Najmeh Nikpour and Fiona Alum provided suggestions and edited this manuscript. Department of Biochemistry at McGill University supported HM and VM with the CIHR Training Initiative in Chemical Biology. This work was supported by Canadian Institute of Health Research (CIHR) grant 119464 (to R. S.).

يصف بروتوكول تحت الإجراء لأداء القائم على مضان الحمض النووي الريبي تحرير مقايسة. الفحص لا يمكن أن يؤديها في PCR أنبوب واحد، 96 جيدا، أو لوحات 384 جيدا تبعا لنطاق التجربة. في وقت لاحق إشارة مضان يمكن قراءتها على الوقت الحقيقي PCR نظام الكشف مناسبة. يوصف الفحص هنا في سياق لوحات 384 جيدا. 1. التثقيف T. خلايا البروسية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> إعداد المتوسطة النمو لT. البروسية procyclic الخلايا النموذج. ل1 لتر من المتوسط: <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> حل ز 25.4 مسحوق SDM-79 في المياه 800 مل miliQ. </li><li style=";text-align:right;direction:rtl"> إضافة 2 غرام من NaHCO 3 و الرقم الهيدروجيني إلى 7.3 مع هيدروكسيد الصوديوم M 10. </li><li style=";text-align:right;direction:rtl"> إضافة الماء nanopure إلى الحجم النهائي من 900 مل، فلتر تعقيم. </li><li style=";text-align:right;direction:rtl"> إضافة مصل بقري جنيني (FBS)، البنسلين الستربتوميسين حل وهيمن (2.5 ملغ / مل) لتركيزات النهائي من 10٪ (ت / ت)، و 100 U / مل و 7.5 ملغم / لتر على التوالي. </li></ol></li><li style=";text-align:right;direction:rtl"> تنمو 300 مل من T. &lt;م&gt; البروسية 1.7A النوع البري (شكل procyclic) الخلايا عند 28 درجة مئوية، والهز في 70 دورة في الدقيقة لكثافة 1.5 × 10 7 خلية / مل. ملاحظة: هذا يجب أن ينتج 3 مل من editosome نشطة مع ~ 0.5 ملغ من البروتين الكلي، وتكون كافية ل600 ردود الفعل التحرير. </li><li style=";text-align:right;direction:rtl"> حصاد الخلايا بواسطة الطرد المركزي في 6000 x ج لمدة 10 دقيقة في 4 درجات مئوية. </li><li style=";text-align:right;direction:rtl"> غسل بيليه مع 50 مل من العازلة PBSG المبرد (10 ملي نا 2 هبو 4، 10 ملم ناه 2 ص 4، 145 مم كلوريد الصوديوم، و 6 ملي الجلوكوز)، وتدور باستمرار الخلايا مرة أخرى عن طريق الطرد المركزي في 10،000 x ج لمدة 10 دقيقة في 4 ° C. </li></ol> 2. عزل الخام الميتوكوندريا ملاحظة: يجب أن يتم تنفيذ جميع الخطوات على الجليد أو على 4 درجات مئوية للحفاظ على editosome النشاط. <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> resuspend الخلايا تحصد في 30 مل من العازلة DTE (1 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 8.0 و 1 ملم EDTA). استخدام 40 مل العقيمة الخالط Dounce (قبل المبردة) لتعطيل غشاء الخلية عن طريق التمسيد صعودا وهبوطا 10 مرات على الأقل على الجليد. </لى&gt; <li style=";text-align:right;direction:rtl"> على الفور إضافة 4.3 مل من 60٪ سكروز (ث / ت، أي 1.75 م) إلى جناسة إلى تركيز النهائي من 0.25 م الطرد المركزي في 15،800 x ج لمدة 10 دقيقة في 4 درجات مئوية، لتحقيق تفضيلي أسفل الميتوكوندريا. </li><li style=";text-align:right;direction:rtl"> resuspend الكرية الميتوكوندريا في 4.6 مل من STM العازلة (20 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 8.0، 250 ملي السكروز و 2 ملي MgCl 2). إضافة 13.8 ميكرولتر من 0.1 M و CaCl 2 و 4 ميكرولتر من الدناز ريبونوكلياز خالية من الأول إلى تركيزات النهائي من 0.3 ملي و 9 U / مل، على التوالي. احتضان الخليط لمدة 1 ساعة على الجليد. </li><li style=";text-align:right;direction:rtl"> إضافة 4.6 مل من العازلة STE (20 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 8.0، 250 ملي السكروز و 2 ملي EDTA) لإبطال نشاط الدناز أولا الطرد المركزي في 15،800 x ج لمدة 10 دقيقة في 4 درجات مئوية. </li><li style=";text-align:right;direction:rtl"> resuspend وبيليه في 400 ميكرولتر من تحلل العازلة (10 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 7.2 و 10 ملي MgCl 2، 100 ملي بوكل، 1 ميكروغرام / مل pepstatin، 1 ملم DTT، و 1X كاملة خالية من مثبط البروتياز EDTA) ونقل إلى microfuge أنبوب. </li><li style=";text-align:right;direction:rtl"> إضافة 10٪ تريتون X-100 إلى تركيز النهائي من 1٪ ل<html> الثانية احتضان المحللة لمدة 15 دقيقة في 4 درجات مئوية على محور دوار الأنبوب. </li><li style=";text-align:right;direction:rtl"> مسح المحللة الميتوكوندريا بواسطة الطرد المركزي مرتين في 17،000 x ج لمدة 15 دقيقة على 4 درجات مئوية؛ الاحتفاظ طاف تطهيرها في كل مرة. </li></ol> 3. Editosome تنقية <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> صب 10 مل 10٪ -30٪ (V / V) التدرج الجلسرين الخطي (الجدول 1) في أنبوب نابذة فائقة السرعة باستخدام 2X العازلة HHE التدرج (40 ملي HEPES الرقم الهيدروجيني 7.9، 20 ملي المغنيسيوم (سلا) 2، 100 ملي بوكل، و 2 مم EDTA) وصانع التدرج باتباع دليل التعليمات. </li><li style=";text-align:right;direction:rtl"> إزالة بعناية 500 ميكرولتر من الحل من أعلى التدرج الجلسرين وتحميل بلطف 500 ميكرولتر من المحللة الميتوكوندريا تطهيرها. تدور في 178،000 x ج لمدة 6 ساعة في 4 درجات مئوية باستخدام نابذة فائقة السرعة. </li><li style=";text-align:right;direction:rtl"> جمع الكسور 500 ميكرولتر بالتسلسل من أعلى إلى أسفل الانحدار عند 4 درجات مئوية. ثم المفاجئة تجميد الكسور باستخدام النيتروجين السائل وتخزينها في -80 درجة مئوية حتى الاستخدام. </li></ol>ق = &quot;jove_title&quot;&gt; 4. إعداد RNA <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> يصلب القالب الحمض النووي منها تحتوي على تسلسل مكملة لتسلسل T7 المروج (الجدول 2) مع قليل النوكليوتيد T7 المروج (5&#39;-TAATACGACTCACTATAGGG-3 &#39;) في نسبة المولي 1:1 من التدفئة في 90 درجة مئوية لمدة 3 دقائق والتبريد في RT لمدة 10 دقيقة على الأقل. </li><li style=";text-align:right;direction:rtl"> نسخ الحمض النووي الريبي باستخدام النسخ عدة في المختبر عن طريق اتباع دليل التعليمات. </li><li style=";text-align:right;direction:rtl"> وقف رد فعل النسخ عن طريق إضافة حجم مساو من 7 M اليوريا صبغ (7 M اليوريا، 0.05٪ الزيلين Cynol، و 0.05٪ برموفينول الأزرق). تعمل على تصفية تعقيمها 9٪ هلام بولي أكريلاميد تغيير طبيعة (9٪ الأكريلاميد، 7 M اليوريا، 1X TBE). </li><li style=";text-align:right;direction:rtl"> استخدام الأشعة فوق البنفسجية (UV) التظليل مع مصباح الأشعة فوق البنفسجية قصيرة الموجة لتحديد مكان والمكوس RNA منها. وضع قطعة هلام رفعه في أنبوب microfuge وإضافة 400 ميكرولتر من هلام شطف العازلة (20 ملي تريس، حمض الهيدروكلوريك درجة الحموضة 7.5، 250 ملي NaOAc، 1 ملم EDTA و0.25٪ SDS). أزل بين عشية وضحاها في RT على محور دوار الأنبوب. </li><li style=";text-align:right;direction:rtl"> PRECIpitate الحمض النووي الريبي مزال بإضافة 1 مل من البرد الإيثانول بنسبة 100٪ واحتضان إما في -80 درجة مئوية لمدة 30 دقيقة أو -20 درجة مئوية خلال الليل. </li><li style=";text-align:right;direction:rtl"> أجهزة الطرد المركزي في 16،000 x ج لمدة 30 دقيقة في 4 درجات مئوية، لتكوير أسفل الحمض النووي الريبي. </li><li style=";text-align:right;direction:rtl"> غسل بيليه مع 1 مل من الإيثانول بنسبة 75٪. أجهزة الطرد المركزي في 16،000 x ج لمدة 20 دقيقة في 4 درجات مئوية. </li><li style=";text-align:right;direction:rtl"> resuspend الكرية RNA مناسب في ريبونوكلياز المياه مجانا لتحقيق تركيزات المطلوب، كما هو مبين في الجدول رقم 2. </li></ol> 5. مضان القائم على الفحص-RNA التحرير <ol style=";text-align:right;direction:rtl"><li style=";text-align:right;direction:rtl"> لفعل واحد، والجمع بين 1 بمول (1 ميكرولتر) من preA6Rbz و 2.5 بمول (1 ميكرولتر) من gA6Rbz (نسبة المولي 1:2.5) في أنبوب microfuge، احتضان عند 70 درجة مئوية لمدة 3 دقائق، والسماح لها الجلوس على RT لفي لا يقل عن 10 دقيقة. </li><li style=";text-align:right;direction:rtl"> وفي الوقت نفسه إعداد مزيج الرئيسي باستخدام الجدول 3، من دون preA6Rbz وgA6Rbz، للتفاعل التحرير التي تحتوي على 1X العازلة HHE (25 ملي HEPES الرقم الهيدروجيني 7.9، 10 ملي المغنيسيوم (سلا) 2، 50 ملي بوكل و 10 ملي EDTA)، 1 ملمATP، 5 مم CaCl 2، 16 نانوغرام / ميكرولتر من الحمض النووي الريبي المستخفية الخميرة، 0.1٪ تريتون X-100، وeditosome المنقى. </li><li style=";text-align:right;direction:rtl"> إضافة صلب preA6Rbz وgA6Rbz لإكمال مزيج الرئيسي. </li><li style=";text-align:right;direction:rtl"> الاستغناء 18 ميكرولتر من مزيج الرئيسي (الجدول 3) في الآبار التي تحتوي إما 2 ميكرولتر من ريبونوكلياز خالية من المياه (الآبار مع عدم وجود مركبات) أو 2 ميكرولتر من 200 ميكرومتر المركبات الكيميائية وتشمل عينات السيطرة في لوحة وفقا لشكل 5. </li><li style=";text-align:right;direction:rtl"> ختم اللوحة مع لوحة سداده وتدور لوحة أسفل، لإزالة أي فقاعات الهواء. احتضان عند 28 درجة مئوية لمدة 4 ساعة. </li><li style=";text-align:right;direction:rtl"> إضافة 25 بمول (2 ميكرولتر) من gA6Rbz منافس إلى كل بئر. وضع سداده الطازجة، وتدور لوحة أسفل ووضعه على الوقت الحقيقي PCR الجهاز. برنامج التجربة التالية: الخطوة 1: 85 درجة مئوية لمدة 5 دقائق؛ الخطوة 2: 24 درجة مئوية لمدة 10 دقيقة؛ الخطوة 3: إيقاف. </li><li style=";text-align:right;direction:rtl"> إضافة 15 بمول (1 ميكرولتر) من الحنق الركيزة إلى كل بئر إلى الحجم النهائي من 23 ميكرولتر. ختم لوحة مع السداده الطازجة.تدور بسرعة لوحة ووضعه مرة أخرى على الوقت الحقيقي PCR الجهاز. </li><li style=";text-align:right;direction:rtl"> البرنامج تجربة جديدة مع الخطوات التالية: الخطوة 1: 37 درجة مئوية لمدة 1 دقيقة؛ الخطوة 2: اقرأ؛ الخطوة 3: اذهب إلى الخطوة 1، 40 مرة؛ الخطوة 4: إيقاف. </li><li style=";text-align:right;direction:rtl"> إعداد لوحة عن طريق تحديد جميع الآبار التي تتطلب القراءة واختيار المرشح FAM. حجم المدخلات إلى 23 ميكرولتر وبدء التشغيل. </li><li style=";text-align:right;direction:rtl"> حساب المنحدر من القيم التي تم الحصول عليها من كل جانب / عينة للحصول على قياس الحركية من خلال التآمر المنحدرات على الرسم البياني شريط للتحليل. ملاحظة: قراءة الحركية يحسن نسبة الإشارة إلى الضوضاء بين العينة والخلفية؛ كما العينة الخلفية سيكون له منحدر قريبة من الصفر. قراءة نقطة النهاية لديها أعلى من الضوضاء في الخلفية. </li></ol>

