وقد تم دعم هذا العمل من قبل المنح من المعهد الوطني للصحة العقلية (R00MH103531 و R01MH116901 إلى J.A.) ، ومنحة تدريب ما قبل الدكتوراه من المعهد الوطني للطب العام (T32GM007635 إلى S.R.) ، وزمالات ليدا هيل جيليام للدراسة المتقدمة (GT11021 إلى S.R.). نشكر الدكتور كيفن وولفري على المساعدة في المجهر، والدكتور ك أولريش باير لاستخدام مجهره النيففلورسنت، وتوماس سودهوف (جامعة ستانفورد) لLRRTM2 بلاسميد.

1. خلية ثقافة وtransfection
<ol><li>جعل وسائط الخلية HEK مع DMEM، 1x (تعديل دولبيككو من المتوسط النسر) تكملها مع 4.5 ز / ل الجلوكوز، L-الجلوتامين والصوديوم بيروفات و 10٪ FBS. مرشح معقمة.</li>
	<li>يحدد مسبقاً الأحرف اللينة والمستقبلات المناسبة لتشايس التجميع. ملاحظة: Neurexin3α SS4+/ - وأحد اليغانات المعروفة، LRRTM2، تم استخدامه في هذه الدراسة. وأعرب عن اليغاندس والمستقبلات من الفائدة من cDNAs في pcDNA3.1. تم استخدام تجميع جيبسون لإدراج Neurexin3α فيpcDNA3.12. Neurexin3α F/R: TTTAAACTTAAGCTTGGTACCGAGCTCGGGCGCATCCCACCATGAGCCTCTCTCACCTCACCCACTC/ GAGCGGCCGCCACTGCTGCTGCTGGGGGGGGGGACCTTACACATAATAATACTCCTTCCTT.</li>
	<li>إعداد خلايا HEK293T.<ol>
<li>تنمو خلايا HEK293T إلى التقاء في واحدة T-75 قارورة.</li>
		<li>مرة واحدة التقاء، واستخدام 2 مل من التربسين ومكان في حاضنة 37 درجة مئوية لمدة 2 دقيقة. إضافة 6 مل من وسائط HEK إلى القارورة لإعادة تعليق الخلايا ونقل جميع 8 مل إلى أنبوب مخروطي 15 مل.</li>
		<li>بيليه في 500 س ز لمدة 5 دقائق و resuspend في وسائط الخلية HEK لمجموع 8 مل.</li>
		<li>عد الخلايا وإضافة 735،000 الخلايا في كل بئر من لوحة 6-جيدا. ضبط مستوى الصوت النهائي إلى 2 مل لكل بئر باستخدام وسائط خلية HEK.</li>
		<li>وضع في حاضنة 37 درجة مئوية والسماح للخلايا أن تنمو بين عشية وضحاها أو حتى تصل إلى 50-60٪ التقاء.</li>
	</ol></li>
	<li>Transfect خلايا HEK293T باستخدام طريقة فوسفات الكالسيوم13.<ol>
<li>Transfect جيدا-1 مع 3 ميكروغرام من البروتين من الفائدة وtransfect مع 1 ميكروغرام من البروتين الفلورسنت (3 ميكروغرام من pcDNA3.1-Neurexin3αWT SS4- و 1 ميكروغرام من mCherry).</li>
		<li>Transfect بشكل جيد-2 كما في الخطوة 1.4.1. ولكن مع البروتين المتحول من الفائدة (pcDNA3.1-Neurexin3αA687T SS4-).</li>
		<li>Transfect جيدا-3 مع 3 ميكروغرام من يغاند من الفائدة وtransfect مع 1 ميكروغرام من بروتين آخر الفلورسنت (3 ميكروغرام من pcDNA3.1 LRRTM2 و 1 ميكروغرام من GFP).</li>
		<li>Transfect جيدا-4 و-5 لتكون بمثابة ضوابط سلبية: جيدا-4 مع 1 ميكروغرام من GFP و-5 جيدا مع 1 ميكروغرام من mCherry.</li>
		<li>إعداد لوحة أخرى (كما هو الحال في الخطوة 1.4.1-1.4.4) إذا تطلبت شروطًا أو عناصر تحكم إضافية (Neurexin3αWT/A687T SS4+). ملاحظة: يتم تحليل كفاءة النقل 24 ساعة بعد transfection تحت مجهر epifluorescence وكميتها كعدد من الخلايا التي تعبر عن البروتين الفلورسنت أنها كانت مصابة. ومن شأن اتباع نهج أكثر تبسيطا أن يشمل نقل خلايا HEK مع ترميز ناقلات bicistronic لبروتين الفلورسنت ورابطة الاهتمام وينصح بشدة فوق co-transfection. في حالة هذه الدراسة، ألفا Neurexins هي ~ 4.3 كيلوبايت، ولوحظت كثافة الفلوريسنس منخفضة باستخدام نظام bicistronic مما يستلزم co-transfection.</li>
	</ol></li>
	<li>بعد 48 ساعة من عملية التهيّن، حصاد الخلايا من أجل التجميع.<ol>
<li>غسل كل جيدا مرتين مع برنامج تلفزيوني.</li>
		<li>أضف 1 مل من 10 mM EDTA في برنامج تلفزيوني في كل بئر إلى فصل بلطف التفاعلات بين الخلايا إلى الخلية ولوحة احتضان عند 37 درجة مئوية لمدة 5 دقائق. ملاحظة: لا ينصح التربسين للخطوة 1.5.2 بسبب الانقسام البروتيني المحتمل لجزيئات التصاق في الدراسة. بالإضافة إلى ذلك، بعد إضافة EDTA قد لا يتم إيقاف البروتوكول حتى اكتمال كما الخلايا الآن سيتم تعرضها للظروف المحيطة.</li>
		<li>بلطف اضغط لوحة لفصل الخلايا، وحصاد كل بئر في أنابيب مخروطية 15 مل منفصلة.</li>
		<li>أنابيب مخروطية للطرد المركزي عند 500 x g ودرجة حرارة الغرفة لمدة 5 دقائق.</li>
	</ol></li>
	<li>في حين أن الخلايا هي تعبئة، وإعداد 6 أنابيب الحضانة عن طريق وضع العلامات على الجزء العلوي من كل أنبوب microcentrifuge مع كل حالة. ملاحظة: ينبغي استخدام كل تبديل في شروط GFP و mCherry لتشمل جميع الظروف التجريبية والضوابط المناسبة. على سبيل المثال: 1. GFP/mCherry، 2. mCherry/LRRTM2-GFP 3. GFP/Neurexin3αWT SS4--mCherry, 4. GFP/Neurexin3αA687T SS4- mCherry, 5. Neurexin3αWT SS4----mCherry/LRRTM2-GFP, 6. Neurexin3αA687T SS4- -mCherry/LRRTM2-GFP. جعل أنابيب إضافية لاستيعاب المزيد من الشروط والضوابط.</li>
	<li>إزالة الخلايا فائقة و resuspend في 500 ميكرولتر من وسائط HEK مع 10 mM CaCl2 و 10 mM MgCl2 2 الدفء إلى 37 درجة مئوية. ملاحظة: إضافة CaCl2 و MgCl2 يسمح جزيئات التصاق لإعادة الربط وهو مطلوب فقط إذا كان الشركاء التفاعل عبر الخلية في السؤال تتطلب الكاتيونات divalent للتصاق.</li>
	<li>عد الخلايا في كل أنبوب مخروطي 15 مل باستخدام مقياس للهيمويت و aliquot 200,000 خلية من كل حالة في أنبوب مناسب من الخطوة 1.6.1 لمزيج 1:1 في حجم إجمالي 500 ميكرولتر. ملاحظة: يجب أن يستغرق 5 دقائق فقط لكل شرط لحساب والمبالغ aliquot.</li>
	<li>احتضان الأنابيب في درجة حرارة الغرفة في دوار أنبوب بطيء.</li>
</ol>2. الحصول على صورة
<ol><li>تحسين المعلمات المجهر للحصول على عينات محددة. في هذا المثال، تم التقاط الصور على مجهر واسع المجال. استخدام هدف الهواء 5x (NA: 0.15; WD: 20000 μm) للحصول على حقل كبير بما فيه الكفاية للتحليل.</li>
	<li>تقييم تجميع خط الأساس مباشرة بعد خلط الشرطين خلايا HEK في الخطوة 1.8. هذه هي الآن 'الوقت صفر' الصور.<ol>
<li>Pipette 40 ميكرولتر من كل خليط عينة على شريحة المجهر المشحونة والصورة تحت الفلورانس في كل من القنوات 488 و 561.</li>
		<li>الحصول على ثلاثة حقول مختلفة من الرؤية في مستوى التركيز واحد لكل قطرة العينة.</li>
	</ol>
</li>
	<li>الحصول على الصور النهائية في 60 دقيقة كما صورة 'الوقت 60'.<ol>
<li>للحصول على صورة 'الوقت 60' من الخليط بعد 60 دقيقة حضانة، واتخاذ آخر 40 ميكرولتر عينة من كل حالة من أنابيب الدورية والماصات كل عينة على شريحة مشحونة. صورة كما في الخطوة 2.2.2. ملاحظة: يجب التحقق من تجميع الخلايا كل 15 دقيقة حتى يحدث التشبع. وسيتوقف توقيت التجميع على البروتينات التي يجري اختبارها.</li>
	</ol>
</li>
</ol>3. تحليل ImageJ/فيجي
<ol><li>لتحديد مدى التجميع باستخدام فيجي/ImageJ، احفظ ملفات التحليل.<ol>
<li>حفظ ملفات ترميز إضافية المتوفرة في مجلد imageJ وحدات الماكرو على الكمبيوتر.</li>
		<li>تثبيت ماكرو التجميع المتوفرة (الإضافات، وحدات الماكرو، تثبيت، وحدد ملف "AggregationAssay.txt").</li>
	</ol>
</li>
	<li>تحديد العتبات.<ol>
<li>تحميل ملف "وقت الصفر" .tif إلى imageJ وتقسيم القنوات (صورة | | اللون انقسام القنوات). ملاحظة: يتم استخدام الصورة 'الوقت صفر' لتحديد العتبة وأصغر حجم بونكتا للتجربة بأكملها.</li>
		<li>قناع كل قناة(الإضافات | | وحدات الماكرو AggregationAssay_MakeMask). جعل قناع من صورة نافذة سوف تظهر. خانات الاختيار بجوار تحديد عتبة الصورة وتحديد الكتل Params من مدرج التكراري وانقر فوق موافق.</li>
		<li>حدد عتبة الصورة باستخدام شريط الشرائح، وسجل الرقم إلى يمين شريط الشرائح، وانقر فوق موافق.</li>
		<li>سيظهر مدرج بياني لحجم الكتلة. حدد حجم كتلة من الرسم البياني الذي يناسب التجربة، اكتب هذا الرقم في المربع الحد الأدنى من حجم الكتلة: ثم انقر فوق موافق. لن يتم تحليل الكتل التي دون هذا الحجم.</li>
	</ol>
</li>
	<li>قم بتشغيل التحليل.<ol>
<li>فتح صورة 'الوقت 60' من حالة 1 في imageJ وتقسيم القنوات كما هو الحال في الخطوة 3.2.1.</li>
		<li>قناع كل قناة (الإضافات ، وحدات الماكرو ، AggregationAssay_MakeMask). استخدام نفس عتبة والحجم المحدد في الخطوة 3.2.3 والخطوة 3.2.4. إلغاء تحديد المربعات بجوار تحديد عتبة الصورة وتحديد الكتل Params من الرسم البياني ثم يدوياً اكتب الحجم وعتبات في الحقول المناسبة ثم انقر فوق موافق.</li>
		<li>حساب مؤشر التجميع(الإضافات | | وحدات الماكرو AggregationAssay_CalculateOverlap). حدد القنوات المقنعة التي سيتم مقارنتها والدليل الذي سيتم حفظ الملفات الناتجة فيه.</li>
		<li>كرر الخطوات 3.3.1-3.3.3 لكل صورة 'الوقت 60' في كل حالة. ملاحظة: يُعرَّف مؤشر التجميع بأنه منطقة التداخل الإجمالي مقسوماً على مجموع منطقتين للقناتين مطروحاً منها منطقة التداخل مضروبة في 100 (مؤشر التجميع = منطقة التداخل/[مساحة القناة 1 + مساحة القناة 2 – منطقة التداخل] x 100). هذا التهيئة عملية 'OR' بين القناتين المقنعين تمثل إجمالي البيكسلات في أي قناع.</li>
	</ol>
</li>
</ol>

