessed by collecting vascular endothelial cells from the antecubital vein and measuring protein expression of markers of oxidative stress using immunofluorescence. We provide here a discussion of these methods to measure FMDBA, aPWV, and vascular endothelial cell protein expression.

The degree of vascular dysfunction and contributing physiological mechanisms can be assessed in patients with chronic kidney disease by measuring brachial artery flow-mediated dilation, aortic pulse-wave velocity, and vascular endothelial cell protein expression.

Beurteilung der Gefäßfunktion bei Patienten mit chronischer Nierenerkrankung

Patients with chronic kidney disease (CKD) have significantly increased risk of cardiovascular disease (CVD) compared to the general population, and this ...

Collection and Extraction of Saliva DNA for Next Generation Sequencing

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality DNA. However, DNA extraction from saliva can yield high quality DNA with little to no degradation/fragmentation that is suitable for a variety of DNA assays without the expense of a phlebotomist and can even be acquired through the mail. However, at present, no saliva DNA collection/extraction protocols for next generation sequencing have been presented in the literature. This protocol optimizes parameters of saliva collection/storage and DNA extraction to be of sufficient quality and quantity for DNA assays with the highest standards, including microarray genotyping and next generation sequencing.

DNA extraction from saliva can provide a readily available source of high molecular weight DNA, with little to no degradation/fragmentation. This protocol provides optimized parameters for saliva collection/storage and DNA extraction to be of sufficient quality and quantity for downstream DNA assays with high quality requirements.

Sammlung und Extraktion von DNA-Speichel für Next Generation Sequencing

The preferred source of DNA in human genetics research is blood, or cell lines derived from blood, as these sources yield large quantities of high quality ...

Orthotopic Implantation and Peripheral Immune Cell Monitoring in the II-45 Syngeneic Rat Mesothelioma Model

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of the role of the tumor microenvironment in treatment response, collectively point to the need for immune-competent orthotopic models for pre-clinical testing of these new therapies. This paper demonstrates how to establish an orthotopic immune-competent rat model of pleural malignant mesothelioma. Monitoring disease progression in orthotopic models is confounded by the internal location of the tumors. To longitudinally monitor disease progression and its effect on circulating immune cells in this and other rat models of cancer, a single tube flow cytometry assay requiring only 25 &#181;l whole blood is described. This provides accurate quantification of seven immune parameters: total lymphocytes, monocytes and neutrophils, as well as the T-cell subsets CD4 and CD8, B-cells and Natural Killer cells. Different subsets of these parameters are useful in different circumstances and models, with the neutrophil to lymphocyte ratio having the greatest utility for monitoring disease progression in the mesothelioma model. Analyzing circulating immune cell levels using this single tube method may also assist in monitoring the response to immune-based treatments and understanding the underlying mechanisms leading to success or failure of treatment.

The generation of an orthotopic rat model of pleural malignant mesothelioma by implantation of II-45 mesothelioma cells into the pleural cavity of immune competent rats is presented. A flow cytometric method to analyze seven immune cell subsets in these animals from a 25 &#181;l&#160;blood sample is also described.

Orthotopen Implantation und der peripheren Immunzellenüberwachung in der II-45 Syngene Rat Mesotheliom Modell

The enormous upsurge of interest in immune-based treatments for cancer such as vaccines and immune checkpoint inhibitors, and increased understanding of ...

Endotoxin Activity Assay for the Detection of Whole Blood Endotoxemia in Critically Ill Patients

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis and septic shock. The early identification of an infectious process that is rapidly evolving to a critical illness might prompt a quicker and more intensive treatment, thereby potentially leading to better patient outcomes. The Endotoxin Activity (EA) assay can be used at the bedside as a reliable biomarker of systemic endotoxemia. The detection of elevated endotoxin activity levels has been repeatedly shown to be associated with an increased disease severity in patients with sepsis and septic shock. The assay is quick and easy to perform. Briefly, after sampling, an aliquot of whole blood is mixed with an anti-endotoxin antibody and with added LPS. Endotoxin activity is measured as the relative oxidative burst of primed neutrophils as detected by chemioluminescence. The assay&#39;s output is expressed on a scale from 0 (absent) to 1 (maximal) and categorized as &#8220;low&#8221; (&#60;0.4 units), &#8220;intermediate&#8221; (0.4&#8211;0.59 units), or &#8220;high&#8221; (&#8805;0.6 units). The detailed methodology and rationale for the implementation of the EA assay are reported in this manuscript.