<ol>
	<li>Benne, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=transcript+of+the+frameshifted+coxII+gene+from+trypanosome+mitochondria+contains+four+nucleotides+that+are+not+encoded+in+the+DNA.">transcript of the frameshifted coxII gene from trypanosome mitochondria contains four nucleotides that are not encoded in the DNA.</a> Cell. 46, 819-826 (1986).</li><li>Hajduk, S., Ochsenreiter, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+kinetoplastids.">RNA editing in kinetoplastids.</a> RNA biology. 7, 229-236 (2010).</li><li>Aphasizhev, R., Aphasizheva, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridine+insertion/deletion+editing+in+trypanosomes:+a+playground+for+RNA-guided+information+transfer.">Uridine insertion/deletion editing in trypanosomes: a playground for RNA-guided information transfer.</a> Wiley interdisciplinary reviews RNA. 2, 669-685 (2011).</li><li>Seiwert, S. D., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing:+transfer+of+genetic+information+from+gRNA+to+precursor+mRNA+in+vitro.">RNA editing: transfer of genetic information from gRNA to precursor mRNA in vitro.</a> Science. 266, 114-117 (1994).</li><li>Weng, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Guide+RNA-binding+complex+from+mitochondria+of+trypanosomatids.">Guide RNA-binding complex from mitochondria of trypanosomatids.</a> Molecular. 32, 198-209 (2008).</li><li>Hashimi, H., Zikova, A., Panigrahi, A. K., Stuart, K. D., Lukes, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TbRGG1,+an+essential+protein+involved+in+kinetoplastid+RNA+metabolism+that+is+associated+with+a+novel+multiprotein+complex.">TbRGG1, an essential protein involved in kinetoplastid RNA metabolism that is associated with a novel multiprotein complex.</a> RNA. 14, 970-980 (2008).</li><li>Ammerman, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Architecture+of+the+trypanosome+RNA+editing+accessory+complex,+MRB1.">Architecture of the trypanosome RNA editing accessory complex, MRB1.</a> Nucleic Acids Res. 40, 5637-5650 (2012).</li><li>Huang, C. E., O'Hearn, S. F., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Assembly+and+function+of+the+RNA+editing+complex+in+Trypanosoma+brucei+requires+band+III+protein.">Assembly and function of the RNA editing complex in Trypanosoma brucei requires band III protein.</a> Molecular and cellular biology. 22, 3194-3203 (2002).</li><li>Carnes, J., Trotter, J. R., Peltan, A., Fleck, M., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+editing+in+Trypanosoma+brucei+requires+three+different+editosomes.">RNA editing in Trypanosoma brucei requires three different editosomes.</a> Molecular and cellular biology. 28, 122-130 (2008).</li><li>Hearn, S. F., Huang, C. E., Hemann, M., Zhelonkina, A., Sollner-Webb, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trypanosoma+brucei+RNA+editing+complex:+band+II+is+structurally+critical+and+maintains+band+V+ligase,+which+is+nonessential.">Trypanosoma brucei RNA editing complex: band II is structurally critical and maintains band V ligase, which is nonessential.</a> Molecular and cellular biology. 23, 7909-7919 (2003).</li><li>Schnaufer, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+RNA+ligase+essential+for+RNA+editing+and+survival+of+the+bloodstream+form+of+Trypanosoma+brucei.">An RNA ligase essential for RNA editing and survival of the bloodstream form of Trypanosoma brucei.</a> Science. 291, 2159-2162 (2001).</li><li>Tarun, S. Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=KREPA6+is+an+RNA-binding+protein+essential+for+editosome+integrity+and+survival+of+Trypanosoma+brucei.">KREPA6 is an RNA-binding protein essential for editosome integrity and survival of Trypanosoma brucei.</a> RNA. 14, 347-358 (2008).</li><li>Croft, S. L., Barrett, M. P., Urbina, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chemotherapy+of+trypanosomiases+and+leishmaniasis.">Chemotherapy of trypanosomiases and leishmaniasis.</a> Trends in parasitology. 21, 508-512 (2005).</li><li>Denise, H., Barrett, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uptake+and+mode+of+action+of+drugs+used+against+sleeping+sickness.">Uptake and mode of action of drugs used against sleeping sickness.</a> Biochemical pharmacology. 61, 1-5 (2001).</li><li>Seiwert, S. D., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Direct+visualization+of+uridylate+deletion+in+vitro+suggests+a+mechanism+for+kinetoplastid+RNA+editing.">Direct visualization of uridylate deletion in vitro suggests a mechanism for kinetoplastid RNA editing.</a> Cell. 84, 831-841 (1996).</li><li>Igo, R. P., Palazzo, S. S., Burgess, M. L., Panigrahi, A. K., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Uridylate+addition+and+RNA+ligation+contribute+to+the+specificity+of+kinetoplastid+insertion+RNA+editing.">Uridylate addition and RNA ligation contribute to the specificity of kinetoplastid insertion RNA editing.</a> Molecular and cellular biology. 20, 8447-8457 (2000).</li><li>Igo, R. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+uridylate-specific+exoribonuclease+activity+in+Trypanosoma+brucei+RNA+editing.">Role of uridylate-specific exoribonuclease activity in Trypanosoma brucei RNA editing.</a> Eukaryotic cell. 1, 112-118 (2002).</li><li>Wang, B., Salavati, R., Heidmann, S., Stuart, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+hammerhead+ribozyme+substrate+and+reporter+for+in+vitro+kinetoplastid+RNA+editing.">A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing.</a> RNA. 8, 548-554 (2002).</li><li>Moshiri, H., Salavati, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fluorescence-based+reporter+substrate+for+monitoring+RNA+editing+in+trypanosomatid+pathogens.">A fluorescence-based reporter substrate for monitoring RNA editing in trypanosomatid pathogens.</a> Nucleic Acids Res. 38, e138 (2010).</li><li>Jenne, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+identification+and+characterization+of+hammerhead-ribozyme+inhibitors+using+fluorescence-based+technology.">Rapid identification and characterization of hammerhead-ribozyme inhibitors using fluorescence-based technology.</a> Nature. 19, 56-61 (2001).</li><li>Hartig, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein-dependent+ribozymes+report+molecular+interactions+in+real+time.">Protein-dependent ribozymes report molecular interactions in real time.</a> Nature. 20, 717-722 (2002).</li><li>Famulok, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allosteric+aptamers+and+aptazymes+as+probes+for+screening+approaches.">Allosteric aptamers and aptazymes as probes for screening approaches.</a> Current opinion in molecular therapeutics. 7, 137-143 (2005).</li><li>Teng, B., Burant, C. F., Davidson, N. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+cloning+of+an+apolipoprotein+B+messenger+RNA+editing+protein.">Molecular cloning of an apolipoprotein B messenger RNA editing protein.</a> Science. 260, 1816-1819 (1993).</li><li>Jurica, M. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Searching+for+a+wrench+to+throw+into+the+splicing+machine.">Searching for a wrench to throw into the splicing machine.</a> Nature chemical biology. 4, 3-6 (2008).</li><li>Spahn, C., Prescott, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Throwing+a+spanner+in+the+works:+antibiotics+and+the+translation+apparatus.">Throwing a spanner in the works: antibiotics and the translation apparatus.</a> Journal of molecular medicine. 74, 423-439 (1996).</li></ol>