<ol>
	<li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neuroligins+and+neurexins+link+synaptic+function+to+cognitive+disease.">Neuroligins and neurexins link synaptic function to cognitive disease.</a> Nature. 455 (7215), 903-911 (2008).</li><li>Lakey, J. H., Raggett, E. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Measuring+protein-protein+interactions.">Measuring protein-protein interactions.</a> Current Opinion in Structural Biology. 8 (1), 119-123 (1998).</li><li>Aoto, J., Martinelli, D. C., Malenka, R. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Presynaptic+neurexin-3+alternative+splicing+trans-synaptically+controls+postsynaptic+AMPA+receptor+trafficking.">Presynaptic neurexin-3 alternative splicing trans-synaptically controls postsynaptic AMPA receptor trafficking.</a> Cell. 154 (1), 75-88 (2013).</li><li>Aoto, J., F&#246;ldy, C., Ilcus, S. M. C., Tabuchi, K., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Distinct+circuit-dependent+functions+of+presynaptic+neurexin-3+at+GABAergic+and+glutamatergic+synapses.">Distinct circuit-dependent functions of presynaptic neurexin-3 at GABAergic and glutamatergic synapses.</a> Nature Neuroscience. 18 (7), 997-1007 (2015).</li><li>S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+Neurexin+Complexes:+A+Molecular+Code+for+the+Logic+of+Neural+Circuits.">Synaptic Neurexin Complexes: A Molecular Code for the Logic of Neural Circuits.</a> Cell. 171 (4), 745-769 (2017).</li><li>Dai, J., Aoto, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+Splicing+of+Presynaptic+Neurexins+Differentially+Controls+Postsynaptic+NMDA+and+AMPA+Receptor+Responses.">Alternative Splicing of Presynaptic Neurexins Differentially Controls Postsynaptic NMDA and AMPA Receptor Responses.</a> Neuron. 102 (5), 993-1008 (2019).</li><li>Restrepo, S., Langer, N. J., Nelson, K. A., Aoto, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+a+Neurexin-3&#945;+Human+Mutation+in+Mouse+Neurons+Identifies+a+Novel+Role+in+the+Regulation+of+Transsynaptic+Signaling+and+Neurotransmitter+Release+at+Excitatory+Synapses.">Modeling a Neurexin-3&#945; Human Mutation in Mouse Neurons Identifies a Novel Role in the Regulation of Transsynaptic Signaling and Neurotransmitter Release at Excitatory Synapses.</a> The Journal of Neuroscience. 39 (46), 9065-9082 (2019).</li><li>Ko, J., Fuccillo, M. V., Malenka, R. C., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Functions+as+a+Neurexin+Ligand+in+Promoting+Excitatory+Synapse+Formation.">LRRTM2 Functions as a Neurexin Ligand in Promoting Excitatory Synapse Formation.</a> Neuron. 64 (6), 791-798 (2009).</li><li>de Wit, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTM2+Interacts+with+Neurexin1+and+Regulates+Excitatory+Synapse+Formation.">LRRTM2 Interacts with Neurexin1 and Regulates Excitatory Synapse Formation.</a> Neuron. 64 (6), 799-806 (2009).</li><li>Linhoff, M. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+Unbiased+Expression+Screen+for+Synaptogenic+Proteins+Identifies+the+LRRTM+Protein+Family+as+Synaptic+Organizers.">An Unbiased Expression Screen for Synaptogenic Proteins Identifies the LRRTM Protein Family as Synaptic Organizers.</a> Neuron. 61 (5), 734-749 (2009).</li><li>Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LRRTMs+and+Neuroligins+Bind+Neurexins+with+a+Differential+Code+to+Cooperate+in+Glutamate+Synapse+Development.">LRRTMs and Neuroligins Bind Neurexins with a Differential Code to Cooperate in Glutamate Synapse Development.</a> Journal of Neuroscience. 30 (22), 7495-7506 (2010).</li><li>Gibson, D. G., Young, L., Chuang, R. -. Y., Venter, J. C., Hutchison, C. A., Smith, H. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nature Methods. 6 (5), 343-345 (2009).</li><li>Bacchetti, S., Graham, F. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transfer+of+the+gene+for+thymidine+kinase+to+thymidine+kinase-deficient+human+cells+by+purified+herpes+simplex+viral+DNA.">Transfer of the gene for thymidine kinase to thymidine kinase-deficient human cells by purified herpes simplex viral DNA.</a> Proceedings of the National Academy of Sciences of the United States of America. 74 (4), 1590-1594 (1977).</li><li>Cerchiari, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+strategy+for+tissue+self-organization+that+is+robust+to+cellular+heterogeneity+and+plasticity.">A strategy for tissue self-organization that is robust to cellular heterogeneity and plasticity.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (7), 2287-2292 (2015).</li><li>Burdick, M. M., McCarty, O. J. T., Jadhav, S., Konstantopoulos, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+inflammation+and+cancer+metastasis.">Cell-cell interactions in inflammation and cancer metastasis.</a> IEEE Engineering in Medicine and Biology Magazine. 20 (3), 86-91 (2001).</li><li>Fox, D. A., Gizinski, A., Morgan, R., Lundy, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cell-cell+interactions+in+rheumatoid+arthritis+synovium.">Cell-cell interactions in rheumatoid arthritis synovium.</a> Rheumatic Diseases Clinics of North America. 36 (2), 311-323 (2010).</li><li>Yamagata, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+insights+into+modulation+and+selectivity+of+transsynaptic+neurexin-LRRTM+interaction.">Structural insights into modulation and selectivity of transsynaptic neurexin-LRRTM interaction.</a> Nature Communications. 9 (1), 3964 (2018).</li><li>Nguyen, T., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Binding+properties+of+neuroligin+1+and+neurexin+1beta+reveal+function+as+heterophilic+cell+adhesion+molecules.">Binding properties of neuroligin 1 and neurexin 1beta reveal function as heterophilic cell adhesion molecules.</a> The Journal of Biological Chemistry. 272 (41), 26032-26039 (1997).</li><li>Boucard, A. A., Ko, J., S&#252;dhof, T. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+Affinity+Neurexin+Binding+to+Cell+Adhesion+G-protein-coupled+Receptor+CIRL1/Latrophilin-1+Produces+an+Intercellular+Adhesion+Complex.">High Affinity Neurexin Binding to Cell Adhesion G-protein-coupled Receptor CIRL1/Latrophilin-1 Produces an Intercellular Adhesion Complex.</a> Journal of Biological Chemistry. 287 (12), 9399-9413 (2012).</li></ol>