We hereby present a protocol to measure at the bedside the endotoxin activity of human whole blood samples. The Endotoxin Activity assay is a simple test to perform and may be a useful biomarker in critically ill patients with sepsis.

Lipopolysaccharide, also known as endotoxin, is a fundamental component of gram-negative bacteria and plays a crucial role in the development of sepsis ...

Integration of Brain Tissue Saturation Monitoring in Cardiopulmonary Exercise Testing in Patients with Heart Failure

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction (HF). However, in clinical cardiopulmonary exercise testing (CPET), cerebral hemodynamics is not assessed. NIRS is used to measure cerebral tissue oxygen saturation (SctO2) in the frontal lobe. This method is reliable and valid and has been utilized in several studies. SctO2 is lower during both rest and peak exercise in patients with HF than in healthy controls (66.3 &#177; 13.3% and 63.4 &#177; 13.8% vs. 73.1 &#177; 2.8% and 72 &#177; 3.2%). SctO2 at rest is significantly linearly correlated with peak VO2 (r = 0.602), oxygen uptake efficiency slope (r = 0.501), and brain natriuretic peptide (r = -0.492), all of which are recognized prognostic and disease severity markers, indicating its potential prognostic value. SctO2 is determined mainly by end-tidal CO2 pressure, mean arterial pressure, and hemoglobin in the HF population. This article demonstrates a protocol that integrates SctO2 using NIRS into incremental CPET on a calibrated bicycle ergometer.

This protocol integrated near-infrared spectroscopy into conventional cardiopulmonary exercise testing to identify the involvement of the cerebral hemodynamic response in exercise intolerance in patients with heart failure.

Integration der Hirngewebesättigungsüberwachung bei Kardiopulmonaden-Übungstests bei Patienten mit Herzinsuffizienz

Cerebral hypo-oxygenation during rest or exercise negatively impacts the exercise capacity of patients with heart failure with reduced ejection fraction ...

Real-Time Monitoring of Neurocritical Patients with Diffuse Optical Spectroscopies

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact morbidity and mortality rates. However, there is currently a lack of suitable non-invasive, real-time technologies for continuous monitoring of cerebral physiology at the bedside. Diffuse optical techniques have been proposed as a potential tool for bedside measurements of cerebral blood flow and cerebral oxygenation in case of neurocritical patients. Diffuse optical spectroscopies have been previously explored to monitor patients in several clinical scenarios ranging from neonatal monitoring to cerebrovascular interventions in adults. However, the feasibility of the technique to aid clinicians by providing real-time information at the bedside remains largely unaddressed. Here, we report the translation of a diffuse optical system for continuous real-time monitoring of cerebral blood flow, cerebral oxygenation, and cerebral oxygen metabolism during intensive care. The real-time feature of the instrument could enable treatment strategies based on patient-specific cerebral physiology rather than relying on surrogate metrics, such as arterial blood pressure. By providing real-time information on the cerebral circulation at different time scales with relatively cheap and portable instrumentation, this approach may be especially useful in low-budget hospitals, in remote areas and for&#160;monitoring in open fields (e.g., defense and sports).

Presented here is a protocol for non-invasively monitoring cerebral hemodynamics of neurocritical patients in real-time and at the bedside using diffuse optics. Specifically, the proposed protocol uses a hybrid diffuse optical systems to detect and display real-time information on cerebral oxygenation, cerebral blood flow and cerebral metabolism.

Echtzeit-Monitoring neurokritischer Patienten mit diffuser optischer Spektroskopie

Neurophysiological monitoring is an important goal in the treatment of neurocritical patients, as it may prevent secondary damage and directly impact ...

Digital Handwriting Analysis of Characters in Chinese Patients with Mild Cognitive Impairment

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) can manifest fine motor disorders of the upper extremities. Handwriting is a complex and unique human activity involving both motor and cognitive coordination. Researchers from western countries have discovered that patients with MCI have abnormal handwriting features. However, no relevant studies have been conducted in the Chinese population. Owing to the cross-culture phenomenon of handwriting, the aim of this study is to find new handwriting tasks to demonstrate the differences in handwriting features between elderly patients with MCI and age-matched healthy individuals.

This study proposed a digital handwriting analysis of characters in individuals with mild cognitive impairment to find more information than is revealed by traditional pencil&#8211;paper handwriting analysis.

Digitale Handschriftanalyse von Charakteren bei chinesischen Patienten mit leichter kognitiver Beeinträchtigung

An increasing amount of evidence shows that cognitive deficits and movement dysfunctions are not separated. Patients with mild cognitive impairment (MCI) ...