The authors have nothing to disclose.

وقدم الإنتاجية العالية طريقة الفرز رواية لتحديد مثبطات ضد مجمع التحرير الحمض النووي الريبي من المثقبيات، وتوفير وسيلة جديدة لاكتشاف الأدوية لمواجهة الأمراض التي تسببها trypanosomatids. وقد استند الحنق-ribozyme الفحص المستخدمة على نطاق واسع لأغراض مختلفة 20-22؛ ومع ذلك، لقد استخدمت قدرات الفحص ribozyme مقرها الحنق لرصد النشاط في المختبر من الحمض النووي الريبي تحرير 19. يحتمل أن تتكيف هذا الاختبار على أنواع أخرى من تحرير الحمض النووي الريبي في حقيقيات النوى، مثل تحرير استبدال النوكليوتيدات من الرنا ترميز نواة الثدييات 23. الجدة من هذا الاختبار ليس في وضع المقايسات ribozyme مقرها الحنق، في حد ذاته، ولكن في وضع الأسلوب الذي يدمج هذه التقنية إلى تحرير مقايسة الحمض النووي الريبي التي هي قابلة للالفرز الفائق الإنتاجية للمواد الكيميائية ضد editosome. الأسلوب القائم على الفحص ribozyme ديها العديد من المزايا أكثر من غيرها من الشاشات والحمارAYS تستخدم حاليا لهذا الغرض. على وجه التحديد، والتقنية يقدم مقايسة حساسة وقابلة للتكرار &quot;المزيج والتدبير&quot; الاعتماد على ركيزة الفلورسنت بدلا من واحدة رديولبلد، مما يجعل من يصلح لالفرز الفائق الإنتاجية 19. رصد في الوقت الحقيقي للإشارة مضان بعد إضافة الركيزة بدلا من إشارة بسيطة نقطة النهاية يجعل من الممكن تحديد أكثر دقة IC 50 قيم المركبات يعاير 19. وعلاوة على ذلك، فإنه يسمح اختبار من التأثيرات المثبطة للمركبات على مجمع كامل editosome بدلا من البروتينات المؤتلف الفردية. نظرا للطبيعة الديناميكية للتفاعلات داخل المجمعات البروتين، ويمكن اقترح أن هذا الأسلوب يسمح تحديد مثبطات ضد editosome البروتينات في أكثر ممثل بيولوجيا وضع 24. بالإضافة إلى ذلك، استهدفت مجمع كامل editosome يوفر فرصة لاعتقال يحتمل تطور تحرير الحمض النووي الريبيعلى مختلف الخطوات عابرة التي لم يتم تحديدها سابقا. وبالتالي، فإن هذه التقنية تسمح تكتسب منظورا أفضل لتفاعلات والأنشطة التي تعتبر حاسمة بالنسبة لعملية تحرير الحمض النووي الريبي. وقد وجد هذا النهج لتكون ناجحة في الماضي كما يتضح من استجلاء بدائية النواة التجمع المعقدة الريبوسوم وظيفة باستخدام المضادات الحيوية، مثل فيوميسين والاريثروميسين، بوصفها مثبطات مجمع 24،25. لضمان الانتهاء بنجاح من الأسلوب، قد بعض التعديلات في بروتوكولات تكون ضرورية. الأولى، واختيار المناسب الجلسرين التدرج استخراج جزء الميتوكوندريا أمر بالغ الأهمية. هنا، والكسور من 7 إلى 11، والمقابلة لمنطقة ~ 20S من التدرج، أظهرت أعلى نشاط والتحرير، مع جزء 9 واظهار أقصى قدر من النشاط. على الرغم من أن تم اختيار هذا الكسر لكافة الاختبارات المقدمة، فمن الضروري اختبار جميع الكسور مسبقا من أجل تقييم الذي FRAكشن القمم النشاط التحرير. الثانية، للتحقق من صحة اختيار جزء، فمن الأهمية بمكان لأداء الاختبارات الأولية لتقييم نسبة الإشارة إلى الضوضاء عن طريق حساب قيمة Z&#39;عامل. إذا كان قد تم الانتهاء السليم الميتوكوندريا استخراج الجلسرين التدرج تجزئة، يمكن تحقيق القيمة Z&#39;0.6. المقبل، فمن المستحسن لإعادة تقييم حجم رد الفعل من استخراج الميتوكوندريا اللازمة لتحقيق النشاط تحرير الأقصى عبر المعايرة 19. قيود هامة للتقنية المقدمة في هذه الورقة تتعلق عملية شاقة وتستغرق وقتا طويلا للتجزئة الميتوكوندريا استخراج الجلسرين التدرج التي يتم من خلالها تنقية معقدة editosome 19. على الرغم من هذه العيوب، ويقترح هذا الأسلوب تفضيلي للحصول الكسور editosome الخام نظرا لانخفاض تكلفتها المحتملة مقابل العائد، وبالتالي تأهيله للتطبيق على الفرز الفائق الإنتاجية. في المقابل، وسائل أخرى مثل TAP-العلامة بوrification، والتي هي قادرة على إعطاء المزيد من الكسور editosome النقية، هي الأفضل لانخفاض الإنتاجية إلى فحوصات المتوسطة مثل في حالة المقايسات الثانوية. علاوة على ذلك، من أجل ضمان تأثير مثبط محددة من المركبات، فمن الضروري أن تشمل الضوابط لاختبار لهم ضد نشاط ribozyme (A6Rbz) في غياب editosome. تجدر الإشارة إلى أن دراسات سابقة قد سلطت الضوء أن هذه الطريقة قد تكون غير فعالة في حساب القيم IC50 للمركبات مثل صبغ بسبب تداخل محتمل في تركيزات عالية مركب 19. لزيادة حساسية هذه التقنية HTS قدم، ووضع مقايسة على أساس مضان مماثلة تشمل ما قبل المشقوق ribozyme تحريرها قبل هو مفيد. هذا من شأنه أن يسمح تجاوز endonucleolytic خطوة الانقسام معدل الحد يحفزه endonucleases في مجمع editosome. سيكون ميزة أخرى لهذا الاختبار أن يكون التطبيق تعديل كأداة فحص الثانويةلرصد تأثير مثبطات تحديدها من خلال الشاشة الرئيسية على ExoUase، TUTase وربط الأنشطة الحفازة. مقايسة المقترحة حاليا يقتصر على الكشف عن مثبطات ضد نوع حذف تحرير الحمض النووي الريبي. وبالتالي، فإن سبيلا آخر لاستكشاف يكون التعديل للمقايسة قدم لتمكين رصد آثار مجمع على نوع الإدراج التحرير الحمض النووي الريبي.