ليس لدى أصحاب البلاغ ما يكشفون عنه.

تشريح البروتين البروتينية التفاعلات التي تحدث في عبر خلال التصاق الخلية يمكن أن يؤدي إلى فهم أفضل للآليات الجزيئية الكامنة في العمليات الخلوية الأساسية بما في ذلك تشكيل وظيفة وصيانة نقاط الاشتباك العصبي أثناء النضج وإعادة عرض. الآثار المترتبة على التفاعلات من خلية إلى خلية توسيع نطاقها وراء علم الأعصاب ولها أدوار أوسع نطاقا في نقل الإشارات، وهجرة الخلايا وتطوير الأنسجة14. يمكن الانحرافات في التصاق الخلية تعطيل العمليات الخلوية حتمية لوظيفة الخلية السليمة ويمكن الكامنة تحت مجموعة متنوعة من الإلتكولوجيا مثل السرطان والتهاب المفاصل والإدمان والتوحد والفصام1،15،16. هنا، نحن نقدم بروتوكول مفصل الأمثل التي تنطوي على تجميع الخلايا HEK التي تسمح لاختبار التفاعلات التصاق الخلية في trans. 
مع بروتوكول تجميع خلايا HEK هذا، يمكننا تشريح الاختلافات في التجميع إلى قدرة الربط التقريبية بين بروتين presynaptic و ligand ما بعد المينابك. على هذا النحو، يمكننا أن نطرح أسئلة مثل: هل التفاعل بين اثنين من البروتينات متشابك الأساسية تتأثر طفرة نقطة؟ وبشكل أكثر تحديداً، هل يتأثر التفاعل عبرية Neurexin3α مع LRRTM2 بـ A687T؟ إنّ طفرة الـ A687T missense التي تمت دراستها هنا تقع في منطقة رابط غير مدروسة سابقًا في المجال خارج الخلية من Neurexin3α7. وتوضح النتائج أن طفرة A687T تعزز تجميع الخلايا التي تحتوي على Neurexin3αA687T إلى خلايا تحتوي على LRRTM2(الشكل 2C). هذه النتيجة هامة لأنه كان قد تبين سابقا أن LRRTMs ربط فقط إلى Neurexins عبر نطاق Neurexin دعا LNS617، ويشير كذلك إلى أن تسلسل المنبع LNS6 يمكن أن تمارس تأثيرا مستقلا على التفاعلات عبر بين Neurexin3α SS4 - و LRRTM27.
النتائج في الشكل 2 تظهر خصوصية هذا الفحص كجميع الضوابط السلبية (GFP/mCherry; Neurexin3αWT/A687T SS4- -mCherry/GFP أو LRRTM-GFP/mCherry) لم يكن لديه تجميع ملحوظ بعد 60 دقيقة. وهناك سيطرة حرجة المستخدمة في هذه الدراسة, Neurexin3αWT/A687T SS4+ -mCherry/LRRTM-GFP, كما أظهرت أي تجميع بعد 60 دقيقة لأن من المعروف LRRTM2 لربط حصرا إلى SS4 تفتقر (SS4-) isoforms من Neurexin. هذا التحكم يوضح أن الإفراط في التعبير البسيط عن الجزيئات المقيدة بالغشاء غير كاف لفرض التجميع في هذا النظام، مما يوضح كذلك خصوصية هذا الفحص.
الخلية التصاق اختبار الموصوفة هنا وقد استخدمت على نطاق واسع لاختبار تفاعلات transsynaptic جزيئات الخلايا التصاق8,18,19; ومع ذلك، يمكن استخدامه لاختبار التفاعلات اللاصقة بين الخلايا والخلية من البروتينات المربوطة بالأغشية. وقد تم تحسين هذا البروتوكول، الذي تطور مع مرور الوقت، من البروتوكول الأصلي المنشور والاختلافات اللاحقة للبروتوكول عن طريق تغيير ثلاثة معلمات تجريبية. الأول، تم تغيير درجة حرارة الحضانة للخلايا. يدعو البروتوكول الأصلي لاحتضان الخلايا في الخطوة 1.9 عند 4 درجة مئوية. يمكن أن تكون درجة الحرارة المنخفضة بمثابة إجهاد بيئي ويمكن أن تقلل من صلاحية الخلية مما يؤدي إلى موت الخلايا وتحللها. أثناء تحلل الخلايا، تفرز الخلايا الحمض النووي الجينومي ومخلفات الخلايا في وسائل الإعلام التي تسبب الخلايا تكتل في حل مما يؤدي إلى إيجابيات كاذبة أثناء التصوير. ثانياً، زاد عدد الخلايا لكل حالة إلى 000 200 لكل نسمة، وتم تغيير الحجم الموضوعي إلى 5x؛ وهذا يسمح للباحث صورة أكبر لعدد من التفاعلات في مجال الرؤية من أجل زيادة القوة الإحصائية داخل كل ن. ثالثاً، تم قياس مؤشر التجميع بشكل مختلف. وكانت مؤشرات التجميع السابقة محدودة بسبب اختيار حجم الكتلة من قبل المُجرّب مما أدى إلى استبعاد مجموعات "subthreshold". على النقيض من عتبات الآن يتم تعيين حجم الخلية الفردية في 'الوقت صفر'، ويتم حساب التجميع الآن كمنطقة متداخلة مقسومة على مجموع المنطقتين قناة ناقص منطقة التداخل مضروبا في 100 في 'الوقت 60' الذي يسمح لإدراج مجموعات صغيرة إيجابية مما يجعل مقايسة أكثر حساسية للأزواج البروتين يغاند الأخرى(الشكل 2B، C).
قد تكون هناك حاجة إلى استكشاف الأخطاء وإصلاحها والتحسين اعتمادا على البروتينات التفاعل اختبارها. على الرغم من أن فترة الحضانة حتى الحصول النهائي على الصورة سوف تختلف اعتمادا على البروتينات المختبرة، فمن المهم أن لا يتم ملاحظة أي تجميع في "الوقت صفر". إذا كان التجميع ينظر في الوقت صفر، قد يعني أن الخلايا لم تكن صحية في البداية. قد يكون هذا بسبب عدة عوامل بما في ذلك التعرض المفاجئ لدرجات حرارة أقل من 37 درجة مئوية أو الإجراء التجريبي البطيء. الأهم من ذلك، يجب أن تكون وسائط إعادة النياسيبوسين للخطوة 1.7 عند 37 درجة مئوية، مما سيسمح للخلايا بالوصول تدريجيا إلى درجة حرارة الغرفة دون انخفاض مفاجئ في درجة الحرارة القاسية. إحدى الطرق للحصول على صحة الخلايا المثلى طوال التجربة هي التأكد من أن الخطوات من 1.7 إلى 1.9 يتم إكمالها في غضون 25 دقيقة إطار زمني مع عدم وجود فواصل بين. من المستحسن أن المجهر هو الإعداد وجاهزة للاستخدام قبل خلايا الحصاد الخلية في الخطوة 1.5; هذا يضمن أن يمكن التقاط صورة 'الوقت صفر' صحيح في الخطوة 2.2 مباشرة.
إذا لم يتم ملاحظة التجميع بعد 60 دقيقة من الحضانة، قد تكون هناك عدة عوامل تساهم في عدم الالتصاق هذا. أولاً، قد لا تكون البروتينات المعنية شريكة ملزمة أو قد تنخرط في تفاعلات تقارب منخفضة لا يمكن اكتشافها من خلال هذا الفحص. في هذه الحالة، قد يكون مطلوباً إجراء فحص أكثر حساسية.  ثانياً، البروتين (البروتينات) ذات الأهمية قد لا تُحلّل إلى الغشاء عندما يتم التعبير عنه وحده في خلايا HEK. في هذه الحالة، تأكد من أن البروتين هو غشاء موضعي باستخدام التقنيات الكيميائية الحيوية (بيوتينيليشن السطح) أو علامة مباشرة على البروتين من الفائدة مع علامة الفلورسنت وصورة خلايا HEK293T في 40x أو أعلى التكبير لتقييم التعبير السطحي. ومع ذلك، بعد تأكيد توطين الغشاء، نوصي باستخدام المتغيرات غير الموسومة لهذا الـ HEK تجميع الخلية من أجل تقييم أكثر دقة القدرة على الربط من البروتين الأصلي. ثالثاً، في هذا البروتوكول سمحنا لـ Neurexin3α بالتعبير عن 48 ساعة؛ ومع ذلك، قد يختلف وقت التعبير البروتيني حسب البروتينات التي تم اختبارها. رابعاً، من الأهمية بمكان أن تكمل الوسائط في الخطوة 1.7 مع MgCl2 و CaCl2 إذا كانت البروتينات المعنية تعتمد على الكاتيونات المكافلية كما هو الحال مع مثال Neurexins و LRRTM211. إذا كان من غير المعروف ما إذا كان الشركاء التفاعل تتطلب الكاتيونات divalent للالتصاق، إضافة EDTA في شرط واحد. وEDTA ينبغي أن يلخي التكبيل التكميم الالات موجودة بشكل طبيعي في DMEM ضمان حل خال من الكالسيوم والمغنيسيوم. إذا لوحظ التصاق بعد إضافة EDTA، والبروتينات في السؤال لا تتطلب الكاتيونات divalent للتصاق.
العديد من الأساليب موجودة لاختبار التفاعلات البروتين; ومع ذلك، معظم غير محددة لاختبار التفاعلات عبر فقط التي تحدث من خلية إلى خلية وتتطلب خطوات تنقية البروتين مملة. على الرغم من أن اختبار تجميع خلايا HEK ليس مقياسًا مباشرًا للتقارب ولا ينبغي استخدامه لاستبدال نهج أكثر كميًا لاسترداد ثوابت الانفصام ، على حد علمنا ، فإن هذا الاختبار يمثل نهجًا لاختبار التفاعلات العابرة الحقيقية بطريقة شبه كمية وفعالة نسبيًا. وعلاوة على ذلك، ونظرا للسهولة النسبية لهذه المقايسة، يمكن استخدام تحليل تجميع خلايا HEK بالاقتران مع هذه الأساليب الكمية للحصول على توصيف أوسع وأكثر اكتمالا للتفاعلات الجارية.