عملية تحرير الحمض النووي الريبي، تعديل مرنا ما بعد النسخي، اكتشفت لأول مرة في trypanosomatids 1. منذ ذلك الحين، وقد أجريت أعمال كبيرة في دراسة آلية وراء تحرير الحمض النووي الريبي في المثقبية البروسية 2،3. في سلسلة من التفاعلات الإنزيمية، وeditosome، وهو مجمع الأساسية من حوالي 20 البروتينات، ويخلق mRNAs والميتوكوندريا ناضجة لمكونات متعددة من الأكسدة الفسفرة نظام توليد الطاقة. ترتيب الأحداث الحفاز هو الانقسام endonucleolytic، uridylate (U) بالإضافة أو الحذف، والربط، وفقا لما تمليه الرنا دليل (gRNAs) 4. بالإضافة إلى البروتينات الأساسية المعقدة editosome، كما تم تحديد عدد من العوامل التبعي 5-7. وتعتبر هذه البروتينات معظمها مجمعة في المجمعات مستقلة. ومع ذلك، من اجل تجميع البروتين في مجمع editosome الأساسية وأنماط التفاعل بين مجمع الأساسية مع ملحقالمجمعات هي لم يتحدد بعد. تستهدف عملية تحرير الحمض النووي الريبي في trypanosomatids قد توفر dissectors الكيميائية التي تساعد في دراسة التجمع وظيفة معقدة editosome. علاوة على ذلك، أظهرت دراسات عدة بروتينات وظيفية على editosome الإستخدامات الأساسية عبر مراحل الحياة المختلفة، مشيرا إلى قدرتها كأهداف المخدرات 8-12. وبالتالي، فإن مثبطات جدت من editosome قد تعمل أيضا مركبات الرصاص ضد trypanosomatids. هذا هو الوقت المناسب، والأدوية المتاحة حاليا ضد الأمراض التي تسببها trypanosomatid سامة، غير فعالة ومكلفة 13،14. مقايسة فعالة ومريحة في المختبر من الضروري استكشاف الكون الكيميائية لمثبطات معينة التي تعمل على منع تحرير الحمض النووي الريبي. وقد وضعت ثلاثة فحوصات وتستخدم لمراقبة editosome الأنشطة: (أ) جولة كاملة في المختبر فحص الحمض النووي الريبي تحرير 15، (ب) المشقوق مسبقا في المختبر فحص الحمض النووي الريبي تحرير 16،17، والثانية (ج) المطرقة ribozyme (HHR) مقايسة 18 القائم. المقايسات الأولين تعتمد على رؤية مباشرة من المنتج تحريرها (أتباز 6 مرنا) مع مساعدة من النشاط الإشعاعي. يستخدم فحص مقرها HHR-نسخة معدلة من مرنا أتباز 6 التي على غرار لتتصرف كما ribozyme على التحرير. وribozyme وظيفية ثم يشق تحديدا ركيزة الحمض النووي الريبي رديولبلد، بمثابة المراسل. في الآونة الأخيرة، مشيري وآخرون ضعت &#39;خلط وقياس&#39; المستندة إلى HHR في المختبر مراسل فحص الحمض النووي الريبي لمراقبة التحرير حيث يتم استبدال الركيزة الحمض النووي الريبي رديولبلد مع نقل الطاقة مضان الرنين (الحنق) الركيزة 19. مزايا مبدأ هذا الاختبار هي: (أ) هو مزيج سريع ومريحة ونوع مقياس الفحص، حيث أن إنتاج ribozyme نشطة والركيزة الانقسام تحدث في وقت واحد في نفس الأنبوب في انخفاض حجم (أي 20 ميكرولتر)، (ب ) فإنه يتجنب استخدام المواد المسمى بالإشعاع، (ج) الحساسية التي هيfforded من قبل الأجهزة مضان في شكل لوحة عيار الصغيرة، و (د) إشارة إلى ارتفاع نسبة الضوضاء. باستخدام هذا الاختبار، تم تأكيد تأثير الحمض النووي الريبي معروفة التحرير مثبطات يغاز ضد editosome النقية 19. هذه التجربة التحقق من صحة الاختبار لتحديد السريع لمثبطات تحرير الحمض النووي الريبي، في المقام الأول ضد editosomes كله من T. البروسية. الرقم 1 هو خطوة بخطوة تخطيطي مفصل للفي المختبر فحص الحمض النووي الريبي التحرير القائم على مضان. هذا البروتوكول يمكن إما أن تستخدم لرصد تحرير الحمض النووي الريبي في المختبر أو يتم تكييفه لفحص المكتبات مركب من المقاييس المختلفة.

<table border="0" cellpadding="0" cellspacing="0" width="979">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Name of Material/ Equipment</td>
			<td style="width:203px;">Company</td>
			<td style="width:139px;">Catalog Number</td>
			<td style="width:248px;">Comments/Description</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">SDM-79 Medium</td>
			<td>Gibco by life technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="23">
			<td height="23" style="height:23px;">Fetal Bovine Serum</td>
			<td>life technologies</td>
			<td style="width:139px;">12483-020</td>
			<td>heat inactivation at 550C for 1 h</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Hemin, minimum 80%</td>
			<td style="width:203px;">Sigma</td>
			<td style="width:139px;">H5533-10G</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Penicillin-Streptomycin Sollution</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">MT-30-002-CI</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Dnase 1 recombinant, Rnase Free&#160;</td>
			<td style="width:203px;">Roche</td>
			<td style="width:139px;">4716728001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">T7 RiboMax Express Large&#160; scale RNA&#160; production system</td>
			<td style="width:203px;">Promega</td>
			<td style="width:139px;">P1320</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Kimble Kontes Dounce Tissue Grinders&#160;&#160;</td>
			<td style="width:203px;">Fisher Scientific</td>
			<td style="width:139px;">K885300-0040&#160;&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Gradient Master, ver 5.25&#160;</td>
			<td style="width:203px;">Biocomp</td>
			<td style="width:139px;">107-201M</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Ultra Clear Tube, 13.2ML</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">344059</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Optima L-100XP&#160; Ultracentrifuge&#160;</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">392052</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">SW 41 Ti ROTOR</td>
			<td style="width:203px;">Beckman Coulter</td>
			<td style="width:139px;">331336</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">MicroSeal &#39;B&#39; Seal, Seals</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">MSB1001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">CFX 384 Touch Real-Time PCR Detection System</td>
			<td style="width:203px;">Biorad</td>
			<td style="width:139px;">185-5484</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Acryl/Bis solution (19: 1), 40% (w/v)</td>
			<td style="width:203px;">Bio Basic</td>
			<td style="width:139px;">A0006-500ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:391px;">Urea, Molecular biology grade, 1Kg</td>
			<td style="width:203px;">life technologies</td>
			<td style="width:139px;">AM9902</td>
			<td style="width:248px;"></td>
		</tr>
	</tbody>
</table>

rna catalyst as a reporter for screening drugs against rna editing in trypanosomes

وقد تم إحراز تقدم كبير في تحديد آلية تحرير RNA الميتوكوندريا في المثقبيات. وبالمثل، تم إحراز تقدم كبير في تحديد مكونات معقدة editosome التي تحفز تحرير الحمض النووي الريبي. ومع ذلك، فإنه لا يزال من غير الواضح كيف تعمل هذه البروتينات معا. المركبات الكيميائية التي تم الحصول عليها من شاشة عالية الإنتاجية ضد editosome قد تمنع أو تؤثر على الخطوات واحدة أو أكثر في دورة التحرير. وبالتالي، فإن تحديد مركبات كيميائية جديدة تولد تحقيقات الجزيئية قيمة للتشريح وظيفة editosome والتجمع. في دراسات سابقة، أجريت في المختبر تحرير المقايسات خارج باستخدام الحمض النووي الريبي المسمى الراديو. هذه المقايسات هي مضيعة للوقت وغير فعالة وغير مناسبة لأغراض الإنتاجية العالية. هنا، واستنادا مضان متجانسة &quot;خلط وقياس&quot; المطرقة ribozyme في المختبر مراسل مقايسة لمراقبة التحرير الحمض النووي الريبي، ويرد. فقط نتيجة لتحرير الحمض النووي الريبيوribozyme المطرقة نقل الطاقة مضان الرنين (الحنق) oligoribonucleotide الركيزة يخضع الانقسام. هذا بدوره يؤدي إلى فصل من fluorophore من فاكهه تقضي بالتالي إنتاج إشارة. في المقابل، عندما يتم تثبيط وظيفة editosome، سيتم تطفئ إشارة مضان. هذا هو الاختبار حساسة للغاية والبسيطة التي يجب أن تكون قابلة للتطبيق عموما لمراقبة التحرير في الحمض النووي الريبي المختبر أو إنتاجية عالية الفرز من المواد الكيميائية التي يمكن أن تحول دون وظيفة editosome.