التفاعلات متشابك تسهيلها من قبل جزيئات التصاق متشابك هي الأساس لتطوير وتنظيم ومواصفات وصيانة وظيفة من نقاط الاشتباك العصبي وتوليد الشبكات العصبية. ويتزايد بسرعة تحديد جزيئات التصاق الخلايا المتحولة؛ وبالتالي، من المهم بشكل أساسي تحديد الشركاء الملزمين وفهم كيفية تفاعل جزيئات الالتصاق الجديدة هذه مع بعضها البعض. بالإضافة إلى ذلك، حددت تسلسل الجينوم الطفرات في العديد من هذه الجزيئات التصاق التي ترتبط عادة إلى العديد من الاضطرابات العصبية النمائية، العصبية والنفسية،والإدمان 1. الطفرات في الجينات التي رمز لجزيئات التصاق الخلايا متشابك قد تغير بشكل ضار التفاعلات عبر وقد تسهم في التعديلات فيزيائية المرضية في تشكيل المشبك أو الصيانة.
توجد مقايسات متعددة لتقييم كمي تفاعلات البروتين والبروتين مثل قياس السعرات الحرارية isothermal، dichroism دائري، الرنين البلازمونالسطحي 2 وعلى الرغم من الكمية في الطبيعة، لديهم عدة قيود. أولاً، تتطلب بروتيناً مؤتلفاً، وتطالب أحياناً بخطوات تنقية طويلة ومملة. ثانيا، تتطلب هذه الكفاءات معدات متخصصة متطورة وخبرة فنية. ثالثاً، يمكن أن تبالغ في تقدير مدى الربط لأنها تسمح لكل من رابطة الدول المستقلة والتفاعلات العابرة بين البروتينات المربوطة بشكل طبيعي إلى غشاء في الجسم الحي. هنا نقترح اختبار بسيط وسريع نسبيا أن الاختبارات حصرا التفاعلات عبر.
للتحايل على العديد من المضاعفات المرتبطة بمقايس البروتين النقي، قمنا بتحسين تحليل تفاعل البروتين القائم على الخلايا الذي يلخص التفاعلات عبر في نظام الخلايا غير المغايرة. وقد سبق استخدام هذا الفحص في أشكال مختلفة لدراسة التفاعلات عبر الخلايا. في هذا النهج، يتم نقل جزيئات التصاق الخلية المرشحة إلى خلايا HEK293T. في الظروف الفسيولوجية، خلايا HEK293T لا تظهر التجميع الذاتي، مما يجعلها نماذج مثالية لهذا الفحص. ومع ذلك، عندما يتم الجمع بين مجموعات من الأفراد من خلايا HEK التعبير عن مستقبلات ويغاند، فإن ربط المستقبلات وقواد ليغاند تجميع خلايا HEK أن يحدث. ويتم هذا التجميع حصرياً عن طريق التفاعلات عبر، وعادة ما يكون قابلاً للملاحظة في عشرات الدقائق. لا يلزم اتخاذ خطوات لتنقية البروتين في هذه الطريقة، وتعتمد كفاءة الطريقة على النموذج الذي يتم فيه دمج مجموعات خلايا HEK التي تعبر عن جزيئات التصاقها، ثم يتم تصويرها بعد عشرات الدقائق فقط. بالإضافة إلى ذلك، هذه الطريقة غير مكلفة نسبيا، حيث لا الأجسام المضادة ولا معدات مكلفة مطلوبة. المعدات الوحيدة المطلوبة للحصول على البيانات هي مجهر فلوري قياسي. ميزة إضافية لهذا المقايسة القائمة على الخلية هي القدرة على فحص بسرعة تأثير الطفرات نقطة ذات الصلة المرض على التفاعلات عبر. ويمكن إجراء ذلك عن طريق نقل خلايا HEK مع cDNAs من المتغيرات المتحولة من البروتين من الفائدة.
في هذا البروتوكول، نقدم مثالاً نتحقق فيه مما إذا كانت طفرة الميزنس في Neurexin3α (Neurexin3αA687T)،التي تم تحديدها في مريض تم تشخيصه بإعاقة ذهنية عميقة والصرع، يغير التفاعلات في ترانس مع بروتين تكرار الغشاء اللين الغني باليوسين 2 (LRRTM2). Neurexin3α هو عضو في الأسرة المحفوظة تطوريا من الجزيئات presynaptic الخلية التصاق وبينما عمل مؤخرا قد حددت أدوار متعددة في المشبك3,4,5,6,7, فهمنا متشابك من هذا الجزيء وجميع أعضاء الأسرة neurexin لا تزال غير مكتملة. LRRTM2 هو عبارة عن بروتين التصاق الخلايا بعد التصاقات ما بعد التصاقات التي تشارك في تشكيل المشبك العصبي والصيانة8,9,10. الأهم من ذلك، LRRTM2 يتفاعل حصرا مع isoforms neurexin التي تفتقر إلى موقع لصق 4 exon البديل (SS4-) ولكن ليس مع isoforms neurexin التي تحتوي على موقع لصق 4 البديلة exon (SS4 +). يقع الطفرة البشرية (A687T) التي تم تحديدها في Neurexin3α في منطقة خارج الخلية غير مدروسة يتم حفظها تطورياً ويتم الحفاظ عليها بين جميع نويات ألفا7. كما تم تأسيس التفاعل بين هذين الجزيئات8,9,11, طرحنا السؤال: هل القدرة على الربط من Neurexin3α SS4- إلى LRRTM2 غيرت بواسطة A687T نقطة طفرة؟ وكشفت هذه الأقوال أن طفرة نقطة A687T عززت بشكل غير متوقع تجميع Neurexin3α إلى LRRTM2 مما يشير إلى أن المنطقة خارج الخلية التي تقع فيها الطفرة النقطة، تلعب دورا في التوسط التفاعلات عبرسينابتيك.