لشرح الخطوات اللازمة لإنشاء شاشة واسعة النطاق، أرقام 2-5 لتجارب السيطرة ممثل تتعلق نوعية الفحص. هذه هي التجارب التحكم الأساسية للمقايسة متسقة على مدى عدة أيام من فحص أو للمقارنة بين شاشات مختلفة. تقييم الإسفار نسبة الإشارة إلى الضوضاء لضمان الاستقرار ونوعية oligoribonucleotide الركيزة المسمى فلوريسئين في إعداد نطاق واسع، وقد حسبت Z&#39;عامل، الذي يعرف بأنه الفرق بين الخلفية فحص والحد الأقصى للإشارة باستخدام جزيء ribozyme النشط (A6Rbz). . المقايسات مع Z&#39;عامل تعتبر&gt; 0.5 مقبولة للشاشة عالية الإنتاجية الشكل 2 يوضح بيانات تمثيلية باستخدام الركيزة الحنق المسمى مع 5 &#39;فلوريسئين (FAM؛ باعث) و 3&#39; N، N &#39;tetramethylrhodamine (TAMRA؛ فاكهه تقضي) (A6Rbz_F / T). أنتجت هذه الركيزة على عامل Z&#39;من 0.64 عند حسابها باستخدام 72 مكررات في حضور وغياب A6Rbz. في هذا الاختبار الركيزة البديلة باستخدام أيوا الأسود فاكهه تقضي الظلام (A6Rbz_F/Ib) يمكن أن يحقق نسبة أفضل إشارة إلى الضجيج مقارنة TAMRA. وذلك لأن ولاية ايوا الأسود، على عكس TAMRA، استوعبت تنبعث الطاقة في شكل حرارة وضوء لا. كان عامل Z&#39;الحصول عليها باستخدام FAM / أيوا الأسود (F / رطل) المسمى الركيزة 0.68. التحسن في Z&#39;عامل لالركيزة F / رطل المسمى على الركيزة TAMRA المسمى هو بسبب الخلفية أقل نسبيا. تظهر هذه النتائج أن كلا من ممثل ركائز هي الخيارات الممكنة لاستخدامها في شاشة عالية الإنتاجية. تحديد الأنشطة التحرير من الجلسرين التدرج الكسور لتحديد واختيار الكسور editosome الأكثر نشاطا للتجارب، وglycero<html> تم اختبار كسور ل التدرج في المختبر لتحرير باستخدام مقايسة على أساس مضان (الخطوة V). تظهر هذه البيانات (الشكل 3) 7-12 الكسور مثل كسور الأكثر نشاطا (≥ 50٪ النشاط التحرير؛ مع جزء الأكثر نشاطا إلى 100٪). ويمكن الجمع بين هذه الكسور عندما يكون مطلوبا أكثر editosome. حساب عامل Z&#39;عندما تم الجمع بين الكسور Editosome لتحديد تأثير combinig الكسر editosome، تم حساب قيمة Z&#39;عامل من 0.6 عندما استخدمت الكسور الأكثر نشاطا (F8 F9 + + F10) كمصدر للeditosome. لحساب تم اختبار 72 مكررات في حضور وغياب editosome (الشكل 4) Z&#39;عامل. تم استخدام الركيزة F / رطل في هذه التجربة. هذه البيانات تظهر أنه استنادا إلى Z&#39;عامل، والجمع بين الكسور التدرج الجلسرين لها تأثير ضئيل على نوعية الفحص. <html> الحمار = &quot;jove_content&quot;&gt; تجربة مراقبة الممثل للفحص واستخدمت بيانات تمثيلية مقارنة عينات مراقبة مختلفة لتحليل المتغيرات في الفحص. كما هو مبين في الشكل (5)، وردود الفعل فقدان أي مكونات تحرير الحمض النووي الريبي (ردود الفعل 1-4) لا يلتصق الركيزة. ويلاحظ انشقاق الركيزة مقاسا مضان والنسبية النشاط التحرير إلا في وجود جميع مكونات ردود الفعل التحرير في حال عدم وجود المانع (رد فعل 5) أو في وجود جميع مكونات التحرير ومركب نشط (رد فعل 6). في المقابل، يمكن للمجمع المثبطة منع تحرير الحمض النووي الريبي، ويستخدم كعنصر تحكم إيجابية (رد فعل 7). هنا، كانت تستخدم الأسود جارح (MRB) ومركبات C53 كما الضوابط الإيجابية والسلبية، على التوالي. ghres.jpg &quot;العرض =&quot; 500 &quot;/&gt; الشكل 1. في المختبر فحص الحمض النووي الريبي التحرير القائم على ribozyme المطرقة. أ) الخطوة بخطوة التمثيل التخطيطي للفحص في المختبر التحرير القائم على مضان: (أ) تهجين من المطرقة ribozyme (تحرير قبل A6Rbz) تحريرها مسبقا مع دليل الحمض النووي الريبي لها (gA6Rbz). (ب) الاعتراف والتفاعل بين الحمض النووي الريبي مزدوج من قبل المجمع editosome المنقى. (ج) حذف تحرير الحمض النووي الريبي التي حفزتها editosome. (د) التفكك من A6Rbz تحريرها من editosome وgA6Rbz عن طريق التسخين في 85 درجة مئوية وإضافة دليل الحمض النووي الريبي منافس (gA6Rbz_comp). (ه) التهجين الركيزة الحنق مع المطرقة النشط ribozyme A6 (A6Rbz النشط). (و) ويظهر الكشف عن إشارات FAM التالية الانقسام الركيزة الحنق من قبل ribozyme نشطة. ب) ribozyme المطرقة تحريرها مسبقا (قبل تحريرها A6Rbz) بالتعاون مع gA6Rbz التي تحدد حذف ثلاثة بنا (ARRO برأسينث) من موقع التحرير (ES). نتيجة لتحرير الحمض النووي الريبي في وجود editosome وظيفية يتم تحرير ribozyme غير نشط في شكله النشط (تحرير A6Rbz) التي يمكن أن يلتصق الآن الركيزة الحنق (موقع الانقسام المشار إليها بواسطة السهم). وحفظها يتم تمييز 5&#39;-CUGA-3 &#39;من A6Rbz تحريرها في جوهر الحفاز الأساسية للنشاط ribozyme (موقع تحريرها) (تم تعديل هذا الرقم من مشيري 19). <a href="https://www-jove-com.remotexs.ntu.edu.sg/files/ftp_upload/51712/51712fig1highres.jpg" target="_blank">الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.</a> <img alt="الرقم 2" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig2highres.jpg" width="500" /> الشكل 2. إشارة إلى نسبة الضوضاء مقارنة بين ركائز الحنق إيواء quenchers مختلفة. Ribozyme (A6Rbz) النشاط باستخدام FAM / TAMRA (F / T) وFAM / أيوا الأسود فيصل القاسم (F / رطل) ركائز. وreprese المحور الصادياليلة مضان حدة التعسفي (FAU) في الدقيقة الواحدة. <img alt="الرقم 3" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig3highres.jpg" width="500" /> الرقم 3. النشاط تحرير الحمض النووي الريبي من كسور حدد الحصول عليها من الجلسرين التدرج الطرد المركزي من المحللة الميتوكوندريا. جزء رقم 9 (F9) لديها أعلى نشاط. يمثل المحور الصادي النشاط التحرير النسبي في نسبة، معتبرا F9 إلى 100٪. <img alt="الرقم 4" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig4highres.jpg" width="500" /> تم الحصول على الرقم 4. حساب Z&#39;عامل باستخدام الكسور الأكثر نشاطا (F8 F9 + + F10) كمصدر editosome. الاختلاف التجريبية من 72 مكررات لكل نوع من التفاعل. تم حساب Z&#39;عامل 0.6. يمثل المحور الصادي النشاط التحرير النسبي. <img alt="الرقم 5" fo:content-width="5in" src="/files/ftp_upload/51712/51712fig5highres.jpg" width="500" /> الرقم 5. تجربة الممثل لمضان القائم على RNA التحرير الفحص. أجريت ردود الفعل في الحجم النهائي من 20 ميكرولتر لكل بئر وCFX384 TouchTM الوقت الحقيقي PCR نظام الكشف كان يستخدم لقياس إشارة مضان. ويعرض الرسم البياني الضوابط المختلفة بالإضافة إلى رد فعل التحرير الكامل الذي يحتوي على جميع المكونات اللازمة للفحص (# 5). تم قياس مضان في وجود الركيزة الحنق وحده (رقم 1) لتقييم سلامة الركيزة. تم تنفيذ نموذج رقم 2 في غياب editosome لرصد أي نشاط ribozyme قبل التحرير. لتقييم تأثير editosome التشويه والتحريف على الركيزة، تم قياس مضان في وجود editosome والحنق الركيزة فقط (# 3). لاختبار الموجه دليل تحرير خصوصية، وسام<html> التنوير القائل في غياب gA6Rbz كان يستخدم (رقم 4). A غير المثبطة (C53، رقم 6) ومركب المثبطة (MRB، ​​رقم 7) كانت تستخدم لاختبار تأثير على فحص التحرير. في حين تحول دون تحرير الحمض النووي الريبي بشكل كبير من MRB، C53 لديها تأثير يذكر. أشرطة الخطأ تتوافق مع اختلاف التجريبية (الانحراف المعياري) بين 10 مكررات. يمثل المحور الصادي النشاط التحرير النسبي في نسبة، معتبرا أن رد فعل كاملة (# 5) إلى 100٪. <table border="0" cellpadding="0" cellspacing="0" width="614" style=";text-align:right;direction:rtl"><tbody><tr><td></td><td> 10٪ </td><td> 30٪ </td></tr><tr><td> 2X العازلة HHE التدرج </td><td> 5 مل </td><td> 5 مل </td></tr><tr><td> الغليسيرول </td><td> 1 مل </td><td> 3 مل </td></tr><tr><td> DEPC H 2 O </td><td> 4 مل </td><td> 2 مل </td></tr><tr><td> 1 M DTT </td><td> 10 ميكرولتر </td><td> 10 ميكرولتر </td></tr></tbody></table>ن = صفحة &quot;دائما&quot;&gt; الجدول رقم 1. 10٪ وبنسبة 30٪ الجلسرين الحل (10ML لكل منهما). <table border="0" cellpadding="0" cellspacing="0" width="600" style=";text-align:right;direction:rtl"><tbody><tr><td colspan="2"> قبل تحرير A6 Ribozyme (preA6Rbz) </td></tr><tr><td> قالب preA6Rbz الحمض النووي </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCA TCAAAAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTT CC CCCTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> preA6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUUUUGAUGAGUCCGUGAGGACGAAACAAUAGA UCAAAUGU-3 &#39; </td></tr><tr><td> RNA الأسهم اضرب. </td><td> 1 ميكرومتر </td></tr><tr><td colspan="2"> دليل A6 Ribozyme (gA6Rbz) </td></tr><tr><td> قالب gA6RBz الحمض النووي </td><td> 5&#39;-AAAAAAAAAAAAAAAAATAATTATCATATCACTGT CAAGGGAAAGTTGTGAGGGTGATGAGTCCGTGTATATCC CC CTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> gA6Rbz RNA </td><td> 5&#39;-GGGAUAUACACGGACUCAUCACCCUCACAACUU UCCCUUGACAGUGAUAUGAUAAUUAUUUUUUUUUUUUUUUUU-3 &#39; </td></tr><tr><td> RNA الأسهم اضرب. </td><td> 2.5 ميكرومتر </td></tr><tr><td colspan="2"> دليل A6 Ribozyme المنافس (gA6RBz_comp) </td></tr><tr><td> قالب gA6Rbz_comp الحمض النووي </td><td> 5&#39;-GGATATACACGGACTCATCACCCTCACAACTTTC CCTTGACAGTGATATGATAATTATTTTTTTTTTTTTTTTT CCCTAT AGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> gA6Rbz_comp RNA </td><td> 5&#39;-AAAAAAAAAAAAAAAAAUAAUUAUCAUAUCACUG UCAAGGGAAGUUGUGAGGGUGAUGAGUCCGUGUAUAUCC-3 &#39; </td></tr><tr><td> RNA الأسهم اضرب. </td><td> 12.5 ميكرومتر </td></tr><tr><td colspan="2"> نشط A6 Ribozyme (A6RBz) </td></tr><tr><td> قالب الحمض النووي A6Rbz </td><td> 5&#39;-ACATTTGATCTATTGTTTCGTCCTCACGGACTCAT CAGTCACAACTTTCCCTTTCTCTCCTCCCCCTAACCTTTCC CC CTATAGTGAGTCGTATTA -3 &#39; </td></tr><tr><td> A6Rbz RNA </td><td> 5&#39;-GGGAAAGGUUAGGGGGAGGAGAGAAAGGGAAA GUUGUGACUGAUGAGUCCGUGAGGACGAAACAAUAGAUCA AAUGU-3 &#39; </td></tr><tr><td> RNA الأسهم اضرب. </td><td> 1 ميكرومتر </td></tr><tr><td colspan="2"> الحنق الركيزة </td></tr><tr><td> TAMRA فاكهه تقضي </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA-TAMRA-3 &#39;(Eurogentec) </td></tr><tr><td> أيوا الأسود فاكهه تقضي </td><td> 5&#39;-FAM-GAUCUAUUGUCUCACA-أيوا الأسود 3 &#39;(IDT) </td></tr><tr><td> RNA الأسهم اضرب. </td><td> 15 ميكرومتر (على حد سواء) </td></tr></tbody></table> الجدول 2. قوالب الحمض النووي والحمض النووي الريبي ركائز. <table border="0" cellpadding="0" cellspacing="0" style=";text-align:right;direction:rtl"><tbody><tr><td> تركيب </td><td> رد فعل التحرير (ميكرولتر) </td></tr><tr><td> 10X HHE </td><td> 1.5 </td></tr><tr><td> 0.1 M و CaCl 2 </td><td> 1 </td></tr><tr><td> 100 ملي ATP </td><td> 0.2 </td></tr><tr><td> 10٪ Tritonx-100 </td><td> 0.2 </td></tr><tr><td> 500 نانوغرام / ميكرولتر الحمض النووي الريبي المستخفية الخميرة </td><td> 1 </td></tr><tr><td> Editosome </td><td> 5 </td></tr><tr><td> ريبونوكلياز مجانا H 2 O </td><td> 7.1 </td></tr><tr><td> 1 ميكرومتر preA6Rbz </td><td> 1 </td></tr><tr><td> 2.5 ميكرومتر gA6Rbz </td><td> 1 </td></tr><tr><td> مجموع </td><td> 18 </td></tr></tbody></table> الجدول 3. تكوين رد الفعل، وماجستير ميكس.

Watch this Scientific Journal Video about RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes at JoVE.com

RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

RNA محفز كمراسلة لفحص الحمض النووي الريبي أدوية ضد التحرير في المثقبيات

Substantial progress has been made in determining the mechanism of mitochondrial RNA editing in trypanosomes. Similarly, considerable progress has been ...

rna-catalyst-as-reporter-for-screening-drugs-against-rna-editing

Nanyang Technological University

Research

JoVE Journal

Biology

8.4K Views.  McGill University. A highly sensitive ribozyme-based assay, applicable to high-throughput screening of chemicals targeting the unique process of RNA editing in trypanosomatid pathogens, is described in this paper. Inhibitors can be used as tools for hypothesis-driven analysis of the RNA editing process and ultimately as therapeutics.

Video: RNA Catalyst as a Reporter for Screening Drugs against RNA Editing in Trypanosomes

Visualizing RNA Localization in Xenopus Oocytes

RNA localization is a conserved mechanism of establishing cell polarity. Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to spatially restrict gene expression of Vg1 protein. Tight control of Vg1 distribution in this manner is required for proper germ layer specification in the developing embryo. RNA sequence elements in the 3' UTR of the mRNA, the Vg1 localization element (VLE) are required and sufficient to direct transport. To study the recognition and transport of Vg1 mRNA in vivo, we have developed an imaging technique that allows extensive analysis of trans-factor directed transport mechanisms via a simple visual readout. 
To visualize RNA localization, we synthesize fluorescently labeled VLE RNA and microinject this transcript into individual oocytes. After oocyte culture to allow transport of the injected RNA, oocytes are fixed and dehydrated prior to imaging by confocal microscopy. Visualization of mRNA localization patterns provides a readout for monitoring the complete pathway of RNA transport and for identifying roles in directing RNA transport for cis-acting elements within the transcript and trans-acting factors that bind to the VLE (Lewis et al., 2008, Messitt et al., 2008). We have extended this technique through co-localization with additional RNAs and proteins (Gagnon and Mowry, 2009, Messitt et al., 2008), and in combination with disruption of motor proteins and the cytoskeleton (Messitt et al., 2008) to probe mechanisms underlying mRNA localization.

Visualizing RNA Localization in Xenopus Oocytes

Visualization of in vivo RNA transport is accomplished by microinjection of fluorescently labeled RNA transcripts into Xenopus oocytes, followed by confocal microscopy.

تصور التعريب في الحمض النووي الريبي القيطم البويضات

RNA localization is a conserved mechanism of establishing cell polarity.  Vg1 mRNA localizes to the vegetal pole of Xenopus laevis oocytes and acts to ...

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence (T7, T3, SP6) and the gene to be transcribed (Figure 1A). A typical transcription reaction consists of the template DNA, RNA polymerase, ribonucleotide triphosphates, RNase inhibitor and buffer containing Mg2+ ions.
Large amounts of high quality RNA are often required for a variety of applications. Use of in vitro transcription has been reported for RNA structure and function studies such as splicing1, RNAi experiments in mammalian cells2, antisense RNA amplification by the "Eberwine method"3, microarray analysis4 and for RNA vaccine studies5. The technique can also be used for producing radiolabeled and dye labeled probes6. Warren, et al. recently reported reprogramming of human cells by transfection with in vitro transcribed capped RNA7. The T7 High Yield RNA Synthesis Kit from New England Biolabs has been designed to synthesize up to 180 &mu;g RNA per 20 &mu;l reaction. RNA of length up to 10kb has been successfully transcribed using this kit. Linearized plasmid DNA, PCR products and synthetic DNA oligonucleotides can be used as templates for transcription as long as they have the T7 promoter sequence upstream of the gene to be transcribed.
Addition of a 5' end cap structure to the RNA is an important process in eukaryotes. It is essential for RNA stability8, efficient translation9, nuclear transport10 and splicing11. The process involves addition of a 7-methylguanosine cap at the 5' triphosphate end of the RNA. RNA capping can be carried out post-transcriptionally using capping enzymes or co-transcriptionally using cap analogs. In the enzymatic method, the mRNA is capped using the Vaccinia virus capping enzyme12,13. The enzyme adds on a 7-methylguanosine cap at the 5' end of the RNA using GTP and S-adenosyl methionine as donors (cap 0 structure). Both methods yield functionally active capped RNA suitable for transfection or other applications14 such as generating viral genomic RNA for reverse-genetic systems15 and crystallographic studies of cap binding proteins such as eIF4E16.
In the method described below, the T7 High Yield RNA Synthesis Kit from NEB is used to synthesize capped and uncapped RNA transcripts of Gaussia luciferase (GLuc) and Cypridina luciferase (CLuc). A portion of the uncapped GLuc RNA is capped using the Vaccinia Capping System (NEB). A linearized plasmid containing the GLuc or CLuc gene and T7 promoter is used as the template DNA. The transcribed RNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity. Capped CLuc RNA is used as the internal control to normalize GLuc expression.