<table border="0" cellpadding="0" cellspacing="0" style="width:788px;" width="787">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="60">
			<td height="60" style="height:60px;width:339px;">1.5 mL disposable microtubes with snap caps</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">89000-028</td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">1000 mL Rapid&#8212;Flow Filter Unit, 0.2 um aPES membrane</td>
			<td style="width:121px;">Thermo Fisher</td>
			<td style="width:161px;">567-0020</td>
			<td style="width:167px;">Sterilization of HEK media</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">15 mL SpectraTube centrifuge tubes</td>
			<td style="width:121px;">Ward&#8217;s Science</td>
			<td style="width:161px;">470224-998</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">6 well sterile tissue culture plates</td>
			<td style="width:121px;">VWR</td>
			<td style="width:161px;">100062-892</td>
			<td style="width:167px;">culturing HEK cells</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">Calcium Chloride</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">223506-500G</td>
			<td style="width:167px;">Calcium phosphate transfection, HEK cell resuspension</td>
		</tr>
		<tr height="44">
			<td height="44" style="height:45px;width:339px;">Centrifuge- Sorvall Legend RT</td>
			<td style="width:121px;">Kendro Laboratory Products</td>
			<td align="right" style="width:161px;">75004377</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:22px;width:339px;">CO2 cell incubator</td>
			<td style="width:121px;">Thermo Scientific</td>
			<td style="width:161px;">HERACELL 150i</td>
			<td style="width:167px;">Incubation of HEK cells during growth</td>
		</tr>
		<tr height="64">
			<td height="64" style="height:64px;width:339px;">DMEM, 1x (Dulbecco&#39;s Modification of Eagle&#39;s Medium) with 4.5 g/L glucose, L-glutamine &#38; sodium pyruvate</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">10-013-CV</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Dulbecco&#8217;s Phosphate Buffered Saline PBS (1X)</td>
			<td style="width:121px;">Gibco</td>
			<td style="width:161px;">14190-144</td>
			<td style="width:167px;">Passaging/harvesting HEK cell</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Ethylenediaminetetraacetic acid</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">ED-500G</td>
			<td style="width:167px;">Harvesting HEK cells</td>
		</tr>
		<tr height="25">
			<td height="25" style="height:25px;width:339px;">Falcon Vented culture flasks, 75cm2 growth area</td>
			<td style="width:121px;">Corning</td>
			<td style="width:161px;">9381M26</td>
			<td style="width:167px;">Culturing HEK cells</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Fetal Bovine Serum</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">17L184</td>
			<td style="width:167px;">HEK cell maintenance</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">HEK293T cells</td>
			<td style="width:121px;">ATCC</td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Model system</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">ImageJ</td>
			<td style="width:121px;">NIH</td>
			<td style="width:161px;">V: 2.0.0-rc-69/1.52p</td>
			<td style="width:167px;">Image analysis</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:43px;width:339px;">Magnesium Chloride hexahydrate</td>
			<td style="width:121px;">Sigma</td>
			<td style="width:161px;">M9272-500G</td>
			<td style="width:167px;">HEK cell resuspension</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Sodium phosphate dibasic anhydrous</td>
			<td style="width:121px;">Fisher BioReagents</td>
			<td style="width:161px;">BP332-500</td>
			<td style="width:167px;">Calcium phosphate transfection</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Trypsin 0.25% (1X) Solution</td>
			<td style="width:121px;">GE Healthcare Life Sciences</td>
			<td style="width:161px;">SH30042.01</td>
			<td style="width:167px;">Passaging HEK cells</td>
		</tr>
		<tr height="43">
			<td height="43" style="height:43px;width:339px;">Tube rotator</td>
			<td style="width:121px;"></td>
			<td style="width:161px;"></td>
			<td style="width:167px;">Incubation of mixed population of HEK cells</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:339px;">UltraClear Microscope slides. White Frosted, Positive Charged</td>
			<td style="width:121px;">Denville Scientific Inc.</td>
			<td style="width:161px;">M1021</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
		<tr height="22">
			<td height="22" style="height:22px;width:339px;">Wide-field microscope</td>
			<td style="width:121px;">Zeiss</td>
			<td style="width:161px;">Axio Vert 200M</td>
			<td style="width:167px;">Image acquisition</td>
		</tr>
	</tbody>
</table>

measuring transcellular interactions through protein aggregation in a heterologous cell system

التفاعلات البروتينية في الواجهات الخلوية تملي العديد من النتائج البيولوجية التي تتراوح بين تطوير الأنسجة وتطور السرطان إلى تشكيل المشبك العصبي والصيانة. العديد من هذه التفاعلات الأساسية تحدث في مغايرة وعادة ما يتم الناجمة عن التفاعلات غير المتغايرة أو المثلية بين الخلايا التي تعبر عن أزواج الربط الراسية الغشاء. توضيح كيف الطفرات المرض ذات الصلة تعطيل هذه التفاعلات البروتين الأساسية يمكن أن توفر نظرة ثاقبة في عدد لا يحصى من حقول بيولوجيا الخلايا. العديد من البروتين البروتين التفاعل المقايسة لا عادة توضيح بين رابطة الدول المستقلة والتفاعلات عبر, مما قد يؤدي إلى المبالغة في تقدير مدى الربط الذي يحدث في الجسم الحي وينطوي على تنقية كثيفة العمالة من البروتين و / أو معدات الرصد المتخصصة. هنا، نقدم بروتوكول بسيط الأمثل الذي يسمح لمراقبة وكمية التفاعلات عبر فقط دون الحاجة إلى تنقية البروتين طويلة أو المعدات المتخصصة. يتضمن فحص تجميع خلايا HEK خلط مجموعتين مستقلتين من خلايا HEK، يعبر كل منهما عن أربطة مزدوجة مُلزمة بالغشاء. بعد فترة حضانة قصيرة، يتم تصوير العينات ويتم تحديد المجاميع الناتجة.

طفرة A687T يزيد Neurexin3α SS4- ملزمة LRRTM27 للتحقيق في كيفية تأثر التفاعلات بين الخلايا من اثنين من البروتينات متشابك المعروفة من خلال إدخال طفرة نقطة وجدت في المريض مع الإعاقة الفكرية والصرع، استخدمنا أعلاه هيك خلية تجميع المقايسة(الشكل 1). وقد تم نقل الخلايا وفقا للقسم 1 وأعدت للتصوير وفقا للقسمين 1 و 2 من البروتوكول. تم تصوير الخلايا عند خط الأساس حيث لم يتم ملاحظة أي تجميع كما هو متوقع (غير مبين). وتم تحليل الصور التي تم الحصول عليها في 60 دقيقة كما هو الحال في القسم 3 من البروتوكول. لتقليل التحيز في الاختيار ، تم وضع الشروط بشكل عشوائي لعمية المجرب. لأسباب مماثلة تم اختيار حقل كامل من عرض كل صورة في عائد الاستثمار.
وأظهرت الظروف التي لم تكن الخلايا التعبير عن أي رابطة متشابك (GFP / mCherry) الحد الأدنى من التجميع بعد حضانة لمدة 60 دقيقة(الشكل 2). وبالمثل، فإن الظروف التي كان فيها واحد فقط من مجموعتي الخلايا يعبر عن أربطة متشابك (mCherry/LRRTM2-GFP أو GFP/Neurexin3αWT/A687T SS4- mCherry) أظهرت الحد الأدنى من التجميع بعد حضانة 60 دقيقة(الشكل 2). وكما هو متوقع، فإن الظروف التي تحتوي على مجموعتين من الخلايا ذات جزيئات التصاقات غير متوافقة (Neurexin3αWT/A687T SS4+-mCherry/LRRTM2-GFP) لم تظهر أي تجميع في 60 دقيقة(الشكل 2B). هذه الظروف بمثابة الضوابط السلبية الحرجة كما هو معروف LRRTM2 لربط حصرا إلى SS4 تفتقر إلى isoforms (SS4-) من Neurexins ويسلط الضوء على خصوصية هذا التجميع المقايسة.
الظروف مع جزيئات التصاق متوافقة8,9,10 (Neurexin3αWT SS4- - mCherry/LRRTM2-GFP) أظهرت تجميع كبير بعد 60 دقيقة حضانة(الشكل 2C). يمكن تصور التجميع باللون الأصفر وهو موجود في التداخل بين الخلايا (الشكل 1 والشكل 2). والمثير للدهشة, الحالة حيث Neurexin3α A687T SS4- شارك في احتضان مع LRRTM2 (Neurexin3αA687T SS4- mCherry/LRRTM2-GFP) أظهرت بشكل ملحوظ أكثر تجميعا بالمقارنة مع نظيره wildtype (Neurexin3αWT SS4- mCherry/LRRTM2-GFP; التحكم الإيجابي). وهذا يشير إلى أن طفرة نقطة A687T في Neurexin3α تعزز قدرات الربط من Neurexin3α SS4- إلى LRRTM2.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/61237/61237fig1.jpg"> الشكل 1- الـ 1 سير عمل فحص التجميع. (أ)خلايا HEK293T هي المصابة باستخدام البروتين-1/mCherry، أو بروتين-2/GFP. (B) تعبير Neurexin3α يأخذ 48 ح . (C) يتم حصاد الخلايا باستخدام 10 mM EDTA ثم بيليه (D). (E) تختلط الخلايا في نسبة 1:1 و resuspended في 500 ميكرولتر من وسائط HEK التي تحتوي على 10 mM CaCl2 و MgCl2. ( F)يتم احتضان الخلايا في درجة حرارة الغرفة حتى يحدث التجميع ويتم الحصول على صورة نهائية في "الوقت 60". يتم تصور التجميع كرقم من الـ puncta أصفر مرئي في مجال الرؤية. لا يوجد تجميع يلاحظ عندما الخلايا لا تعبر عن أزواج يغاند المستقبلات الصحيحة وبالتالي ينظر إليها على أنها بانكتا حمراء أو خضراء فردية. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/61237fig1large.jpg" target="_blank">الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/61237/61237fig2.jpg"> الشكل 2- الانبعاثات 2 من 100 Neurexin3αA687T SS4- وقد عززت تجميع مع الليغانية excitatory LRRTM2 مقارنة Neurexin3αWT SS4-. (أ)صور تمثيلية للضوابط السلبية بعد 60 دقيقة من حضانة mCherry مع GFP، mCherry مع LRRTM2، GFP مع Neurexin3αWT SS4+/-، وGFP مع Neurexin3αA687T SS4+/-. وقد لوحظ التجميع بعد 60 دقيقة في كل من LRRTM2 مع Neurexin3αWT SS4-، وLRRTM2 مع Neurexin3αA687T SS4-. (ب) القياس الكمي لمؤشر التجميع في جميع حالات SS4+ بعد 60 دقيقة. مؤشر التجميع = منطقة التداخل/(مساحة القناة 1 + مساحة القناة 2 - منطقة التداخل) x 100. (C) نفس (B) ولكن SS4-. البيانات المعروضة تمثل متوسط ± SEM لعدد التجارب (SEM: GFP/mCherry ± 0.0245، mCherry/LRRTM2 ± 0.02465، GFP/Neurexin3αWT SS4- ± 0.02453، GFP/Neurexin3αA687T SS4- ± 0.0109, Neurexin3αWT SS4-/LRRTM2 ± 0.0538, Neurexin3αA687T SS4-/LRRTM2 ± 0.0174; p= 0.0136). الأرقام المعروضة في الحانات تمثل عدد التجارب المستقلة التي أجريت. تمثل الخطوط المنقطة أساس أو متوسط الحد الأدنى لتجميع شروط التحكم. تم تحديد الأهمية الإحصائية من قبل ANOVA في اتجاه واحد، مقارنات متعددة; *ف<0.05; p<0.0001.تم تعديل هذا الرقم من ريستريبو وآخرون7. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/61237fig2large.jpg" target="_blank">الرجاء النقر هنا لعرض نسخة أكبر من هذا الرقم.</a>
ملفات ترميز تكميلية. <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/61237/Supplemental_Coding_Files.zip" target="_blank">الرجاء النقر هنا لتحميل هذه الملفات.</a>

Watch this Scientific Journal Video about Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System at JoVE.com

Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

هنا، نقدم بروتوكول الأمثل لقياس بسرعة وشبه متزامنة التفاعلات مستقبلات رابطة في trans في نظام خلية غير متغايرة باستخدام المجهر الفلورية.

قياس التفاعلات عبر الخلية من خلال تجميع البروتين في نظام الخلايا heterologous

Protein interactions at cellular interfaces dictate a multitude of biological outcomes ranging from tissue development and cancer progression to synapse ...

measuring-transcellular-interactions-through-protein-aggregation

Nanyang Technological University

Research

JoVE Journal

Neuroscience

3.4K Views.  University of Colorado Denver School of Medicine. هنا، نقدم بروتوكول الأمثل لقياس بسرعة وشبه متزامنة التفاعلات مستقبلات رابطة في trans في نظام خلية غير متغايرة باستخدام المجهر الفلورية.

Video: Measuring Transcellular Interactions through Protein Aggregation in a Heterologous Cell System

Assaying Surface Expression of Chemosensory Receptors in Heterologous Cells

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors (GPCRs) 1 that are postulated to bind volatile odorant molecules and converting the extracellular signal into an intracellular signal by coupling with G protein G&alpha;olf. Binding of the odorants to the receptors is thought to follow a combinatorial rule, that is, one odorant may bind several receptors and one receptor may bind several odorants to varying degrees 2. Biochemical, signaling and ligand binding studies have been conveniently carried out for most GPCRs using heterologous cells. However use of heterologous cells for study of odorant receptors, was precluded for a long time since on transfection they failed to export to the surface. Saito et al have demonstrated single membrane pass Receptor Transporting Protein (RTP) family chaperones show enhanced expression in the olfactory sensory neurons and act as chaperones to traffic odorant receptors to the surface in heterologous cells, when co transfected together 3. To carry out biochemical assays for receptors using heterologous cells, one must first determine if the receptor shows robust surface expression in the cell line. This can be assayed by overexpressing the receptors with the chaperone RTP1S followed by live cell staining to fluorescently label the extracellular domain or a tag in the extracellular domain exclusively. Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

Here we demonstrate a protocol to carry out live cell staining that can be used to detect odorant receptors on the surface of HEK293T cells conveniently. In addition, it may also be used to assay for surface expression of other chemosensory receptors or GPCRs.