In vitro Transcription and Capping of Gaussia Luciferase mRNA Followed by HeLa Cell Transfection

This method describes high yield in vitro synthesis of both capped and uncapped mRNA from a linearized plasmid containing the Gaussia luciferase (GLuc) gene. The RNA is purified and a fraction of the uncapped RNA is enzymatically capped using the Vaccinia virus capping enzyme. In the final step, the mRNA is transfected into HeLa cells and cell culture supernatants are assayed for luciferase activity.

في المختبر، والسد النسخ من مرنا luciferase المراسل Gaussia تلاه ترنسفكأيشن الخلية هيلا

In vitro transcription is the synthesis of RNA transcripts by RNA polymerase from a linear DNA template containing the corresponding promoter sequence ...

Chromatin Isolation by RNA Purification (ChIRP)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental gene expression 1,2,3,4,5,6,7. The recent discovery of thousands of lncRNAs in association with specific chromatin modification complexes, such as Polycomb Repressive Complex 2 (PRC2) that mediates histone H3 lysine 27 trimethylation (H3K27me3), suggests broad roles for numerous lncRNAs in managing chromatin states in a gene-specific fashion 8,9. While some lncRNAs are thought to work in cis on neighboring genes, other lncRNAs work in trans to regulate distantly located genes. For instance, Drosophila lncRNAs roX1 and roX2 bind numerous regions on the X chromosome of male cells, and are critical for dosage compensation 10,11. However, the exact locations of their binding sites are not known at high resolution. Similarly, human lncRNA HOTAIR can affect PRC2 occupancy on hundreds of genes genome-wide 3,12,13, but how specificity is achieved is unclear. LncRNAs can also serve as modular scaffolds to recruit the assembly of multiple protein complexes. The classic trans-acting RNA scaffold is the TERC RNA that serves as the template and scaffold for the telomerase complex 14; HOTAIR can also serve as a scaffold for PRC2 and a H3K4 demethylase complex 13.
Prior studies mapping RNA occupancy at chromatin have revealed substantial insights 15,16, but only at a single gene locus at a time. The occupancy sites of most lncRNAs are not known, and the roles of lncRNAs in chromatin regulation have been mostly inferred from the indirect effects of lncRNA perturbation. Just as chromatin immunoprecipitation followed by microarray or deep sequencing (ChIP-chip or ChIP-seq, respectively) has greatly improved our understanding of protein-DNA interactions on a genomic scale, here we illustrate a recently published strategy to map long RNA occupancy genome-wide at high resolution 17. This method, Chromatin Isolation by RNA Purification (ChIRP) (Figure 1), is based on affinity capture of target lncRNA:chromatin complex by tiling antisense-oligos, which then generates a map of genomic binding sites at a resolution of several hundred bases with high sensitivity and low background. ChIRP is applicable to many lncRNAs because the design of affinity-probes is straightforward given the RNA sequence and requires no knowledge of the RNA's structure or functional domains.

Chromatin Isolation by RNA Purification ChIRP

ChIRP is a novel and rapid technique to map genomic binding sites of long noncoding RNAs (lncRNAs). The method takes advantage of the specificity of anti-sense tiling oligonucleotides to allow the enumeration of lncRNA-bound genomic sites.

لونين عزل من قبل تنقية الحمض النووي الريبي (السقسقة)

Long noncoding RNAs are key regulators of chromatin states for important biological processes such as dosage compensation, imprinting, and developmental ...

Electroantennographic Bioassay as a Screening Tool for Host Plant Volatiles

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host plant.1,2 When a host plant is an important agronomic commodity feeding damage by insect pests can inflict serious economic losses to growers. Accordingly, kairomones can be used as attractants to lure or confuse these insects and, thus, offer an environmentally friendly alternative to pesticides for insect control.3 Unfortunately, plants can emit a vast number volatiles with varying compositions and ratios of emissions dependent upon the phenology of the commodity or the time of day. This makes identification of biologically active components or blends of volatile components an arduous process. To help identify the bioactive components of host plant volatile emissions we employ the laboratory-based screening bioassay electroantennography (EAG). EAG is an effective tool to evaluate and record electrophysiologically the olfactory responses of an insect via their antennal receptors. The EAG screening process can help reduce the number of volatiles tested to identify promising bioactive components. However, EAG bioassays only provide information about activation of receptors. It does not provide information about the type of insect behavior the compound elicits; which could be as an attractant, repellent or other type of behavioral response. Volatiles eliciting a significant response by EAG, relative to an appropriate positive control, are typically taken on to further testing of behavioral responses of the insect pest. The experimental design presented will detail the methodology employed to screen almond-based host plant volatiles4,5 by measurement of the electrophysiological antennal responses of an adult insect pest navel orangeworm (Amyelois transitella) to single components and simple blends of components via EAG bioassay. The method utilizes two excised antennae placed across a "fork" electrode holder. The protocol demonstrated here presents a rapid, high-throughput standardized method for screening volatiles. Each volatile is at a set, constant amount as to standardize the stimulus level and thus allow antennal responses to be indicative of the relative chemoreceptivity. The negative control helps eliminate the electrophysiological response to both residual solvent and mechanical force of the puff. The positive control (in this instance acetophenone) is a single compound that has elicited a consistent response from male and female navel orangeworm (NOW) moth. An additional semiochemical standard that provides consistent response and is used for bioassay studies with the male NOW moth is (Z,Z)-11,13-hexdecadienal, an aldehyde component from the female-produced sex pheromone.6-8

A method to rapidly screen host plant volatiles by measurement of the electrophysiological response of adult navel orangeworm (Amyelois transitella) antennae to single components and blends via electroantennographic analysis is demonstrated.

Electroantennographic الأحيائي كأداة فحص لمواد متطايرة النبات المضيف

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host ...

Substrate Generation for Endonucleases of CRISPR/Cas Systems

The interaction of viruses and their prokaryotic hosts shaped the evolution of bacterial and archaeal life. Prokaryotes developed several strategies to evade viral attacks that include restriction modification, abortive infection and CRISPR/Cas systems. These adaptive immune systems found in many Bacteria and most Archaea consist of clustered regularly interspaced short palindromic repeat (CRISPR) sequences and a number of CRISPR associated (Cas) genes (Fig. 1) 1-3. Different sets of Cas proteins and repeats define at least three major divergent types of CRISPR/Cas systems 4. The universal proteins Cas1 and Cas2 are proposed to be involved in the uptake of viral DNA that will generate a new spacer element between two repeats at the 5' terminus of an extending CRISPR cluster 5. The entire cluster is transcribed into a precursor-crRNA containing all spacer and repeat sequences and is subsequently processed by an enzyme of the diverse Cas6 family into smaller crRNAs 6-8. These crRNAs consist of the spacer sequence flanked by a 5' terminal (8 nucleotides) and a 3' terminal tag derived from the repeat sequence 9. A repeated infection of the virus can now be blocked as the new crRNA will be directed by a Cas protein complex (Cascade) to the viral DNA and identify it as such via base complementarity10. Finally, for CRISPR/Cas type 1 systems, the nuclease Cas3 will destroy the detected invader DNA 11,12 .
These processes define CRISPR/Cas as an adaptive immune system of prokaryotes and opened a fascinating research field for the study of the involved Cas proteins. The function of many Cas proteins is still elusive and the causes for the apparent diversity of the CRISPR/Cas systems remain to be illuminated. Potential activities of most Cas proteins were predicted via detailed computational analyses. A major fraction of Cas proteins are either shown or proposed to function as endonucleases 4.
Here, we present methods to generate crRNAs and precursor-cRNAs for the study of Cas endoribonucleases. Different endonuclease assays require either short repeat sequences that can directly be synthesized as RNA oligonucleotides or longer crRNA and pre-crRNA sequences that are generated via in vitro T7 RNA polymerase run-off transcription. This methodology allows the incorporation of radioactive nucleotides for the generation of internally labeled endonuclease substrates and the creation of synthetic or mutant crRNAs. Cas6 endonuclease activity is utilized to mature pre-crRNAs into crRNAs with 5'-hydroxyl and a 2',3'-cyclic phosphate termini.

CRISPR/Cas systems mediate adaptive immunity in Bacteria and Archaea. Many Cas proteins are proposed to act as endoribonucleases acting on crRNA precursors of varying length. Here we illustrate three different approaches to generate pre-crRNA substrates for the biochemical analysis of Cas endonuclease activity.