معايرة تعبير حسي كيميائي السطحية من المستقبلات في خلايا غيروي

The vivid world of odors is recognized by the sense of olfaction. Olfaction in mice is mediated by a repertoire of about 1200 G Protein Coupled Receptors ...

Efficient Derivation of Human Neuronal Progenitors and Neurons from Pluripotent Human Embryonic Stem Cells with Small Molecule Induction

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system (CNS) structure and circuitry in today's healthcare industry. Cell-based therapies hold great promise to restore the lost nerve tissue and function for CNS disorders. However, cell therapies based on CNS-derived neural stem cells have encountered supply restriction and difficulty to use in the clinical setting due to their limited expansion ability in culture and failing plasticity after extensive passaging1-3. Despite some beneficial outcomes, the CNS-derived human neural stem cells (hNSCs) appear to exert their therapeutic effects primarily by their non-neuronal progenies through producing trophic and neuroprotective molecules to rescue the endogenous cells1-3. Alternatively, pluripotent human embryonic stem cells (hESCs) proffer cures for a wide range of neurological disorders by supplying the diversity of human neuronal cell types in the developing CNS for regeneration1,4-7. However, how to channel the wide differentiation potential of pluripotent hESCs efficiently and predictably to a desired phenotype has been a major challenge for both developmental study and clinical translation. Conventional approaches rely on multi-lineage inclination of pluripotent cells through spontaneous germ layer differentiation, resulting in inefficient and uncontrollable lineage-commitment that is often followed by phenotypic heterogeneity and instability, hence, a high risk of tumorigenicity7-10. In addition, undefined foreign/animal biological supplements and/or feeders that have typically been used for the isolation, expansion, and differentiation of hESCs may make direct use of such cell-specialized grafts in patients problematic11-13. To overcome these obstacles, we have resolved the elements of a defined culture system necessary and sufficient for sustaining the epiblast pluripotence of hESCs, serving as a platform for de novo derivation of clinically-suitable hESCs and effectively directing such hESCs uniformly towards clinically-relevant lineages by small molecules14 (please see a schematic in Fig. 1). Retinoic acid (RA) does not induce neuronal differentiation of undifferentiated hESCs maintained on feeders1, 14. And unlike mouse ESCs, treating hESC-differentiated embryoid bodies (EBs) only slightly increases the low yield of neurons1, 14, 15. However, after screening a variety of small molecules and growth factors, we found that such defined conditions rendered retinoic acid (RA) sufficient to induce the specification of neuroectoderm direct from pluripotent hESCs that further progressed to neuroblasts that generated human neuronal progenitors and neurons in the developing CNS with high efficiency (Fig. 2). We defined conditions for induction of neuroblasts direct from pluripotent hESCs without an intervening multi-lineage embryoid body stage, enabling well-controlled efficient derivation of a large supply of human neuronal cells across the spectrum of developmental stages for cell-based therapeutics.

We have established a protocol for induction of neuroblasts direct from pluripotent human embryonic stem cells maintained under defined conditions with small molecules, which enables derivation of a large supply of human neuronal progenitors and neuronal cell types in the developing CNS for neural repair.

كفاءة اشتقاق أسلاف الإنسان متعلق بالخلايا العصبية والخلايا العصبية من افرة القوة الخلايا الجذعية الجنينية البشرية التعريفي مع جزيء صغير

There is a large unfulfilled need for a clinically-suitable human neuronal cell source for repair or regeneration of the damaged central nervous system ...

Peering into the Dynamics of Social Interactions: Measuring Play Fighting in Rats

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. The frequency of play fighting can be measured by counting the number of playful nape attacks occurring per unit time. However, playful defense, as it can only occur in response to attack, is necessarily a contingent measure that is best measured as a percentage (#attacks defended/total # attacks X 100%). How a particular attack is defended against can involve one of several tactics, and these are contingent on defense having taken place; consequently, the type of defense is also best expressed contingently as a percentage. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements of one animal are countered by the actions of its partner, play fighting is a complex, dynamic interaction. This dynamic complexity raises methodological problems about what to score for experimental studies. We present a scoring schema that is sensitive to the correlated nature of the actions performed. Two experiments illustrate how these measurements can be used to detect the effect of brain damage on play fighting even when there is no effect on overall playfulness. That is, the schema presented here is designed to detect and evaluate changes in the content of play following an experimental treatment.

التناظر في ديناميات التفاعلات الاجتماعية: العب قياس القتال في الفئران

Play fighting in the rat involves attack and defense of the nape of the neck, which if contacted, is gently nuzzled with the snout. Because the movements ...

Dual Electrophysiological Recordings of Synaptically-evoked Astroglial and Neuronal Responses in Acute Hippocampal Slices

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs through activation of their ion channels and neurotransmitter receptors, and process information in part through activity-dependent release of gliotransmitters. Furthermore, astrocytes constitute the main uptake system for glutamate, contribute to potassium spatial buffering, as well as to GABA clearance. These cells therefore constantly monitor synaptic activity, and are thereby sensitive indicators for alterations in synaptically-released glutamate, GABA and extracellular potassium levels. Additionally, alterations in astroglial uptake activity or buffering capacity can have severe effects on neuronal functions, and might be overlooked when characterizing physiopathological situations or knockout mice. Dual recording of neuronal and astroglial activities is therefore an important method to study alterations in synaptic strength associated to concomitant changes in astroglial uptake and buffering capacities. Here we describe how to prepare hippocampal slices, how to identify stratum radiatum astrocytes, and how to record simultaneously neuronal and astroglial electrophysiological responses. Furthermore, we describe how to isolate pharmacologically the synaptically-evoked astroglial currents.

The preparation of acute brain slices from isolated hippocampi, as well as the simultaneous electrophysiological recordings of astrocytes and neurons in stratum radiatum during stimulation of schaffer collaterals is described. The pharmacological isolation of astroglial potassium and glutamate transporter currents is demonstrated.

تسجيلات الكهربية المزدوجة للSynaptically-استجابات Astroglial والخلايا العصبية في الحصين شرائح الحاد

Astrocytes form together with neurons tripartite synapses, where they integrate and modulate neuronal activity. Indeed, astrocytes sense neuronal inputs ...

A Lightweight, Headphones-based System for Manipulating Auditory Feedback in Songbirds

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and sensorimotor plasticity1. Consistent sensory perturbations result in compensatory changes in motor output, reflecting changes in feedforward motor control that reduce the experienced feedback error. By quantifying how different sensory feedback errors affect human behavior, prior studies have explored how visual signals are used to recalibrate arm movements2,3 and auditory feedback is used to modify speech production4-7. The strength of this approach rests on the ability to mimic naturalistic errors in behavior, allowing the experimenter to observe how experienced errors in production are used to recalibrate motor output.
Songbirds provide an excellent animal model for investigating the neural basis of sensorimotor control and plasticity8,9. The songbird brain provides a well-defined circuit in which the areas necessary for song learning are spatially separated from those required for song production, and neural recording and lesion studies have made significant advances in understanding how different brain areas contribute to vocal behavior9-12. However, the lack of a naturalistic error-correction paradigm - in which a known acoustic parameter is perturbed by the experimenter and then corrected by the songbird - has made it difficult to understand the computations underlying vocal learning or how different elements of the neural circuit contribute to the correction of vocal errors13.
The technique described here gives the experimenter precise control over auditory feedback errors in singing birds, allowing the introduction of arbitrary sensory errors that can be used to drive vocal learning. Online sound-processing equipment is used to introduce a known perturbation to the acoustics of song, and a miniaturized headphones apparatus is used to replace a songbird's natural auditory feedback with the perturbed signal in real time. We have used this paradigm to perturb the fundamental frequency (pitch) of auditory feedback in adult songbirds, providing the first demonstration that adult birds maintain vocal performance using error correction14. The present protocol can be used to implement a wide range of sensory feedback perturbations (including but not limited to pitch shifts) to investigate the computational and neurophysiological basis of vocal learning.

We describe the design and assembly of miniaturized headphones suitable for replacing a songbird&#x2019;s natural auditory feedback with a manipulated acoustic signal. Online sound processing hardware is used to manipulate song output, introduce real-time errors in auditory feedback via the headphones, and drive vocal motor learning.