الجيل الركيزة لEndonucleases من CRISPR / كاس أنظمة

The  interaction of viruses and their prokaryotic hosts shaped the evolution of  bacterial and archaeal life. Prokaryotes developed several strategies to ...

Depletion of Ribosomal RNA for Mosquito Gut Metagenomic RNA-seq

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity and functionality of the gut community will provide insight into the effects of gut microbiota on mosquito life traits. Metagenomic RNA-Seq has become an important tool to analyze transcriptomes from various microbes present in a microbial community. Messenger RNA usually comprises only 1-3% of total RNA, while rRNA constitutes approximately 90%. It is challenging to enrich messenger RNA from a metagenomic microbial RNA sample because most prokaryotic mRNA species lack stable poly(A) tails. This prevents oligo d(T) mediated mRNA isolation. Here, we describe a protocol that employs sample derived rRNA capture probes to remove rRNA from a metagenomic total RNA sample. To begin, both mosquito and microbial small and large subunit rRNA fragments are amplified from a metagenomic community DNA sample. Then, the community specific biotinylated antisense ribosomal RNA probes are synthesized in vitro using T7 RNA polymerase. The biotinylated rRNA probes are hybridized to the total RNA. The hybrids are captured by streptavidin-coated beads and removed from the total RNA. This subtraction-based protocol efficiently removes both mosquito and microbial rRNA from the total RNA sample. The mRNA enriched sample is further processed for RNA amplification and RNA-Seq.

A ribosomal RNA (rRNA) depletion protocol was developed to enrich messenger RNA (mRNA) for RNA-seq of the mosquito gut metatranscriptome. Sample specific rRNA probes, which were used to remove rRNA via subtraction, were created from the mosquito and its gut microbes. Performance of the protocol can result in the removal of approximately 90-99% of rRNA.

استنزاف الحمض النووي الريبي الريباسي لMetagenomic الوتر البعوض RNA-يليها

The mosquito gut accommodates dynamic microbial communities across different stages of the insect's life cycle. Characterization of the genetic capacity ...

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

Marine elasmobranchs are valued animal models for biomedical and genomic studies as they are the most primitive vertebrates to have adaptive immunity and have unique mechanisms for osmoregulation 1-3. As the most primitive living jawed-vertebrates with paired appendages, elasmobranchs are an evolutionarily important model, especially for studies in evolution and development. Marine elasmobranchs have also been used to study aquatic toxicology and stress physiology in relationship to climate change 4. Thus, development and adaptation of methodologies is needed to facilitate and expand the use of these primitive vertebrates to multiple biological disciplines. Here I present the successful adaptation of RNA whole mount in situ hybridization and histological techniques to study gene expression and cell histology in elasmobranchs.
Monitoring gene expression is a hallmark tool of developmental biologists, and is widely used to investigate developmental processes 5. RNA whole mount in situ hybridization allows for the visualization and localization of specific gene transcripts in tissues of the developing embryo. The expression pattern of a gene's message can provide insight into what developmental processes and cell fate decisions a gene may control. By comparing the expression pattern of a gene at different developmental stages, insight can be gained into how the role of a gene changes during development.
While whole mount in situ's provides a means to localize gene expression to tissue, histological techniques allow for the identification of differentiated cell types and tissues. Histological stains have varied functions. General stains are used to highlight cell morphology, for example hematoxylin and eosin for general staining of nuclei and cytoplasm, respectively. Other stains can highlight specific cell types. For example, the alcian blue stain reported in this paper is a widely used cationic stain to identify mucosaccharides. Staining of the digestive tract with alcian blue can identify the distribution of goblet cells that produce mucosaccharides. Variations in mucosaccharide constituents on short peptides distinguish goblet cells by function within the digestive tract 6. By using RNA whole mount in situ's and histochemical methods concurrently, cell fate decisions can be linked to gene-specific expression.
Although RNA in situ's and histochemistry are widely used by researchers, their adaptation and use in marine elasmobranchs have met limited and varied success. Here I present protocols developed for elasmobranchs and used on a regular basis in my laboratory. Although further modification of the RNA in situ's hybridization method may be needed to adapt to different species, the protocols described here provide a strong starting point for researchers wanting to adapt the use of marine elasmobranchs to their scientific inquiries.

RNA In situ Hybridization in Whole Mount Embryos and Cell Histology Adapted for Marine Elasmobranchs

By combining methods for RNA whole mount in situ hybridization and histology, gene expression can be linked with cell fate decisions in the developing embryo. These methods have been adapted to marine elasmobranchs and facilitate the use of these animals as model organisms for biomedical, toxicology and comparative studies.

RNA<em&gt; في الموقع</em&gt; التهجين في الأجنة جبل الجامعة وعلم الأنسجة الخلية مقتبس عن Elasmobranchs البحرية

Marine  elasmobranchs are valued animal models for biomedical and genomic studies as  they are the most primitive vertebrates to have adaptive immunity ...

A Chemical Screening Procedure for Glucocorticoid Signaling with a Zebrafish Larva Luciferase Reporter System

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids can lead to severe side effects. Test systems are needed to search for novel compounds influencing glucocorticoid signaling in vivo or to determine unwanted effects of compounds on the glucocorticoid signaling pathway. We have established a transgenic zebrafish assay which allows the measurement of glucocorticoid signaling activity in vivo and in real-time, the GRIZLY assay (Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY). The luciferase-based assay detects effects on glucocorticoid signaling with high sensitivity and specificity, including effects by compounds that require metabolization or affect endogenous glucocorticoid production. We present here a detailed protocol for conducting chemical screens with this assay. We describe data acquisition, normalization, and analysis, placing a focus on quality control and data visualization. The assay provides a simple, time-resolved, and quantitative readout. It can be operated as a stand-alone platform, but is also easily integrated into high-throughput screening workflows. It furthermore allows for many applications beyond chemical screening, such as environmental monitoring of endocrine disruptors or stress research.

We describe the procedure and data analysis of a chemical screening system for glucocorticoid stress hormone signaling using zebrafish larvae: the Glucocorticoid Responsive In vivo Zebrafish Luciferase activitY (GRIZLY) assay. The assay sensitively and specifically detects effects on glucocorticoid signaling by compounds that require metabolization or affect endogenous glucocorticoid production.

Glucocorticoid stress hormones and their artificial derivatives are widely used drugs to treat inflammation, but long-term treatment with glucocorticoids ...

A Method for Screening and Validation of Resistant Mutations Against Kinase Inhibitors

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the potential of targeting the kinase in cancers by effectively treating the CML patients. This observation revolutionized drug development to target the oncogenic kinases implicated in various other malignancies, such as, EGFR, B-RAF, KIT and PDGFRs. However, one major drawback of anti-kinase therapies is the emergence of drug resistance mutations rendering the target to have reduced or lost affinity for the drug. Understanding the mechanisms employed by resistant variants not only helps in developing the next generation inhibitors but also gives impetus to clinical management using personalized medicine. We reported a retroviral vector based screening strategy to identify the spectrum of resistance conferring mutations in BCR/ABL, which has helped in developing the next generation BCR/ABL inhibitors. Using Ruxolitinib and JAK2 as a drug target pair, here we describe in vitro screening methods that utilizes the mouse BAF3 cells expressing the random mutation library of JAK2 kinase.

Emergence of genetic resistance against kinase inhibitor therapy poses significant challenge for effective cancer therapy. Identification and characterization of resistant mutations against a newly developed drug helps in better clinical management and next generation drug design. Here, we describe our protocol for in vitro screening and validation of resistant mutations.

وهناك طريقة لفحص والتحقق من الطفرات المقاومة ضد كيناز مثبطات

The discovery of BCR/ABL as a driver oncogene in chronic myeloid leukemia (CML) resulted in the development of Imatinib, which, in fact, demonstrated the ...

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression regulation at posttranscriptional levels by affecting the stability and translational efficiency of target mRNAs. RNA pull-down technique has been widely used to study RNA-protein interaction, which is necessary to elucidate the mechanism underlying RBPs&#39; as well as long non-coding RNAs&#39; (lncRNAs) function. However, the high lipid abundance in adipocytes poses a technical challenge in conducting this experiment. Here a detailed RNA pull-down protocol is optimized for primary adipocyte culture. An RNA fragment from androgen receptor&#39;s (AR) 3&#39; untranslated region (3&#39;UTR) containing an adenylate-uridylate-rich elementwas used as an example to demonstrate how to retrieve its RBP partner, HuR protein, from adipocyte lystate. The method described here can be applied to detect the interactions between RBPs and noncoding RNAs, as well as between RBPs and coding RNAs.

Detection of RNA-binding Proteins by In Vitro RNA Pull-down in Adipocyte Culture

An RNA pull-down protocol is optimized here for detection of interactions between RNA-binding proteins (RBPs) and noncoding as well as coding RNAs. An RNA fragment from androgen receptor (AR) was used as an example to demonstrate how to retrieve its RBP from lystate of primary brown adipocytes.

الكشف عن البروتينات ملزمة الحمض النووي الريبي<em&gt; في المختبر</em&gt; RNA المنسدلة في خلية شحمية الثقافة

RNA-binding proteins (RBPs) are emerging as a regulatory layer in the development and function of adipose. RBPs play a key role in the gene expression ...