خفيفة الوزن، القائم على نظام سماعات لمعالجة ملاحظات السمعية في العصافير

Experimental manipulations of sensory feedback during complex behavior have provided valuable insights into the computations underlying motor control and ...

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Genetic modification of specific regions of the developing mammalian brain is a very powerful experimental approach. However, generating novel mouse mutants is often frustratingly slow. It has been shown that access to the mouse brain developing in utero with reasonable post-operatory survival is possible. Still, results with this procedure have been reported almost exclusively for the most superficial and easily accessible part of the developing brain, i.e. the cortex. The thalamus, a narrower and more medial region, has proven more difficult to target. Transfection into deeper nuclei, especially those of the hypothalamus, is perhaps the most challenging and therefore very few results have been reported. Here we demonstrate a procedure to target the entire hypothalamic neuroepithelium or part of it (hypothalamic regions) for transfection through electroporation. The keys to our approach are longer narcosis times, injection in the third ventricle, and appropriate kind and positioning of the electrodes. Additionally, we show results of targeting and subsequent histological analysis of the most recessed hypothalamic nucleus, the mammillary body.

Genetic Manipulation of the Mouse Developing Hypothalamus through In utero Electroporation

Despite the functional and medical importance of the hypothalamus, in utero genetic manipulation of its development has rarely been attempted. We show a detailed procedure for in utero electroporation into the mouse hypothalamus and show representative results of total and partial (regional) hypothalamic transfection.

التلاعب الجيني من الفأرة النامية من خلال المهاد<em&gt; في الرحم</em&gt; Electroporation

Genetic  modification of specific regions of the developing mammalian brain is a very  powerful experimental approach. However, generating novel mouse ...

A Caenorhabditis elegans Model System for Amylopathy Study

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of Alzheimer's disease (AD) and is found in Lewy body dementia, inclusion body myositis and cerebral amyloid angiopathy 1-4. Amylopathies progressively develop with time. For this reason simple organisms with short lifespans may help to elucidate molecular aspects of these conditions. Here, we describe experimental protocols to study A&beta;-mediated neurodegeneration using the worm Caenorhabditis elegans. Thus, we construct transgenic worms by injecting DNA encoding human A&beta;42 into the syncytial gonads of adult hermaphrodites. Transformant lines are stabilized by a mutagenesis-induced integration. Nematodes are age synchronized by collecting and seeding their eggs. The function of neurons expressing A&beta;42 is tested in opportune behavioral assays (chemotaxis assays). Primary neuronal cultures obtained from embryos are used to complement behavioral data and to test the neuroprotective effects of anti-apoptotic compounds.

A Caenorhabditis elegans Model System for Amylopathy Study

We describe methods to study aspects of amylopathies in the worm C. elegans. We show how to construct worms expressing human A&beta;42 in neurons and how to test their function in behavioral assays. We further show how to obtain primary neuronal cultures that can be used for pharmacological testing.

A<em&gt; انواع معينة ايليجانس</em&gt; النظام النموذجي للدراسات Amylopathy

Amylopathy is a term that describes abnormal synthesis and accumulation of amyloid beta (A&beta;) in tissues with time. A&beta; is a hallmark of ...

Use of a Caspase Multiplexing Assay to Determine Apoptosis in a Hypothalamic Cell Model

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and decreases waste in costs and reagents. Here we describe optimization of a multiplex assay to assess apoptosis following a palmitic acid (PA) challenge in an in vitro hypothalamic model, using both fluorescent and luminescent based assays to measure viable cell counts and caspase-3/7 activity in a 96-well microtiter plate format. Following PA challenge, viable cells were determined by a resazurin-based fluorescent assay. Caspase-3/7 activity was then determined using a luminogenic substrate, DEVD, and normalized to cell number. This multiplexing assay is a useful technique for determining change in caspase activity following an apoptotic stimulus, such as saturated fatty acid challenge. The saturated fatty acid PA can increase hypothalamic oxidative stress and apoptosis, indicating the potential importance of assays such as that described here in studying the relationship between saturated fatty acids and neuronal function.

Multiplex assays can provide beneficial information for basic cellular mechanisms&#160;and eliminate waste of reagents and unnecessary repetitive experiments. We describe here a multiplex caspase-3/7 activity assay, using fluorescent- and luminescent-based methods, to determine cell viability in an in vitro hypothalamic model following oxidative challenge with palmitic acid.

استخدام كاسباس المتعدد الفحص لتحديد موت الخلايا المبرمج في المهاد الخليوي نموذج

The ability to multiplex assays in studies of complex cellular mechanisms eliminates the need for repetitive experiments, provides internal controls, and ...

Inducing Plasticity of Astrocytic Receptors by Manipulation of Neuronal Firing Rates

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be stimulated by neuronally-released transmitter. However, the ability of astrocytic receptors to exhibit plasticity in response to changes in neuronal activity has received little attention. Here we describe a model system that can be used to globally scale up or down astrocytic group I metabotropic glutamate receptors (mGluRs) in acute brain slices. Included are methods on how to prepare parasagittal hippocampal slices, construct chambers suitable for long-term slice incubation, bidirectionally manipulate neuronal action potential frequency, load astrocytes and astrocyte processes with fluorescent Ca2+ indicator, and measure changes in astrocytic Gq GPCR activity by recording spontaneous and evoked astrocyte Ca2+ events using confocal microscopy. In essence, a &#8220;calcium roadmap&#8221; is provided for how to measure plasticity of astrocytic Gq GPCRs. Applications of the technique for study of astrocytes are discussed. Having an understanding of how astrocytic receptor signaling is affected by changes in neuronal activity has important implications for both normal synaptic function as well as processes underlying neurological disorders and neurodegenerative disease.

Here we describe an adaptation of protocols used to induce homeostatic plasticity in neurons for the study of plasticity of astrocytic G protein-coupled receptors. Recently used to examine changes in astrocytic group I mGluRs in juvenile mice, the method can be applied to measure scaling of various astrocytic GPCRs, in tissue from adult mice in situ and in vivo, and to gain a better appreciation of the sensitivity of astrocytic receptors to changes in neuronal activity.

حمل اللدونة من نجمي المستقبلات بواسطة التلاعب أسعار اطلاق النار متعلق بالخلايا العصبية

Close to two decades of research has established that astrocytes in situ and in vivo express numerous G protein-coupled receptors (GPCRs) that can be ...

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal dysfunction and loss. Fluorescence-based imaging tools and technologies enable unprecedented analysis of subcellular neurobiological processes, yet there is still a need for unbiased, reproducible, and accessible approaches for extracting quantifiable data from imaging studies. We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-based imaging studies using Drosophila models of neurodegeneration. Specifically, we describe an easy-to-follow, semi-automated approach using Fiji/ImageJ to analyze two cellular processes: first, we quantify protein aggregate content and profile in the Drosophila optic lobe using fluorescent-tagged mutant huntingtin proteins; and second, we assess autophagy-lysosome flux in the Drosophila visual system with ratiometric-based quantification of a tandem fluorescent reporter of autophagy. Importantly, the protocol outlined here includes a semi-automated segmentation step to ensure all fluorescent structures are analyzed to minimize selection bias and to increase resolution of subtle comparisons. This approach can be extended for the analysis of other cell biological structures and processes implicated in neurodegeneration, such as proteinaceous puncta (stress granules and synaptic complexes), as well as membrane-bound compartments (mitochondria and membrane trafficking vesicles). This method provides a standardized, yet adaptable reference point for image analysis and quantification, and could facilitate reliability and reproducibility across the field, and ultimately enhance mechanistic understanding of neurodegeneration.

Quantitative Cell Biology of Neurodegeneration in Drosophila Through Unbiased Analysis of Fluorescently Tagged Proteins Using ImageJ

We have developed a simple and adaptable workflow to extract quantitative data from fluorescence-imaging-based cell biological studies of protein aggregation and autophagic flux in the central nervous system of Drosophila models of neurodegeneration.

بيولوجيا الخلية كمية من نيوروديجينيريشن في المورفولوجية من خلال تحليل غير منحازة للبروتينات فلوريسسينتلي المعلمة باستخدام إيماجيج

With the rising prevalence of neurodegenerative diseases, it is increasingly important to understand the underlying pathophysiology that leads to neuronal ...

قياس التفاعلات عبر الخلية من خلال تجميع البروتين في نظام الخلايا heterologous

Summary

Explore More Videos

Chapters in this video